Prosecution Insights
Last updated: October 04, 2026
Application No. 16/098,845

GENETICALLY ENGINEERED CELLS AND METHODS OF MAKING THE SAME

Final Rejection §101§103§112
Filed
Nov 02, 2018
Priority
May 06, 2016 — provisional 62/332,657 +2 more
Examiner
VIVLEMORE, TRACY ANN
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Editas Medicine Inc.
OA Round
8 (Final)
73%
Grant Probability
Favorable
9-10
OA Rounds
0m
Est. Remaining
80%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allowance Rate
531 granted / 727 resolved
+13.0% vs TC avg
Moderate +7% lift
Without
With
+6.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
66 currently pending
Career history
798
Total Applications
across all art units

Statute-Specific Performance

§101
4.4%
-35.6% vs TC avg
§103
34.2%
-5.8% vs TC avg
§102
19.4%
-20.6% vs TC avg
§112
24.0%
-16.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 727 resolved cases

Office Action

§101 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Detailed Action This action is in response to the papers filed March 3, 2026. Amendments Applicant's response and amendment, filed March 3, 2026, to the prior Office Action is acknowledged. Applicant has cancelled Claims 1-161, 163-386, 394-397, 404-407, 409-410, 418-419, and 426, amended Claims 162, 389, 408, 417, and 420-425, and added new claims, Claims 427-429 Claims 162, 387-393, 398-403, 408, 411-417, 420-425, and 427-429 are pending. Election/Restrictions Applicant has elected without traverse the invention of Group III, claim(s) 162, 188, and 196, drawn to a method of altering a T cell, the method comprising the step(s) of contacting the T cell with one or more Cas9 molecule/gRNA molecule complexes comprising a targeting domain which is complementary with a target domain from the PDCD1 gene. Within Group III, Applicant has elected without traverse the following species, wherein: i) the alternative target antigen to which the recombinant receptor specifically binds is CD19, as recited in Claim 392; and ii) the disease or disorder to be treated corresponding to the above-elected target antigen to which the recombinant receptor specifically binds is chronic lymphocytic leukemia (CLL), as recited in Claim 387. Applicant has amended the independent claims to require the presence of a PDCD1 gRNA, a TRAC gRNA, and a TRBC gRNA. Thus, the prior gRNA species restriction is withdrawn. Claims 162, 387-393, 398-403, 408, 411-417, 420-425, and 427-429 are pending and under consideration. Priority This application is a 371 of PCT/US2017/031464 filed on May 6, 2017. Applicant’s claim for the benefit of a prior-filed application provisional application 62/333,144 filed on May 6, 2016 and 62/332,657 filed on May 6, 2016 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. 1. Claims 162, 387-393, 398-403, 408, 411-417, 420-425, and 427-429 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more. Applicant has amended the independent claims to recite a method of altering a T cell (singular), comprising the step(s) of: i) contacting the T cell (singular) with a Cas9 molecule and gRNA molecules; and ii) electroporating the T cell (singular), thereby introducing the Cas9 molecule and gRNA molecules into the T cell, wherein the method yields at least 40% viability of the T cell. Instant recitation is considered to be directed to the judicial exception of abstract thought because those of ordinary skill in the art immediately recognize that, per natural law of biology, the T cell is only alive (syn. viable) or dead. There is no partial viability, e.g. not more than 40%, not more than 50%, etc… Rather, the recited % viability is directed to the T cell population (plural) as a whole, as admitted by Applicant, per Example 10. See also 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections below for further discussion. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite: i) “altering a T cell population” in the preamble, ii) electroporating the T cell population in step (ii); and iii) “wherein the T cell population has a viability of…”. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. 2. The prior rejection of Claims 162, 387-393, 396, 398-403, 408, 411-417, and 420-426 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments to the independent claims cancelling recitation of “as set forth in”, and instead recites “the….sequences of SEQ ID NO”, which the Examiner finds persuasive. 3. The prior rejection of Claims 420-421 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments to the claims, which the Examiner finds persuasive. 4. Claims 162, 387-393, 398-403, 408, 411-417, and 420-425 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). Applicant has amended the independent claims to recite the step of introducing into the T cells by electroporation a Cas9 molecule. Applicant has amended dependent Claims 423-425 to recite wherein the Cas9 molecule is encoded by a DNA molecule or an mRNA. The term “Cas9 molecule” in the independent claims is indefinite because Applicant’s amendments introduce a new, broadening, definition into the terms, and the specification does not clearly redefine the term to encompass the broadening definition. See also 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection, below. Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. The specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid is not a Cas9 molecule. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that amendments to Claims 423-425 render the rejection moot. Applicant’s argument(s) has been fully considered, but is not persuasive. Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. While the specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid encoding Cas9, and the mRNA encoding Cas9, is/are not a Cas9 molecule (protein). See also 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, rejection, below. 5. Claims 423-425 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection. Applicant has amended the independent claims to recite the step of introducing into the T cells by electroporation a Cas9 molecule. Applicant has amended dependent Claims 423-425 to recite wherein the Cas9 molecule is encoded by a DNA molecule or an mRNA. Dependent claims fail to further limit the independent claims because, as discussed above, those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. While the specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid encoding Cas9, and the mRNA encoding Cas9, is/are not a Cas9 molecule (protein). Dependent claims are broader in scope than the independent claims. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. New matter 6. Claim(s) 162, 387-393, 398-403, 408, 411-417, and 420-425 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant has amended the independent claims to recite the step of introducing into the T cells by electroporation a Cas9 molecule. Applicant has amended dependent Claims 423-425 to recite wherein the Cas9 molecule is encoded by a DNA molecule or an mRNA. Applicant’s amendments introduce a new, broadening, definition into the terms, and the specification does not clearly redefine the term to encompass the broadening definition. See also 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection above. Clear support for the new limitation(s) cannot be found in the instant application or priority documents. Accordingly, the amendment(s) to the claims is/are considered to constitute new matter. MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).” MPEP 2163.02 teaches that “Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application”. MPEP 2163.06 further notes “When an amendment is filed in reply to an objection or rejection based on 35 U.S.C. 112, first paragraph, a study of the entire application is often necessary to determine whether or not “new matter” is involved. Applicant should therefore specifically point out the support for any amendments made to the disclosure” (emphasis added). Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. The specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid is not a Cas9 molecule. Applicant fails to point out with particularity where support for the amended independent claims and dependent Claims 423-425 changing the definition of “Cas9 molecule” is found in the originally-filed application. If Applicant believes that support for the new limitation(s), as now recited in Claim(s) 423-425, is present and clearly envisaged in the instant application or earlier filed priority documents, applicant must, in responding to this Office Action, point out with particularity, where such support may be found. Declarations and new references cannot demonstrate possession of a concept after the fact. Applicant does not indicate where these limitations are supported by the original specification, or how, as is Applicant's burden. See MPEP §714.02, last sentence of the third paragraph from the end and MPEP §2163.06 (I) last sentence. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that amendments to Claims 423-425 render the rejection moot. Applicant’s argument(s) has been fully considered, but is not persuasive. Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. While the specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid encoding Cas9, and the mRNA encoding Cas9, is/are not a Cas9 molecule (protein). 7. Claims 162, 387-393, 398-403, 408, 411-417, 420-425, and 427-429 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as failing to set forth the subject matter which the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the applicant regards as the invention. Evidence that the claims fail(s) to correspond in scope with that which the inventor or a joint inventor, or for pre-AIA applications the applicant regards as the invention can be found in the reply filed March 3, 2026. In that paper, the inventor or a joint inventor, or for pre-AIA applications the applicant has stated that “The claims require…introduction of the Cas9 molecule and the gRNAs comprising both a 5’ ARCA cap and a 3’ polyA tail into T cells—by electroporation….presented in Example 10 and Figure 20”, “the evidence directly corresponds to the scope of the instant claims, the unexpected results showing satisfies the commensurability requirement”, and “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation—under conditions that yield a T cell viability of 40% or more….presented in Example 10”, and these statements indicate that the invention is different from what is defined in the claim(s). As a first matter, independent claims are directed to altering a T cell (singular), comprising the step(s) of: i) contacting the T cell (singular) with a Cas9 molecule and gRNA molecules; and ii) electroporating the T cell (singular), thereby introducing the Cas9 molecule and gRNA molecules into the T cell. Those of ordinary skill in the art immediately recognize that, per natural law of biology, the T cell is only alive (syn. viable) or dead. There is no partial viability, e.g. not more than 40%, not more than 50%, etc… Rather, the recited % viability is directed to the T cell population (plural) as a whole, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation”. See also 35 U.S.C. 101 rejection above. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite: i) “altering a T cell population” in the preamble, ii) electroporating the T cell population in step (ii); and iii) “wherein the T cell population has a viability of …”. As a second matter, instant independent claims recite the % viability referring back to the contacting step (step (i)), not the electroporation step (step (ii)). Those of ordinary skill in the art immediately recognize that these are not the same steps. Rather, the recited % viability is directed to the electroporation step, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation”. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite “wherein the T cell population has a viability… upon electroporation”. As a third matter, as discussed above, instant independent claims recite the step of introducing a Cas9 molecule (protein) into the T cell. Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. While the specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid encoding Cas9, and the mRNA encoding Cas9, is/are not a Cas9 molecule (protein). See above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejections. Rather, the recited % viability of Example 10/Figure 20 is directed to the step of electroporating the gRNAs and a mRNA encoding Cas9 molecule into the T cells, step, as per “Applicant further submits…evidence of unexpected results….by electroporation ….presented in Example 10”, whereby Example 10 clearly discloses “electroporated with S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail”. Independent claims fail to recite “electroporated with S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail”. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite: “ii) electroporating the T cell population with the S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail and the (two or more) (Claim 417) or (three or more) (Claims 162, 408) gRNA molecules”. As a fourth matter, instant independent claims require the gRNAs to be modified to comprise a 5’ ARCA cap and a 3’ polyA tail. Rather, the recited % viability is directed to the electroporation step, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation under conditions ….presented in Example 10 (results shown in Figure 20)”. Figure 20 clearly evidences that electroporation of a composition comprising: i) an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) the three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail, yielded about 70% viability of the T cell population. Instant independent claims are broader in scope than asserted secondary consideration of unexpected results for reciting less than the about 70% viability, e.g. not more than 40%, not more than 45%, not more than 50%, not more than 55%, not more than 60%, and/or not more than 65%. The limitation “40%” refers to gRNAs not modified to comprise a 5’ ARCA cap and/or a 3’ polyA tail yielded % viabilities of only about 40% to 50%, which is not the structures of the instant independent claims. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite “wherein the T cell population has a viability of 70% or more upon electroporation”. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). See also 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejection below. 8. Claims 162, 387-393, 398-403, 408, 411-417, 420-425, and 427-429 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant has amended the independent claims to recite a method of altering a T cell (singular), comprising the step(s) of: i) contacting the T cell (singular) with a Cas9 molecule and gRNA molecules; and ii) electroporating the T cell (singular), thereby introducing the Cas9 molecule and gRNA molecules into the T cell, wherein the method yields at least 40% viability of the T cell. The Examiner incorporates herein the above 35 U.S.C. 101, 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejections. In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). As a first matter, independent claims are directed to altering a T cell (singular), comprising the step(s) of: i) contacting the T cell (singular) with a Cas9 molecule and gRNA molecules; and ii) electroporating the T cell (singular), thereby introducing the Cas9 molecule and gRNA molecules into the T cell. Those of ordinary skill in the art immediately recognize that, per natural law of biology, the T cell is only alive (syn. viable) or dead. There is no partial viability, e.g. not more than 40%, not more than 50%, etc… Rather, the recited % viability is directed to the T cell population (plural) as a whole, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation”. See also 35 U.S.C. 101 rejection above. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite: i) “altering a T cell population” in the preamble, ii) electroporating the T cell population in step (ii); and iii) “wherein the T cell population has a viability of …”. As a second matter, instant independent claims recite the % viability referring back to the contacting step (step (i)), not the electroporation step (step (ii)). Those of ordinary skill in the art immediately recognize that these are not the same steps. Rather, the recited % viability is directed to the electroporation step, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation”. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite “wherein the T cell population has a viability… upon electroporation”. As a third matter, as discussed above, instant independent claims recite the step of introducing a Cas9 molecule (protein) into the T cell. Those of ordinary skill in the art have long-recognized that a Cas9 molecule is a protein composed of amino acids, not nucleic acids. Such is natural law of chemistry and biology. While the specification discloses, for example, a DNA plasmid encoding Cas9 (e.g. [0966]), which is understood in the art to be a DNA molecule (nucleic acid) encoding a Cas9 molecule (amino acid). The DNA plasmid encoding Cas9, and the mRNA encoding Cas9, is/are not a Cas9 molecule (protein). See above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejections. Rather, the recited % viability is directed to the step of electroporating the gRNAs and a mRNA encoding Cas9 molecule into the T cells, step, as per “Applicant further submits…evidence of unexpected results….by electroporation ….presented in Example 10”, whereby Example 10 clearly discloses “electroporated with S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail”. Independent claims fail to recite “electroporated with S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail”. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite: “ii) electroporating the T cell population with the S. pyogenes Cas9 mRNA modified with a 5’ ARCA cap and polyA tail and the (two or more) (Claim 417) or (three or more) (Claims 162, 408) gRNA molecules”. As a fourth matter, instant independent claims require the gRNAs to be modified to comprise a 5’ ARCA cap and a 3’ polyA tail. Rather, the recited % viability is directed to the electroporation step, as per “Applicant further submits…evidence of unexpected results….introduction of the Cas9 molecule and the gRNAs into T cells—by electroporation under conditions ….presented in Example 10 (results shown in Figure 20)”. Figure 20 clearly evidences that electroporation of a composition comprising: i) an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) the three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail, yielded about 70% viability of the T cell population. Instant independent claims are broader in scope than asserted secondary consideration of unexpected results for reciting less than the about 70% viability, e.g. not more than 40%, not more than 45%, not more than 50%, not more than 55%, not more than 60%, and/or not more than 65%. The limitation “40%” refers to gRNAs not modified to comprise a 5’ ARCA cap and/or a 3’ polyA tail yielded % viabilities of only about 40% to 50%, which is not the structures of the instant independent claims. Absent evidence to the contrary, it would be remedial for Applicant to amend the independent claims to recite “wherein the T cell population has a viability of 70% or more upon electroporation”. Instant specification fails to disclose electroporation conditions of a T cell with a composition comprising Cas9/gRNA ribonucleoprotein complex that necessarily and predictably achieves not more than 40% viability of the T cell, as opposed to not more than 20%, 30%, 50%, 60%, 70%, 80%, etc…. Instant specification fails to disclose electroporation conditions of a T cell population with a composition comprising Cas9/gRNA ribonucleoprotein complex that necessarily and predictably achieves not more than 40% viability of the T cell population, as opposed to not more than 20%, 30%, 50%, 60%, 70%, 80%, etc…. Instant specification fails to disclose electroporation conditions of a T cell with a composition comprising the gRNA molecules and a DNA molecule encoding Cas9 that necessarily and predictably achieves not more than 40% viability of the T cell, as opposed to not more than 20%, 30%, 50%, 60%, 70%, 80%, etc…. Instant specification fails to disclose electroporation conditions of a T cell population with a composition comprising the gRNA molecules and a DNA molecule encoding Cas9 that necessarily and predictably achieves not more than 40% viability of the T cell population, as opposed to not more than 20%, 30%, 50%, 60%, 70%, 80%, etc…. Rather, the only working example is co-electroporation of a T cell population with a composition comprising: i) an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail the gRNAs, thereby achieving a population of T cells with about 70% viability upon electroporation, as per Example 10 and Figure 20. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 9. Claim(s) 417, 422, 425, and 427 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Duchateau et al (WO 14/191128; of record in IDS) in view of in view of Bonini et al (U.S. 2011/0158957), Conway et al (WO 14/186585; of record in IDS), Meissner et al (U.S. 2016/0348073; filed March 28, 2016; priority to 62/139,479 filed on March 27, 2015; of record), Beane et al (available online June 2, 2015; of record), Montague et al (May 26, 2014; of record), ChopChop (last visited June 9, 2023; of record), Shalem et al (January 3, 2014; of record), Schumann et al (available online July 27, 2015; of record in IDS), Jinek (2013; of record), Von Der Mulbe et al (U.S. 2016/0326575; priority to May 8, 2015; of record), Grudzien et al (2007; of record), Chen et al (U.S. 2016/0017366; published January 21, 2016; of record), Mali et al (2013; of record in specification), and Jemielity et al (2003; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claim 417, Duchateau et al is considered relevant prior art for having disclosed methods of editing the genome of primary human T cells using the CRISPR/Cas9 system (e.g. Figure 4), wherein at least two endogenous genes have been inactivated, to wit, inactivation of PDCD1 and TRAC (e.g. pg 31, line 24; claim 34). Duchateau et al successfully demonstrated editing both the TRAC locus (e.g. pg 50, line 31) and the CD52 locus (e.g. pg 5, Figure 6 legend), thereby generating TRAC-inactivated, CD52-inactivated double-mutant T cells (e.g. pg 49, lines 25-31, Example 2). Similarly, Bonini et al is considered relevant prior art for having disclosed a method of altering the TRAC genes in a T cell, thereby generating TRAC-inactivated T cells (e.g. [0015, 17-18], TCRalpha; Example 2; [0040, 42], “TCR-alpha-edited”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized and successfully reduced to practice the scientific and technical concepts of editing the TRAC locus in a T cell. Similarly, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci in the same T cell. Duchateau et al do not disclose wherein the PDCD1 gRNA comprises a targeting domain of SEQ ID NO:508 or SEQ ID NO:582. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 417, Conway et al is considered relevant prior art for having disclosed a method of editing the genome of T cells (e.g. pg 29, lines 1-30), wherein the TRAC or TRBC loci are edited using the CRISPR/Cas system (e.g. pg 29, lines 27-31) and/or the PDCD1 locus is edited (e.g. pg 31, lines 1-3). Conway et al disclosed PD-1 sgRNA target sequences SEQ ID NO:110 and SEQ ID NO:193 (pg 85, Table 1), wherein SEQ ID NO:110 encompasses instant SEQ ID NO:508, and SEQ ID NO:193 substantially overlaps with instant SEQ ID NO:582, as shown below: SEQ ID NO:508: gtctgggcggtgctacaact SEQ ID NO:110: cagtcgtctgggcggtgctacaactggg SEQ ID NO:582: acaggcgccctggccagtcg SEQ ID NO:193: ggcgccctggccagtcgtctggg Similarly, Meissner et al is considered relevant prior art for having disclosed methods of producing primary human T cells [0014], the method comprising the step of using the CRISPR/Cas system to inactivate PD-1 ([0016], as illustrated in Figure 13A), wherein the CRISPR/Cas system is introduced into the cell as a gRNA/Cas complex [0210, 228]. Meissner et al disclosed wherein said PD-1 guide RNAs having a target sequence of SEQ ID NO’s: 196-531 [0007], wherein gRNA334 (SEQ ID NO: 531) is identical to instant SEQ ID NO:582, and gRNA6 (SEQ ID NO:203) is identical to instant SEQ ID NO:508 (Figures 5-6; search results available in SCORE). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). Thus, the ordinary artisan would have had a reasonable motivation to choose SEQ ID NO:508 or SEQ ID NO:582 from the defined list of known options, and would have had a reasonable expectation of success that the gRNA target sequence would have efficient cutting ability. Furthermore, as discussed by Schumann et al (below), those of ordinary skill in the art previously recognized that it is natural law of cell biology that the CRISPR/Cas system naturally generates a range of deletions, some as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides (Figure 3c), even as much as 168 nucleotides at the gRNA target site (Figure 1e). Thus, those of ordinary skill in the art would have immediately recognized that the PDCD1 gRNA of Conway et al and Meissner et al would yield essentially the same, if not indistinguishable, molecular edits in the same or substantially the same location. Meissner et al disclosed wherein said PD-1 guide RNAs may target exon 1, 2, 3, 4, or 5 [0116]. Meissner et al disclosed wherein said PD-1 guide RNAs having a target sequence of SEQ ID NO’s: 196-531 [0007], wherein gRNA334 (SEQ ID NO: 531) is identical to instant SEQ ID NO:582, and gRNA6 (SEQ ID NO:203) is identical to instant SEQ ID NO:508 (Figures 5-6; search results available in SCORE). Meissner et al disclosed the nucleotide sequence of PDCD1 exon 1 (Table 4) which comprises a nucleotide sequence that is complementary to gRNA targeting domains: SEQ ID NO:508, to wit: gtctgggcggtgctacaact; and SEQ ID NO:582, to wit: acaggcgccctggccagtcg. While Meissner et al disclosed a reduction to practice of using a gRNA to inactivate the PDCD1 gene in exons 2 and 3 (e.g. Figure 13), Meissner et al do not disclose a reduction to practice of using a gRNA to inactivate the PDCD1 gene in exon 1. However, prior to the effective filing date of the instantly claimed invention, Beane et al is considered relevant prior art for having taught a method of editing a T cell, the method comprising the step of contacting T cells with a guided nuclease to inactivate PDCD1 exon 1 (Figure 1a), thereby creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression (e.g. pg 1388, col. 1). Montague et al is considered relevant prior art for having taught that the ordinary artisans had ready access to online web-based tools to select and design guide RNA targeting sequences for CRISPR/Cas gene editing systems for their gene of interest, whereby the ease of use and speed of CHOPCHOP make it a valuable tool for genome engineering. When the ordinary artisan uses the web-based ChopChop web tool, one immediately identifies a guide RNA having 100% identity to instant SEQ ID NO: 508 (rank order #2) and SEQ ID NO:582 (rank order #4). Thus, the ordinary artisan would have had a reasonable motivation to choose SEQ ID NO:508 and/or SEQ ID NO:582 from the defined list of known options, and would have had a reasonable expectation of success that the gRNA target sequence(s) would have efficient cutting ability. Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC (e.g. pg 31, line 24; claim 34). Conway et al disclosed TRAC sgRNA target sequences (pg 85, Table 1), but do not disclose instant TRAC sgRNA target sequence SEQ ID NO:453 nor TRBC sgRNA target sequence SEQ ID NO:413. However, prior to the effective filing date of the instantly claimed invention, Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha)”; [0127], “cleave TCR alpha chain locus, as well as editing the genome of such cells to alter…PD1”). Meissner et al disclosed wherein said TRAC guide RNA69 (SEQ ID NO:601; lower line) is identical to instant SEQ ID NO:453 (upper line; Figure 7). SIN:453 (20nt) GCTGGTACACGGCAGGGTCA gRNA69, SEQ ID NO:601 GCTGGTACACGGCAGGGTCA Meissner et al disclosed the T cells are CAR-T cells [0004, 81-82]. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). Duchateau et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule (e.g. pg 49, line 26). Conway et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule (e.g. pg 14, lines 2-3; pg 31, lines 6-7). Meissner et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule [0203]. With respect to the limitation wherein at least one of the guide RNA molecules comprises a 5’ ARCA cap and a 3’ polyA tail, neither Duchateau et al, Conway et al, nor Shalem et al teach/disclose modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. While Schumann et al taught in vitro transcription reactions to synthesize the gRNAs, Schuman et al do not teach modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. While Meissner et al disclosed the RNAs may be modified to comprise a 5’ cap, e.g. an anti-reverse cap analog (e.g. [0303]) and a 3’ polyA tail (e.g. [0307]), Meissner et al do not disclose a reduction to practice of modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. However, prior to the effective filing date of the instantly claimed invention, Jinek et al is considered relevant prior art for having taught in vitro transcription to produce sgRNA molecules, whereby their sgRNA lacked a 5’ cap and a 3’ polyadenylation sequence that may have reduced the sgRNA stability in vivo; whereas, providing such 5’ and 3’ modifications may enhance the Cas9::sgRNA assembly and activity in cells (e.g. pg 5). Jinek et al demonstrated modifying the sgRNA coding sequence to further comprise a polyA-encoding sequence (e.g. Figure 3a). Von Der Mulbe et al is considered relevant prior art for having disclosed in vitro synthesis of RNA molecules, wherein the RNA molecule includes CRISPR guide RNAs (e.g. [0042], wherein the RNA molecules comprise a 5’ cap and a polyA sequence (e.g. [0042]), and wherein the 5’ cap includes a m7G cap or an anti-reverse cap analogue (e.g. [0040, 98, 265]). Grudzien et al is considered relevant prior art for having taught the replacement of a mRNA 5’ m7G cap with an anti-reverse cap analog (ARCA), thereby rendering the artisan’s 3’ polyA-containing mRNA more resistant to decapping enzymes and degradation (e.g. Abstract; pgs 205-206), resulting in prolonged stability and half-lives (Figure 11.6; Table 11.1). Chen et al is considered relevant prior art for having disclosed a vector encoding a guide RNA and/or a Cas9 nuclease and a polyA sequence (e.g. [0089]) and in vitro synthesis of a mRNA encoding a Cas9 protein, wherein the Cas9 mRNA comprises a 5’ anti-reverse analog cap and a 3’ polyA tail (e.g. [0089, 124, 169], Table 7). Chen et al disclosed in vitro transcription of a CRISPR gRNA (e.g. [0163]), but does not disclose ipsis verbis wherein the IVT gRNA comprises a 5’ anti-reverse analog cap and a 3’ polyA tail. Mali et al is considered relevant prior art for having taught a method of editing a target gene in a human host cell using the CRISPR/Cas9 system the method comprising the step of expressing a guide RNA from an expression vector, wherein said guide RNA encoded by the expression vector comprises a polyT tail (Figure 1A, U6 promoter-target-gRNA scaffold-polyT), and thus upon transcription comprises a polyA tail, per natural law of cell and molecular biology. With respect to the limitation wherein the T cell is electroporated with the Cas9 molecule and the sgRNA molecule(s), Duchateau et al disclosed the CRISPR/Cas9 system is introduced into the cells via electroporation (e.g. Tables 1-2). Conway et al disclosed the CRISPR/Cas9 system is introduced into the cells via electroporation (e.g. pg 9, “sgRNA by electroporation”). Meissner et al disclosed the CRISPR/Cas9 system is introduced into the cells via electroporation (e.g. [0208]). Schumann et al taught wherein the CRISPR/Cas9 system is introduced into the cells via electroporation (e.g. Abstract). Chen et al disclosed wherein the CRISPR/Cas9 system is introduced into the cells via electroporation (e.g. [0109]). Resolving the level of ordinary skill in the pertinent art. People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, cancer biology, immunology, and gene editing technologies. Therefore, the level of ordinary skill in this art is high. "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. Shalem et al is considered relevant prior art for having taught the construction of a CRISPR/Cas9 knockout library comprising at least 64,750 unique gRNA guide target sequences, thus enabling knockout screening in human cells (e.g., Abstract). Shalem et al taught that given the high efficacy of gene knockout by lentiCRISPR, we tested the feasibility of conducting genome-scale CRISPR-Cas9 knockout (GeCKO) screening with a pooled lentiCRISPR Library (pg 85, col. 3). Shalem et al taught that the efficiency of complete knockout, the consistency of distinct sgRNAs, and the high validation rate for top screen hits demonstrate the potential of Cas9:sgRNA-based technology to transform functional genomics (pg 87, col. 2, Conclusion). Schumann et al is considered relevant prior art for having taught that the editing efficiency of a Cas9/gRNA ribonucleoprotein complex delivered in vitro into primary human T cells varies between 4% to 29%, depending upon the dose of the Cas9/gRNA RNP concentration (pg 10438, col. 2; Figure 4d). Schumann et al taught that delivery of a Cas9/gRNA ribonucleoprotein complex into primary human T cells is capable of generating a deletion as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides (Figure 3c), even as much as 168 nucleotides at the gRNA target site (Figure 1e). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to combine: i) a PDCD1 sgRNA comprising a targeting domain SEQ ID NO:508 or SEQ ID NO:582; and ii) a TRAC sgRNA comprising a targeting domain of SEQ ID NO:453 in a method of editing the genome of a T cell using the CRISPR/Cas9 system with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose. The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well-established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960). Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC (e.g. pg 31, line 24; claim 34). Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha)”; [0127], “cleave TCR alpha chain locus, as well as editing the genome of such cells to alter…PD1”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci, in the same T cell. The instantly claimed PDCD1 sgRNA target sequences (SEQ ID NO:508, SEQ ID NO:582) and TRAC sgRNA target sequence (SEQ ID NO:453) were previously known in the art. “A person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to combine: i) a PDCD1 sgRNA comprising a targeting domain SEQ ID NO:508 or SEQ ID NO:582; and ii) a TRAC sgRNA comprising a targeting domain of SEQ ID NO:453, in a method of editing the genome of a T cell using the CRISPR/Cas9 system with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose. The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well-established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960). Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC (e.g. pg 31, line 24; claim 34). Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha)”; [0127], “cleave TCR alpha chain locus, as well as editing the genome of such cells to alter…PD1”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci in the same T cell. The instantly claimed PDCD1 sgRNA target sequences (SEQ ID NO:508, SEQ ID NO:582), and TRAC sgRNA target sequence (SEQ ID NO:453) were previously known in the art. “A person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” One of ordinary skill in the art would have understood how to design nucleic acid molecules encoding guide RNA target sequences directed to the previously known PDCD1 and TRAC gene nucleotide sequences, the artisan merely using readily available online database tools, e.g. GenBank, and guide RNA design tool resources, e.g. CHOPCHOP, with which to identify the finite potential options, taking mere seconds to perform such a search, whereby the ordinary artisan could have pursued the known potential options with a reasonable expectation of success. The number of possible PDCD1 exon 1 guide RNA target sequences and TRAC guide RNA target sequences from which to choose is neither astronomical nor insurmountable, but rather clearly limited to finite list immediately visualized by the online tools (CHOPCHOP), and given the art-recognized PDCD1 gene organization and TRAC gene organization that gene editing of PDCD1 exon 1 was previously demonstrated (Beane et al), that the gene editing of TRAC locus was previously demonstrated (e.g. Duchateau et al; Bonini et al), and the art-recognized nucleotide sequences, it would be only routine experimentation to determine which guide RNAs achieve disruption of the PDCD1 and TRAC genes, respectively, using the previously recognized successful CRISPR/Cas/guide RNA system technology. Targeting PDCD1 exon 1 and the TRAC locus with gene editing techniques would have been reasonably predicted and expected by the ordinary artisan to successfully disrupt, suppress and/or eliminate expression of the PDCD1 and TRAC proteins, respectively. It would have been obvious to one of ordinary skill in the art to try a guide nucleic acid comprising a target nucleotide sequence comprising SEQ ID NOs: 453, 508 and/or 582 with a reasonable expectation of success because Meissner et clearly disclosed a finite list of PDCD1 gRNA guide target sequences, including a PDCD1 gRNA guide target sequence of SEQ ID NO:508 and/or SEQ ID NO:582. Meissner et al also clearly disclosed a finite list of TRAC gRNA guide target sequences, including a TRAC gRNA guide target sequence of SEQ ID NO:453. That the gRNAs SEQ ID NO’s are disclosed within the genus does not negate the fact that SEQ ID NO’s: 453, 508, and 582 were specifically disclosed. Meissner et al clearly disclosed the primary human T cells may further comprise genome edits in the TRAC gene. The list of PDCD1 gRNA guide target sequences and the TRAC sgRNA target sequences are not so great to prohibit the ordinary artisan from envisioning a PDCD1 gRNA guide target sequence of SEQ ID NO:508 and/or SEQ ID NO:582, alone or in combination with envisioning a TRAC gRNA guide target sequence of SEQ ID NO:453 as an embodiment, as Shalem et al clearly evidence that the ordinary artisans were able to specifically and intentionally generate a large (64,7500 unique guide sequences) gRNA library for CRISPR/Cas9 gene knockouts in human cells, whereby the gRNA library achieves a high efficiency of complete knockout and a high validation rate. One of ordinary skill in the art would have understood how to design nucleic acid molecules encoding guide RNA target sequences directed to the previously known PDCD1 and TRAC gene sequences, the artisan merely using readily available molecular biology with which to identify the finite potential options, including the disclosure of Meissner et al, whereby the ordinary artisan could have pursued the known potential options with a reasonable expectation of success. The number of possible PDCD1 and TRAC guide RNA target sequences from which to choose is neither astronomical nor insurmountable, and given the guidance of Shalem et al, it would be only routine experimentation to determine which guide RNAs achieve the desired gene knockout. Furthermore, Beane et al taught a successful reduction to practice of using a guided nuclease to inactivate PDCD1 exon 1 for the same or similar purpose of the instant application, e.g. thereby creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression. There is no objective evidence of criticality for the gRNA-directed location of the PDCD1 knockout at the complementary sequence of SEQ ID NO:508 or SEQ ID NO:582, alone and/or in combination with, the gRNA-directed location of the TRAC knockout at the complementary sequence of SEQ ID NO:453. Schumann et al evidence that gRNA naturally generate deletions as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides, even as much as 168 nucleotides, and thus overlapping and/or adjacent gRNA target sites (Meissner et al, CHOPCHOP) would have been reasonably expected by those of ordinary skill in the art to naturally generate substantially the same target gene inactivation or knock-out lesions, being molecularly indistinguishable. The prior art knocked out the PDCD1 and/or TRAC genes for the same or similar purpose of the instant application, e.g. to generate off-the-shelf universal CAR T cells (e.g. Meissner et al, Abstract), creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression (Bean et al). Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to modify an in vitro transcribed gRNA molecule of Schuman et al and/or Meissner et al to further comprise a 5’ ARCA cap and a 3’ polyA tail with a reasonable expectation of success because those of ordinary skill in the art previously recognized the scientific and technical concepts that: i) the addition of a 5’ cap and a 3’ polyA tail may enhance sgRNA stability in vivo, thereby enhancing assembly and activity of Cas9::sgRNA ribonucleoprotein complexes in cells, whereby the sgRNA coding sequence was modified to further encode a polyA tail (Jinek et al); ii) CRISPR guide RNAs may comprise a 5’ cap, to wit, a m7G cap or an anti-reverse cap analogue, and a polyA sequence (Von Der Mulbe et al; Chen et al); iii) the use of a 5’ ARCA cap and a 3’ polyA tail was successfully reduced to practice in an in vitro transcribed mRNA encoding a Cas9 protein of a CRISPR/Cas9 editing system (Chen et al); and iv) the replacement of a mRNA 5’ m7G cap with an anti-reverse cap analog (ARCA) in the artisan’s in vitro transcribed 3’ polyA-containing mRNA successfully rendered said modified in vitro transcribed mRNA more resistant to decapping enzymes and degradation, thereby prolonging stability and half-lives (Grudzien et al). It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 422, Meissner et al disclosed wherein the gRNA molecule is modified at its 5’ end [0289], including an anti-reverse cap analog (e.g. [0303]), wherein said ARCA cap comprises a 5’-5’ triphosphate linkage (citing Jemielity et al (2003); e.g. Figure 1, product 13). Von Der Mulbe et al disclosed wherein the ARCA cap comprises a 5’-5’ triphosphate linkage (e.g. [0040, 98]). Grudzien et al taught wherein the ARCA cap comprises a 5’-5’ triphosphate linkage (e.g. pg 204, Introduction; Figure 11.1). Meissner et al disclosed wherein the polyA tail may comprise as few as five, and as many as several hundred, adenine nucleotides (e.g. [0307]). Von Der Mulbe et al disclosed wherein the polyA tail may comprise as many as 80-160 adenine nucleotides (e.g. [0299]). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). With respect to Claim 425, Duchateau et al disclosed wherein the target cells are electroporated with an mRNA encoding the RNA-guided nuclease and/or the guide RNA (e.g. pg 57, claim 15). Conway et al disclosed wherein the target cells are electroporated with an mRNA encoding the Cas9 nuclease and the guide RNA (e.g. pg 9, lines 4-6). Meissner et al disclosed wherein the Cas9 is encoded by an mRNA (e.g. [0208]). With respect to Claim 429, Meissner et al disclosed wherein the Cas9 protein is complexed with the gRNA (e.g. [0210, 228]). Schumann et al taught wherein the Cas9 protein is complexed with the gRNA (e.g. pg 10442, col. 2, Methods, Cas9 RNP assembly). Chen et al disclosed wherein the Cas nuclease is complexed with the gRNA (e.g. [0004, 110, 124]). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, absent evidence to the contrary, the invention as a whole is prima facie obvious. Response to Arguments Applicant argues secondary consideration that they unexpectedly achieved a T cell population viability of at least 40% when electroporating a composition comprising the Cas9 molecule and the three or more gRNAs. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, instant claims are directed to editing a single T cell. See discussions above. See 35 U.S.C. 101, 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections above. The cited prior art clearly successfully demonstrated the ability to introduce Cas9 and sgRNAs into T cell, thereby editing the genome of said T cell (syn. 100% viable T cell). As a second matter, Figure 20 clearly evidences that electroporation of a composition comprising: i) an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) the three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail, yielded about 70% viability of the T cell population. Instant independent claims are broader in scope than asserted secondary consideration of unexpected results for failing to recite less 70% or more viability and failing to recite electroporation of T cell population with a composition comprising: i) an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) the three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail. Instant independent claims are not commensurate in scope with Applicant’s asserted secondary consideration. As a third matter, the Examiner provides the following reference to rebut applicant’s arguments regarding the state of the prior art regarding electroporation of T cells with a composition comprising an mRNA encoding S. pyogenes Cas9 and modified with a 5’ ARCA cap and polyA tail; and ii) the three or more gRNAs modified to comprise a 5’ ARCA cap and a 3’ polyA tail. Note: the reference is not considered a part of the 103 rejection but is solely provided to rebut applicant’s argument(s). Hendel et al (Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells, Nature Biotechnology 33(9): 985-989; 34 pages total; doi:10.1038/nbt.3290; available online June 29, 2015) is considered relevant prior art for having taught a method of electroporating (nucleofection is an art-recognized electroporation method) primary human T cells with a composition comprising a chemically modified mRNA encoding Cas9 (e.g. pg 6, col. 1, Online Methods) and sgRNAs chemically modified for stability (e.g. pg 985, col. 2, para 1, “M”, “MS”, “MSP”; pg 988, col. 1; pg 6, col. 1, Online Methods, sgRNA synthesis), wherein the T cell population viability post-electroporation is 80%-90% or higher (less than 20% to less than 10% dead cells) (Suppl Fig 11). Thus, Applicant’s asserted secondary consideration of an unexpected result is contradicted by what has already been achieved by the ordinary artisans in the prior art. The Examiner notes that instant independent claims recite the electroporation method protocol at a high level of generality. Applicant’s asserted secondary consideration per Example 10 also suffers this deficiency, as the specific electroporation method step parameter(s) and conditions is/are omitted or otherwise obfuscated. Those of ordinary skill in the art would immediately recognize that one simply cannot properly fully evaluate, weigh, and achieve a complete analysis of the asserted secondary consideration of Applicant’s result(s) as being “unexpected” in the absence of the specific electroporation protocol method step parameters, which Applicant fails to claim, let alone disclose. Applicant simply fails to provide the necessary information. Applicant iterates prior arguments. The Examiner has rebutted prior arguments in prior Office Actions. 10. Claim(s) 162, 387-393, 398-402, 408, 411-417, 420-425, and 427-429 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Duchateau et al (WO 14/191128; of record in IDS) in view of in view of Bonini et al (U.S. 2011/0158957), Conway et al (WO 14/186585; of record in IDS), Meissner et al (U.S. 2016/0348073; filed March 28, 2016; priority to 62/139,479 filed on March 27, 2015; of record), Beane et al (available online June 2, 2015; of record), Montague et al (May 26, 2014; of record), ChopChop (last visited June 9, 2023; of record), Shalem et al (January 3, 2014; of record), Schumann et al (available online July 27, 2015; of record in IDS), Jinek (2013; of record), Von Der Mulbe et al (U.S. 2016/0326575; priority to May 8, 2015; of record), Grudzien et al (2007; of record), Chen et al (U.S. 2016/0017366; published January 21, 2016; of record), Mali et al (2013; of record in specification), and Jemielity et al (2003; of record), as applied to Claims 417, 422, 425, and 427 above, and in further view of Provasi et al (April 1, 2012; of record) and GenBank (NC_000007.14, 2023; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claims 162, 408, and 417, Duchateau et al is considered relevant prior art for having disclosed methods of editing the genome of primary human T cells using the CRISPR/Cas9 system (e.g. Figure 4), wherein at least two endogenous genes have been inactivated, to wit, inactivation of PDCD1 and TRAC, PDCD1 and TRBC, or TRAC and TRBC (e.g. pg 31, line 24; claim 34). Duchateau et al successfully demonstrated editing both the TRAC locus (e.g. pg 50, line 31) and the CD52 locus (e.g. pg 5, Figure 6 legend), thereby generating TRAC-inactivated, CD52-inactivated double-mutant T cells (e.g. pg 49, lines 25-31, Example 2). Similarly, Bonini et al is considered relevant prior art for having disclosed a method of altering the TRAC and TRBC genes in a T cell, thereby generating TRAC-inactivated, TRBC-inactivated double-mutant T cells (e.g. [0015, 17-18], TCRalpha and/or TCRbeta; Example 2; [0040, 42], “TCR-alpha/beta-edited”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized and successfully reduced to practice the scientific and technical concepts of editing both the TRAC and TRBC loci in the same T cell. Similarly, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci, or PDCD1 and TRBC loci, in the same T cell. Neither Duchateau et al nor Bonini et al disclose wherein the PDCD1 gRNA comprises a targeting domain of SEQ ID NO:508 or SEQ ID NO:582. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 162, 408-409, and 417, Conway et al is considered relevant prior art for having disclosed a method of editing the genome of T cells (e.g. pg 29, lines 1-30), wherein the TRAC or TRBC loci are edited using the CRISPR/Cas system (e.g. pg 29, lines 27-31) and/or the PDCD1 locus is edited (e.g. pg 31, lines 1-3). Conway et al disclosed PD-1 sgRNA target sequences SEQ ID NO:110 and SEQ ID NO:193 (pg 85, Table 1), wherein SEQ ID NO:110 encompasses instant SEQ ID NO:508, and SEQ ID NO:193 substantially overlaps with instant SEQ ID NO:582, as shown below: SEQ ID NO:508: gtctgggcggtgctacaact SEQ ID NO:110: cagtcgtctgggcggtgctacaactggg SEQ ID NO:582: acaggcgccctggccagtcg SEQ ID NO:193: ggcgccctggccagtcgtctggg Similarly, Meissner et al is considered relevant prior art for having disclosed methods of producing primary human T cells [0014], the method comprising the step of using the CRISPR/Cas system to inactivate PD-1 ([0016], as illustrated in Figure 13A), wherein the CRISPR/Cas system is introduced into the cell as a gRNA/Cas complex [0210, 228]. Meissner et al disclosed wherein said PD-1 guide RNAs having a target sequence of SEQ ID NO’s: 196-531 [0007], wherein gRNA334 (SEQ ID NO: 531) is identical to instant SEQ ID NO:582, and gRNA6 (SEQ ID NO:203) is identical to instant SEQ ID NO:508 (Figures 5-6; search results available in SCORE). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). Thus, the ordinary artisan would have had a reasonable motivation to choose SEQ ID NO:508 or SEQ ID NO:582 from the defined list of known options, and would have had a reasonable expectation of success that the gRNA target sequence would have efficient cutting ability. Furthermore, as discussed by Schumann et al (below), those of ordinary skill in the art previously recognized that it is natural law of cell biology that the CRISPR/Cas system naturally generates a range of deletions, some as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides (Figure 3c), even as much as 168 nucleotides at the gRNA target site (Figure 1e). Thus, those of ordinary skill in the art would have immediately recognized that the PDCD1 gRNA of Conway et al and Meissner et al would yield essentially the same, if not indistinguishable, molecular edits in the same or substantially the same location. Meissner et al disclosed wherein said PD-1 guide RNAs may target exon 1, 2, 3, 4, or 5 [0116]. Meissner et al disclosed wherein said PD-1 guide RNAs having a target sequence of SEQ ID NO’s: 196-531 [0007], wherein gRNA334 (SEQ ID NO: 531) is identical to instant SEQ ID NO:582, and gRNA6 (SEQ ID NO:203) is identical to instant SEQ ID NO:508 (Figures 5-6; search results available in SCORE). Meissner et al disclosed the nucleotide sequence of PDCD1 exon 1 (Table 4) which comprises a nucleotide sequence that is complementary to gRNA targeting domains: SEQ ID NO:508, to wit: gtctgggcggtgctacaact; and SEQ ID NO:582, to wit: acaggcgccctggccagtcg. While Meissner et al disclosed a reduction to practice of using a gRNA to inactivate the PDCD1 gene in exons 2 and 3 (e.g. Figure 13), Meissner et al do not disclose a reduction to practice of using a gRNA to inactivate the PDCD1 gene in exon 1. However, prior to the effective filing date of the instantly claimed invention, Beane et al is considered relevant prior art for having taught a method of editing a T cell, the method comprising the step of contacting T cells with a guided nuclease to inactivate PDCD1 exon 1 (Figure 1a), thereby creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression (e.g. pg 1388, col. 1). Montague et al is considered relevant prior art for having taught that the ordinary artisans had ready access to online web-based tools to select and design guide RNA targeting sequences for CRISPR/Cas gene editing systems for their gene of interest, whereby the ease of use and speed of CHOPCHOP make it a valuable tool for genome engineering. When the ordinary artisan uses the web-based ChopChop web tool, one immediately identifies a guide RNA having 100% identity to instant SEQ ID NO: 508 (rank order #2) and SEQ ID NO:582 (rank order #4). Thus, the ordinary artisan would have had a reasonable motivation to choose SEQ ID NO:508 and/or SEQ ID NO:582 from the defined list of known options, and would have had a reasonable expectation of success that the gRNA target sequence(s) would have efficient cutting ability. Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC, PDCD1 and TRBC, or TRAC and TRBC (e.g. pg 31, line 24; claim 34). Bonini et al successfully demonstrated generating TRAC-inactivated, TRBC-inactivated double-mutant T cells (e.g. [0015, 17-18], TCRalpha and/or TCRbeta; Example 2; [0040, 42], “TCR-alpha/beta-edited”). Conway et al disclosed TRAC and TRBC sgRNA target sequences (pg 85, Table 1), but do not disclose instant TRAC sgRNA target sequence SEQ ID NO:453 nor TRBC sgRNA target sequence SEQ ID NO:413. However, prior to the effective filing date of the instantly claimed invention, Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha, TCRbeta)”; [0127], “cleave TCR alpha chain locus and/or TCR beta chain locus sequences, as well as editing the genome of such cells to alter…PD1”). Meissner et al disclosed wherein said TRAC guide RNA69 (SEQ ID NO:601; lower line) is identical to instant SEQ ID NO:453 (upper line; Figure 7). SIN:453 (20nt) GCTGGTACACGGCAGGGTCA gRNA69, SEQ ID NO:601 GCTGGTACACGGCAGGGTCA Meissner et al disclosed the T cells are CAR-T cells [0004, 81-82]. Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRBC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRbeta can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), fourth modification (TCRbeta); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRbeta)”). Meissner et al disclosed wherein said TRBC guide RNAs may target exon 1 (e.g., [0062, 0127]; Figure 10). Meissner et al disclosed wherein said TRBC guide RNA83 (SEQ ID NO:693; lower line) is identical to instant SEQ ID NO: 413 (upper line; Figure 8). GCGCUGACGAUCUGGGUGAC GCGCTGACGATCTGGGTGAC Meissner et al disclosed a reduction to practice of using a gRNA to inactivate the TRBC gene (e.g. Figures 10-11). Similarly, prior to the effective filing date of the instantly claimed invention, Provasi et al is considered relevant prior art for having taught a method of editing a T cell, the method comprising the step of contacting T cells with a guided nuclease to inactivate the constant region of the TRBC gene (e.g., pg 808, col. 1, “Efficient disruption of TRBC genes…in human T cells”), whereby TRBC gene editing results in “high-avidity tumor-specific T cells” (pg 808, col. 2). GenBank NC_000007.14 (Homo sapiens TRBC1 gene) evidences that those of ordinary skill in the art previously recognized the nucleotide sequence of human TRBC1 gene, dating back to at least 2002. When the ordinary artisan uses the web-based ChopChop tool, one immediately identifies a guide RNA having 100% identity to instant SEQ ID NO:413, as well as a guide RNA target sequences that substantially overlap with SEQ ID NO:413, as shown below: instant: --------------GCGCTGACGATCTGGGTGAC rank 12: -------------------------------------------GACGGGTTTGGCCCTATCCT rank 13: ------------------------------------------TGACGGGTTTGGCCCTATCC rank 36: ---------------------TGACGATCTGGGTGACGGGTTT rank 107: --------------GCGCTGACGATCTGGGTGAC rank 18: ------------GGCGCTGACGATCTGGGTGAC rank 30: -GGCCTCGGCGCTGACGATCTGGG rank 49: AGGCCTCGGCGCGTGACGATC In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). Thus, the ordinary artisan would have had a reasonable motivation to choose SEQ ID NO:413 from the defined list of known options, and would have had a reasonable expectation of success that the gRNA target sequence would have efficient cutting ability. Furthermore, as discussed by Schumann et al (below), those of ordinary skill in the art previously recognized that it is natural law of cell biology that the CRISPR/Cas system naturally generates a range of deletions, some as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides (Figure 3c), even as much as 168 nucleotides at the gRNA target site (Figure 1e). Thus, those of ordinary skill in the art would have immediately recognized that the TRBC gRNA of ChopChop and Meissner et al would yield essentially the same, if not indistinguishable, molecular edits in the same or substantially the same location. With respect to the limitation wherein at least one of the guide RNA molecules comprises a 5’ ARCA cap and a 3’ polyA tail, neither Duchateau et al, Conway et al, nor Shalem et al teach/disclose modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. While Schumann et al taught in vitro transcription reactions to synthesize the gRNAs, Schuman et al do not teach modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. While Meissner et al disclosed the RNAs may be modified to comprise a 5’ cap, e.g. an anti-reverse cap analog (e.g. [0303]) and a 3’ polyA tail (e.g. [0307]), Meissner et al do not disclose a reduction to practice of modifying a guide RNA (gRNA) to comprise both a 5’ anti-reverse cap analog and a 3’ polyA tail. However, prior to the effective filing date of the instantly claimed invention, Jinek et al is considered relevant prior art for having taught in vitro transcription to produce sgRNA molecules, whereby their sgRNA lacked a 5’ cap and a 3’ polyadenylation sequence that may have reduced the sgRNA stability in vivo; whereas, providing such 5’ and 3’ modifications may enhance the Cas9::sgRNA assembly and activity in cells (e.g. pg 5). Jinek et al demonstrated modifying the sgRNA coding sequence to further comprise a polyA-encoding sequence (e.g. Figure 3a). Von Der Mulbe et al is considered relevant prior art for having disclosed in vitro synthesis of RNA molecules, wherein the RNA molecule includes CRISPR guide RNAs (e.g. [0042], wherein the RNA molecules comprise a 5’ cap and a polyA sequence (e.g. [0042]), and wherein the 5’ cap includes a m7G cap or an anti-reverse cap analogue (e.g. [0040, 98, 265]). Grudzien et al is considered relevant prior art for having taught the replacement of a mRNA 5’ m7G cap with an anti-reverse cap analog (ARCA), thereby rendering the artisan’s 3’ polyA-containing mRNA more resistant to decapping enzymes and degradation (e.g. Abstract; pgs 205-206), resulting in prolonged stability and half-lives (Figure 11.6; Table 11.1). Chen et al is considered relevant prior art for having disclosed a vector encoding a guide RNA and/or a Cas9 nuclease and a polyA sequence (e.g. [0089]) and in vitro synthesis of a mRNA encoding a Cas9 protein, wherein the Cas9 mRNA comprises a 5’ anti-reverse analog cap and a 3’ polyA tail (e.g. [0089, 124, 169], Table 7). Chen et al disclosed in vitro transcription of a CRISPR gRNA (e.g. [0163]), but does not disclose wherein the IVT gRNA comprises a 5’ anti-reverse analog cap and a 3’ polyA tail. Mali et al is considered relevant prior art for having taught a method of editing a target gene in a human host cell using the CRISPR/Cas9 system the method comprising the step of expressing a guide RNA from an expression vector, wherein said guide RNA encoded by the expression vector comprises a polyT tail (Figure 1A, U6 promoter-target-gRNA scaffold-polyT), and thus upon transcription comprises a polyA tail, per natural law of cell and molecular biology. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to combine: i) a PDCD1 sgRNA comprising a targeting domain SEQ ID NO:508 or SEQ ID NO:582; and ii) a TRAC sgRNA comprising a targeting domain of SEQ ID NO:453 in a method of editing the genome of a T cell using the CRISPR/Cas9 system with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose. The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well-established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960). Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC (e.g. pg 31, line 24; claim 34). Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha, TCRbeta)”; [0127], “cleave TCR alpha chain locus and/or TCR beta chain locus sequences, as well as editing the genome of such cells to alter…PD1”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci, in the same T cell. The instantly claimed PDCD1 sgRNA target sequences (SEQ ID NO:508, SEQ ID NO:582) and TRAC sgRNA target sequence (SEQ ID NO:453) were previously known in the art. “A person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to combine: i) a PDCD1 sgRNA comprising a targeting domain SEQ ID NO:508 or SEQ ID NO:582; ii) a TRAC sgRNA comprising a targeting domain of SEQ ID NO:453; and iii) a TRBC sgRNA comprising a targeting domain of SEQ ID NO:413 in a method of editing the genome of a T cell using the CRISPR/Cas9 system with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose. The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well-established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960). Duchateau et al disclosed using the CRISPR/Cas9 system to inactivate PDCD1 and TRAC, PDCD1 and TRBC, or TRAC and TRBC (e.g. pg 31, line 24; claim 34). Bonini et al successfully demonstrated TRAC-inactivated, TRBC-inactivated double-mutant T cells (e.g. [0015, 17-18], TCRalpha and/or TCRbeta; Example 2; [0040, 42], “TCR-alpha/beta-edited”). Meissner et al disclosed the primary human T cells may further comprise genome edits in the TRAC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRalpha can also be targeted in combination with other molecules (e.g. PD-1); [0005], second modification (PD1), third modification (TCRA); [0114], “cleave PD1 gene sequences, as well as editing the genome of such cells to alter one or more additional target polynucleotide sequences (e.g.,…TCRalpha, TCRbeta)”; [0127], “cleave TCR alpha chain locus and/or TCR beta chain locus sequences, as well as editing the genome of such cells to alter…PD1”). Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized the scientific and technical concepts of editing both the PDCD1 and TRAC loci, the PDCD1 and TRBC loci, and the TRAC and TRBC loci, in the same T cell. The instantly claimed PDCD1 sgRNA target sequences (SEQ ID NO:508, SEQ ID NO:582), TRAC sgRNA target sequence (SEQ ID NO:453), and TRBC sgRNA target sequence (SEQ ID NO:413) were previously known in the art. “A person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” One of ordinary skill in the art would have understood how to design nucleic acid molecules encoding guide RNA target sequences directed to the previously known PDCD1, TRAC, and TRBC gene nucleotide sequences, the artisan merely using readily available online database tools, e.g. GenBank, and guide RNA design tool resources, e.g. CHOPCHOP, with which to identify the finite potential options, taking mere seconds to perform such a search, whereby the ordinary artisan could have pursued the known potential options with a reasonable expectation of success. The number of possible PDCD1 exon 1 guide RNA target sequences, TRAC guide RNA target sequences, and TRBC guide RNA target sequences from which to choose is neither astronomical nor insurmountable, but rather clearly limited to finite list immediately visualized by the online tools (CHOPCHOP), and given the art-recognized PDCD1 gene organization, TRAC gene organization, and TRBC gene organization, that gene editing of PDCD1 exon 1 was previously demonstrated (Beane et al), that the gene editing of TRAC locus was previously demonstrated (e.g. Duchateau et al; Bonini et al), and that gene editing of TRBC constant region was previously demonstrated (Bonini et al; Provasi et al), and the art-recognized nucleotide sequences, it would be only routine experimentation to determine which guide RNAs achieve disruption of the PDCD1, TRAC, and TRBC genes, respectively, using the previously recognized successful CRISPR/Cas/guide RNA system technology. Targeting PDCD1 exon 1, the TRAC locus, and the TRBC locus with gene editing techniques would have been reasonably predicted and expected by the ordinary artisan to successfully disrupt, suppress and/or eliminate expression of the PDCD1, TRAC, and TRBC proteins, respectively. It would have been obvious to one of ordinary skill in the art to try a guide nucleic acid comprising a target nucleotide sequence comprising SEQ ID NOs: 413, 453, 508 and/or 582 with a reasonable expectation of success because Meissner et clearly disclosed a finite list of PDCD1 gRNA guide target sequences, including a PDCD1 gRNA guide target sequence of SEQ ID NO:508 and/or SEQ ID NO:582. Meissner et al also clearly disclosed a finite list of TRAC gRNA guide target sequences, including a TRAC gRNA guide target sequence of SEQ ID NO:453. Meissner et al also clearly disclosed a finite list of TRBC gRNA guide target sequences, including a TRBC gRNA guide target sequence of SEQ ID NO:413. That the gRNAs SEQ ID NO’s are disclosed within the genus does not negate the fact that SEQ ID NO’s: 413, 453, 508, and 582 were specifically disclosed. Meissner et al clearly disclosed the primary human T cells may further comprise genome edits in the TRAC or TRBC gene (Abstract, [0114]; [0004], “multiplexing capabilities of genome editing, e.g., using the CRISPR/Cas9…system, the TCRbeta can also be targeted in combination with other molecules (e.g. PD-1). The list of PDCD1 gRNA guide target sequences, the TRAC sgRNA target sequences, and the TRBC gRNA target sequences are not so great to prohibit the ordinary artisan from envisioning a PDCD1 gRNA guide target sequence of SEQ ID NO:508 and/or SEQ ID NO:582, alone or in combination with envisioning a TRAC gRNA guide target sequence of SEQ ID NO:453, alone or in combination with envisioning a TRBC gRNA guide target sequence of SEQ ID NO:413 as an embodiment, as Shalem et al clearly evidence that the ordinary artisans were able to specifically and intentionally generate a large (64,7500 unique guide sequences) gRNA library for CRISPR/Cas9 gene knockouts in human cells, whereby the gRNA library achieves a high efficiency of complete knockout and a high validation rate. One of ordinary skill in the art would have understood how to design nucleic acid molecules encoding guide RNA target sequences directed to the previously known PDCD1, TRAC, and TRBC gene sequences, the artisan merely using readily available molecular biology with which to identify the finite potential options, including the disclosure of Meissner et al, whereby the ordinary artisan could have pursued the known potential options with a reasonable expectation of success. The number of possible PDCD1, TRAC, and TRBC guide RNA target sequences from which to choose is neither astronomical nor insurmountable, and given the guidance of Shalem et al, it would be only routine experimentation to determine which guide RNAs achieve the desired gene knockout. Furthermore, Beane et al taught a successful reduction to practice of using a guided nuclease to inactivate PDCD1 exon 1 for the same or similar purpose of the instant application, e.g. thereby creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression. Similarly, Provasi et al taught a successful reduction to practice of using a guided nuclease to inactivate the TRBC gene constant region for the same or similar purpose of the instant application, whereby TRBC gene editing results in “high-avidity tumor-specific T cells”. Thus, those of ordinary skill in the art previously recognized the scientific and technical concepts that the PDCD1 exon 1 and the TRBC constant region are useful locations for genome-edited knockouts in T cells. There is no objective evidence of criticality for the gRNA-directed location of the PDCD1 knockout at the complementary sequence of SEQ ID NO:508 or SEQ ID NO:582, alone and/or in combination with, the gRNA-directed location of the TRAC knockout at the complementary sequence of SEQ ID NO:453, alone and/or in combination with, the gRNA-directed location of the TRBC knockout at the complementary sequence of SEQ ID NO:413. Schumann et al evidence that gRNA naturally generate deletions as large as, 20, 30, 40, 50, 60, 70, or 80 nucleotides, even as much as 168 nucleotides, and thus overlapping and/or adjacent gRNA target sites (Meissner et al, CHOPCHOP) would have been reasonably expected by those of ordinary skill in the art to naturally generate substantially the same target gene inactivation or knock-out lesions, being molecularly indistinguishable. The prior art knocked out the PDCD1, TRAC, and/or TRBC genes for the same or similar purpose of the instant application, e.g. to generate off-the-shelf universal CAR T cells (e.g. Meissner et al, Abstract), creating tumor-infiltrating lymphocytes with significantly enhanced effector function at a scale necessary for clinical study in subjects with metastatic melanoma, as inactivation of PD1 should release the cells from PD-L1-induced suppression (Bean et al), and TRBC gene editing results in “high-avidity tumor-specific T cells” (Provasi et al), whereby Meissner et al successfully demonstrated a specific embodiment knocking out the PDCD1 gene and a specific embodiment knocking out the TRBC gene. Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to modify an in vitro transcribed gRNA molecule of Schuman et al and/or Meissner et al to further comprise a 5’ ARCA cap and a 3’ polyA tail with a reasonable expectation of success because those of ordinary skill in the art previously recognized the scientific and technical concepts that: i) the addition of a 5’ cap and a 3’ polyA tail may enhance sgRNA stability in vivo, thereby enhancing assembly and activity of Cas9::sgRNA ribonucleoprotein complexes in cells, whereby the sgRNA coding sequence was modified to further encode a polyA tail (Jinek et al); ii) CRISPR guide RNAs may comprise a 5’ cap, to wit, a m7G cap or an anti-reverse cap analogue, and a polyA sequence (Von Der Mulbe et al; Chen et al); iii) the use of a 5’ ARCA cap and a 3’ polyA tail was successfully reduced to practice in an in vitro transcribed mRNA encoding a Cas9 protein of a CRISPR/Cas9 editing system (Chen et al); and iv) the replacement of a mRNA 5’ m7G cap with an anti-reverse cap analog (ARCA) in the artisan’s in vitro transcribed 3’ polyA-containing mRNA successfully rendered said modified in vitro transcribed mRNA more resistant to decapping enzymes and degradation, thereby prolonging stability and half-lives (Grudzien et al). It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 387, 400, and 415, Duchateau et al disclosed wherein the T cells are from a patient suffering from cancer (e.g. pg 39, lines 5-12; Figure 4; claim 51). Bonini et al disclosed wherein the T cells are from a patient suffering from cancer (e.g. [0126, 151]). Conway et al disclosed wherein the T cells are isolated from a patient suffering from cancer (e.g. pgs 28-29, joining para). Meissner et al disclosed wherein the primary human T cell is obtained from a patient suffering from, e.g. cancer [0042]. With respect to Claims 388-390, and 411-412, Duchateau et al disclosed wherein the T cell further comprises a chimeric antigen receptor (e.g. pg 31, line 31; Figure 4). Bonini et al disclosed wherein the T cell further comprises a recombinant receptor (e.g. Example 2). Conway et al disclosed wherein the T cell further comprises a recombinant receptor (e.g. pg 29, lines 11-26) or a chimeric antigen receptor (e.g. pg 32, lines 16-34). Meissner et al disclosed the T cells are CAR-T cells [0004]. With respect to Claims 399 and 413, Duchateau et al disclosed wherein the CAR comprises an antigen binding domain derived from an antibody (e.g. pg 33, lines 4-5, 30-31). Meissner et al disclosed wherein the CAR comprises an antigen binding domain derived from an antibody [0081, 149]. With respect to Claims 391-392, 398, 401-402, 414, and 416, Duchateau et al disclosed wherein the CAR comprises an antigen binding domain that recognizes a tumor antigen, e.g. CD19, as used for the treatment of acute lymphocytic leukemia (ALL) (e.g. pg 33, lines 19-34). Bonini et al disclosed wherein the recombinant receptor comprises an antigen binding domain that recognizes a tumor antigen, e.g. WT-1 (Example 1), as used for the treatment of leukemia [0012], such as AML [0028]. Conway et al disclosed wherein the recombinant receptor comprises an antigen binding domain that recognizes a tumor antigen, e.g. WT-1 (pg 29, line 26), or CD19, as used for the treatment of chronic lymphocytic leukemia (CLL) (e.g. pg 32, lines 27-31). Meissner et al disclosed wherein the CAR comprises an antigen binding domain that recognizes a tumor antigen, e.g. CD19, as used for the treatment of chronic lymphocytic leukemia (CLL) ([0148], Table 5). With respect to Claims 393, Duchateau et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule (e.g. pg 49, line 26). Conway et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule (e.g. pg 14, lines 2-3; pg 31, lines 6-7). Meissner et al disclosed wherein the Cas9 molecule is a Sp Cas9 molecule [0203]. With respect to Claims 420-422, Meissner et al disclosed wherein the gRNA molecule is modified at its 5’ end [0289], including an anti-reverse cap analog (e.g. [0303]), wherein said ARCA cap comprises a 5’-5’ triphosphate linkage (citing Jemielity et al (2003); e.g. Figure 1, product 13). Von Der Mulbe et al disclosed wherein the ARCA cap comprises a 5’-5’ triphosphate linkage (e.g. [0040, 98]). Grudzien et al taught wherein the ARCA cap comprises a 5’-5’ triphosphate linkage (e.g. pg 204, Introduction; Figure 11.1). Meissner et al disclosed wherein the polyA tail may comprise as few as five, and as many as several hundred, adenine nucleotides (e.g. [0307]). Von Der Mulbe et al disclosed wherein the polyA tail may comprise as many as 80-160 adenine nucleotides (e.g. [0299]). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). With respect to Claims 423-425, Duchateau et al disclosed wherein the target cells are electroporated with an mRNA encoding the RNA-guided nuclease and/or the guide RNA (e.g. pg 57, claim 15). Conway et al disclosed wherein the target cells are electroporated with an mRNA encoding the Cas9 nuclease and the guide RNA (e.g. pg 9, lines 4-6). Meissner et al disclosed wherein the Cas9 is encoded by an mRNA (e.g. [0208]). With respect to Claims 427-429, Meissner et al disclosed wherein the Cas9 protein is complexed with the gRNA (e.g. [0210, 228]). Schumann et al successfully demonstrated the ability to edit the artisan’s target gene of interest, e.g. PD-1, in primary human T cells comprising the step of contacting said primary human T cells with Cas9/gRNA ribonucleoprotein complexes, whereby the Cas9/gRNA ribonucleoprotein complexes were electroporated into the T cells (e.g. pg 10442, col. 2, Methods). Chen et al disclosed wherein the Cas nuclease is complexed with the gRNA (e.g. [0004, 110, 124]). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, absent evidence to the contrary, the invention as a whole is prima facie obvious. 11. Claim(s) 403 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Duchateau et al (WO 14/191128; of record in IDS) in view of in view of Bonini et al (U.S. 2011/0158957), Conway et al (WO 14/186585; of record in IDS), Meissner et al (U.S. 2016/0348073; filed March 28, 2016; priority to 62/139,479 filed on March 27, 2015; of record), Beane et al (available online June 2, 2015; of record), Montague et al (May 26, 2014; of record), ChopChop (last visited June 9, 2023; of record), Shalem et al (January 3, 2014; of record), Schumann et al (available online July 27, 2015; of record in IDS), Jinek (2013; of record), Von Der Mulbe et al (U.S. 2016/0326575; priority to May 8, 2015; of record), Grudzien et al (2007; of record), Chen et al (U.S. 2016/0017366; published January 21, 2016; of record), Mali et al (2013; of record in specification), Jemielity et al (2003; of record), Provasi et al (April 1, 2012; of record), and GenBank (NC_000007.14, 2023; of record), as applied to Claims 162, 387-393, 398-402, 408, 411-417, 420-425, and 427-429 above, and in further view of Li et al (available online August 28, 2014; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Meissner et al do not disclose wherein the Cas9 is a SpCas9 molecule comprising a D10A mutation. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 403, Li et al is considered relevant prior art for having taught optimization of the CRISPR/Cas9 system for genome engineering (Title), wherein said optimization includes comparison of different guide RNA target sequences, individually or in combination, e.g. GFP KO gRNAs (Table 1; pg 3, col. 2), as such is common practice in the art (See also citation #13 to Mali et al, “target specificity screening”). Li et al taught the use of the Cas9D10A nickase to perform the target gene edits, as “the Cas9D10A nickase generated smaller targeted indels with lower chance of off-target mutagenesis” (Abstract). Li et al taught that, depending on the gRNA, the knockout efficiency varied from about 21%, 35%, 40%, 43%, and 49% (e.g. pg 3, col. 2, Optimization of CRISPR-mediated gene knockout). Li et al taught that, for example, using the same gRNA, the nickase induced knockout efficiency of about 32%; whereas, wildtype Cas9 yielded about 44% knockout efficiency (pg 4, col. 1). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first SpCas9 polypeptide, as disclosed by Meissner et al, with a second Cas9 polypeptide, to wit, a SpCas9 D10A polypeptide, as taught by Li et al, in a method of editing the genome of a T cell with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first SpCas9 polypeptide with a second Cas9 polypeptide, to wit, a SpCas9 D10A polypeptide, in a method of editing the genome of a T cell because Li et al taught the use of the Cas9D10A nickase to perform the target gene edits, as “the Cas9D10A nickase generated smaller targeted indels with lower chance of off-target mutagenesis” (Abstract). It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, absent evidence to the contrary, the invention as a whole is prima facie obvious. Citation of Relevant Prior Art 12. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Sharpe et al (U.S. 2018/0303922; priority to 62/242,509 filed October 16, 2015; of record) is considered relevant prior art for having disclosed a method of modulating PD-1 expression in a T cell (Abstract), the method comprising the step of contacting the T cell with a Cas9/guide RNA complex directed against PD-1 [0008], wherein said modified T cells are autologous T cells [0008], wherein said PD-1 modified T cells are used in methods of adoptive transfer therapy, e.g. to treat a patient suffering from cancer [0008, 12], such as chronic lymphocytic leukemia [0049], and whereby adoptive transfer therapies include well-known immunotherapeutic modalities such as adoptive CAR T cell therapy [0307]. Conclusion 13. No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. KEVIN K. HILL Examiner Art Unit 1638 /KEVIN K HILL/Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

Show 14 earlier events
Jan 16, 2025
Non-Final Rejection mailed — §101, §103, §112
Apr 16, 2025
Response Filed
May 08, 2025
Final Rejection mailed — §101, §103, §112
Oct 08, 2025
Request for Continued Examination
Oct 09, 2025
Response after Non-Final Action
Dec 03, 2025
Non-Final Rejection mailed — §101, §103, §112
Mar 03, 2026
Response Filed
Apr 22, 2026
Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735700
COMPOUNDS AND METHODS FOR REDUCING FUS EXPRESSION
4y 9m to grant Granted Sep 15, 2026
Patent 12723266
HOMOLOGY DEPENDENT REPAIR GENOME EDITING
5y 3m to grant Granted Sep 01, 2026
Patent 12709751
MANNAN BINDING LECTIN SERINE PEPTIDASE 2 (MASP2) IRNA COMPOSITIONS AND METHODS OF USE THEREOF
4y 0m to grant Granted Aug 18, 2026
Patent 12703864
VECTORS AND COMPOSITIONS FOR TREATING HEMOGLOBINOPATHIES
4y 6m to grant Granted Aug 11, 2026
Patent 12703858
THERAPEUTICS FOR GLYCOGEN STORAGE DISEASE TYPE III
4y 3m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

9-10
Expected OA Rounds
73%
Grant Probability
80%
With Interview (+6.6%)
2y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 727 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month