DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Status of claims
Applicant's submission filed on 11/10/2025 has been entered.
Claims 1-8, 19-22, 24 had/have been canceled by applicant.
Note: the latest sequence listing comprising 61 sequences was filed on 3/4/2021 by the applicant.
In summary, claims 9-18, 23, 25 are pending and examined in this office action.
All previous objections and rejections not set forth below have been withdrawn in view of the applicant’s amendment and/or upon further consideration. See “Response to Arguments” at the end of office action.
The following rejections are repeated, modified and/or added for the reasons of record as set forth in the last Office action of 5/9/2025, and/or necessitated by the applicant’s amendments. The applicant’s arguments filed 11/10/2025 have been thoroughly considered but are not deemed fully persuasive.
Pre-AIA Claim Rejections - 35 USC § 103
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or non-obviousness.
Claims 9-10, 12-17, 23, 25 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Posada-Buitrago et al (EH244602, published 2007), in view of Duplessis et al (F4S1J2_MELLP, published 6/28/2011), Burk et al (Structural Studies of the Final Enzyme in the α-Aminoadipate Pathway-Saccharopine Dehydrogenase from Saccharomyces cerevisiae. J. Mol. Biol. 373, 745–754, 2007), Puzio et al (WO 2009037279, published 2/2009), and Battur et al (LKR/SDH Plays Important Roles throughout the Tick Life Cycle Including a Long Starvation Period. PLoS ONE. Volume 4, Issue 9, 1-14, September 2009).
Claim 9 is drawn to a transgenic plant cell that expresses at least a dsRNA molecule, wherein the dsRNA molecule comprises
i) a first strand comprising a sequence that is at least 20 contiguous nucleotides of a fungus saccharopine dehydrogenase gene and
ii) a second strand comprising a sequence substantially complementary to the first strand,
wherein the fungus gene is:
a) a polynucleotide comprising a sequence as set forth in SEQ ID NO: 59 (364 bp); and/or
b) a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 60 (33 aa) or 61 (70 aa), wherein the saccharopine dehydrogenase gene is from Phakopsora pachyrhizi.
Posada-Buitrago et al teach a polynucleotide sequence from Phakopsora pachyrhizi 100% identical to SEQ ID NO: 59 (364 bases). See “Sequence Matches” at the end of office action.
Duplessis et al (F4S1J2_MELLP) teach a saccharopine dehydrogenase (SDH) sequence comprising both SEQ ID NO: 60 (33 aa) and SEQ ID NO: 61 (70 aa). See “Sequence Matches” at the end of office action.
By Sequence alignment (pairing), both SEQ ID NO: 60 and SEQ ID NO: 61 match 100% to SEQ ID NO: 59. Thus, SEQ ID NO: 59 comprises sequences encoding SEQ ID NO: 60 and SEQ ID NO: 61, SDH peptides.
Posada-Buitrago et al further specifically indicate that the sequence is from a soybean rust pathogen from Phakopsora pachyrhizi, and is at different stages of the infection process (see bold letters). Thus, Posada-Buitrago et al teach a known fungal pathogen sequence from Phakopsora pachyrhizi. See “Sequence Matches” at the end of office action.
Thus, Posada-Buitrago et al and Duplessis et al (F4S1J2_MELLP) collectively teach a sequence encoding SDH from Phakopsora pachyrhizi 100% identical to SEQ ID NO: 59, and indicate that the sequence is a soybean rust pathogen sequence. Accordingly, Posada-Buitrago et al and Duplessis et al teach a strong motivation to inhibit such sequence.
Posada-Buitrago et al and Duplessis et al do not teach targeting and inhibiting such fungal (Phakopsora pachyrhizi) pathogen sequence by dsRNA.
Making and using inhibitors and/or dsRNA to inhibit known fungal pathogen had been known technique and taught in prior art. In this case, making and using dsRNA to inhibit fungal SDH would have been obvious in view of Burk et al, Puzio et al, and Battur et al, as analyzed below:
Burk et al teach making inhibitors of fungal pathogens including inhibitor of a fungal SDH (p746, left col, 3rd para, p749, right col, last para, p750, left col, 1st para, right col, 1st para). Burk et al teach that SDH from fungi is pathogenic to humans and plants and is a suitable target for antimicrobial drug development (p745, Abstract, Introduction in left and right cols). Burk et al teach that dead-end fungal SDH inhibitors were made (p746, left col, 3rd para). Burk et al further teach applying such method to plant to control fungus pathogens (p745, right col, 1st para; p750, left col, 1st para). Burk et al teach that inhibitors developed by exploiting the structure of SDH would be of use against a number of fungal pathogens, and that it is important to develop drug specifically inhibiting fungal SDH. (p750, left col, 1st para). Thus, Burk et al not only teach inhibiting a fungal SDH in plants and had made such inhibitor, but also provide a strong motivation to inhibit the fungal SDH in plants.
Burk et al do not teaching making and using dsRNA to inhibit fungal SDH and SDH from Phakopsora pachyrhizi.
Puzio et al teach that dsRNA is an alternative way for inhibiting or reducing expression of enzymes, and the detailed mechanism thereof ([0225.1.1.1] in pages 633-634).
Puzio et al teach and claim making dsRNA, composition comprising the dsRNA, vector and construct comprising and encoding the dsRNA (comprising cells and seeds) expressing the dsRNA, and method of using the dsRNA to silence pathogen genes in plants including saccharopine dehydrogenase (SDH) gene ([0253.4.1.1], [0253.5.1.1], claim 1), and introducing the dsRNA into plant cell ([0225.1.1.1]), and including fungi genes ([0107.111], [0253.6.1.1]). Puzio et al teach that the dsRNA is substantially complementary to the target sequence and at least 100 bp in length (p634, lines 13-23), reading on at least 20 contiguous nucleotides.
Battur et al indicate that fungi SDH has the same function as that of ticks in plants based on their structures (p2, right col, 1st para). Battur et al list fungal SDH gene in the same figure along with arthropods (ticks are species of arthropods), only 4 types of organisms are listed (p2, fig 1).
Battur et al teach making dsRNA targeting SDH gene of ticks (p12, right col, 2nd para). Each of the forward and reverse PCR primers to produce the sense sequence of the dsRNA is more than 20 bases long (page 2, left column, 2nd paragraph), thus the sense sequence of the dsRNA must be at least 40 bases long, so must be the antisense (complement) sense. The sense sequence of the dsRNA reads on “a first strand comprising a sequence substantially identical to at least 20 contiguous nucleotides of a genus of fungus or oomycete saccharopine dehydrogenase genes”. The antisense sense sequence of the dsRNA reads on “a second strand comprising a sequence substantially complementary to the first strand”. Battur et al demonstrated the effectiveness in pathogen killing by dsRNA targeting the SDH (p7, table 1). Thus, at the very least, Battur et al teach using dsRNA to successfully silence SDH and demonstrated success thereof.
Accordingly, Puzio et al and Battur et al collectively teach using dsRNA to inhibit and silence fungal SDH, as an alternative of fungal SDH inhibitors of Burk et al.
Regarding dependent claims, Puzio et al teach making composition comprising the dsRNA, vector and construct including DNA sequence and promoters/regulatory element comprising encoding the dsRNA, and transgenic plant (comprising cells and seeds) expressing the dsRNA, and method of using the dsRNA to silence pathogen genes in plants including SDH (p634, lines 25-34; p653, lines 6-11, lines 30-36; p654, lines 17-27, page 801, [0139.1.1.1]), the limitations of claims 10 and 12.
As analyzed above, Posada-Buitrago et al teach a polynucleotide sequence from Phakopsora pachyrhizi 100% identical to SEQ ID NO: 59 (364 bases, comprising sequences encoding SEQ ID NO: 60 and SEQ ID NO: 61); Duplessis et al (F4S1J2_MELLP) teach a saccharopine dehydrogenase (SDH) sequence comprising both SEQ ID NO: 60 and SEQ ID NO: 61, the limitations of claims 13 and 17, 23 and 25.
Battur et al demonstrated the effectiveness in pathogen killing by dsRNA targeting SDH (p7, table 1), reading on “effective quantity”; as analyzed above, SEQ ID NOs: 59-62 are from Phakopsora pachyrhizi. Thus, the limitations of claim 14 are taught.
Puzio et al teach providing a transformed plant cell to a host plant for transcription/expression (p603, line 31-33), and contacting pathogens (p250, line 14-19; p651, line 36-42); as analyzed above, SEQ ID NOs: 59-62 are from Phakopsora pachyrhizi. Thus, the limitations of claims 15-16 are taught.
An invention would have been obvious to one ordinary skill in the art if any teaching, suggestion or motivation in prior art leading the one to combine the teaching(s) or suggestion(s) of the cited references to arrive the claimed invention.
In this case, one ordinary skill would have readily recognized SEQ ID NO: 59 as a SDH encoding sequence and as a fungal pathogen sequence, as taught by Posada-Buitrago et al in view of Duplessis et al. Then, it would have been obvious to one ordinary skill in the art to inhibit such fungal SDH sequence SEQ ID NO: 59 by using dsRNA as an alternative to SDH inhibitors, as collectively taught by Burk et al, Puzio et al, and Battur et al. One ordinary skill also would have been motivated to inhibit such sequence encoding SDH sequence because SEQ ID NO: 59 had been shown to be a fungal pathogen sequence. The expectation of success would have been high, because SEQ ID NO: 59 had been known as a fungal SDH pathogen sequence. The effectiveness of inhibition by inhibitors or dsRNA had been demonstrated by the cited references. Applying the same method of dsRNA inhibition to the known pathogen sequence would have been expected to be successful.
In addition, the applicant does not provide any result of targeting SEQ ID NO: 59, not to mention to have any unexpected result. in Example 12 ([0424]), the specification does not describe/demonstrate if the targeting by the dsRNA was effective, not to mention provided any data to demonstrate if such dsRNA and such targeting were effective controlling the fungus pathogen. Thus, the applicant merely claims using dsRNA to target a genus of SEQ ID NOs, SEQ ID NO: 59 being one of the many species, which is deemed obvious in view of the cited prior art.
Therefore, the invention would have been obvious to one ordinary skill in the art.
Claims 11 and 18 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Posada-Buitrago et al in view of Duplessis et al, Burk et al, Puzio et al and Battur et al, as applied to claims 9 and 12 above, and further in view of Roberts et al (US 20080022423, published 1/24/2008), and Goellner et al (Phakopsora pachyrhizi, the causal agent of Asian soybean rust. MOLECULAR PLANT PATHOLOGY. 11(2), 169–177, 2010).
Claims 9 and 12 have been analyzed above.
Claims 11 and 18 limit claims 9 and 12: said plant is a soybean, oilseed, rice or potato plant.
As analyzed above, Posada-Buitrago et al teach that SEQ ID NO: 59 is a fungal pathogen sequence causing soybean rust.
Puzio et al additionally suggest making transgenic soybean and rice (p591, lines 15-29), but Posada-Buitrago et al in view of Duplessis et al, Burk et al, Puzio et al and Battur et al do not explicitly teach using dsRNA to inhibit fungal SDH and SEQ ID NO: 59 in soybean plant.
Roberts et al teach, claim and demonstrated a detailed method of making transgenic soybean plant expressing dsRNA to silence fungal pathogen sequences, particularly soybean rust and pathogens from Phakopsora pachyrizi ([0012], Example 3 in [0145]-[0156], claim 28-29).
Goellner et al teach that Phakopsora pachyrhizi is the major and aggressive fungus causing soybean rust disease (p169, summary; p171, left col, 2nd para). Goellner et al teach producing molecular genetic tools for resistance to pathogens of Phakopsora pachyrhizi in soybean (p170, left col, 2nd para, p172, whole right col, p173-p174, whole pages). Thus, Goellner et al provide strong support and motivation to Roberts et al to target pathogen sequences from fungus Phakopsora pachyrhizi, particularly in soybean plant.
It would have been prima facie obvious at the time the invention to modify the invention rendered obvious by the teaching of Posada-Buitrago et al in view of in view of Duplessis et al, Burk et al, Puzio et al and Battur et al, such that the invention (method and transgenic plant) is applied to soybean plant, as suggested by Puzio et al and taught by Roberts et al. Goellner et al provide strong motivation for one ordinary skill in the art to do so, because the SDH sequence of Posada-Buitrago et al Phakopsora pachyrhizi had been known to cause soybean rust, and because Goellner et al had provided strong motivation to target pathogens from Phakopsora pachyrhizi in soybean plant. The expectation would have been high because applying the exact method of dsRNA inhibition to the known pathogen sequence would have been expected to be successful. The method of making transgenic soybean expressing dsRNA silencing fungal pathogens had been taught by Roberts et al.
Therefore, the dependent claims would have been obvious to one ordinary skill in the art.
Response to Arguments
Claim Rejections - 35 U.S.C. § 103
Posada-Buitrago
The applicant argues that Posada-Buitrago does not do not teach or suggest a dsRNA sequence.
The argument is not deemed persuasive. Although Posada-Buitrago does not directly teach the subject matter of dsRNA as acknowledged by PTO, Posada-Buitrago et al teach a polynucleotide sequence from Phakopsora pachyrhizi 100% identical to SEQ ID NO: 59 (364 bases). Duplessis et al (F4S1J2_MELLP) teach a saccharopine dehydrogenase (SDH) sequence comprising both SEQ ID NO: 60 (33 aa) and SEQ ID NO: 61 (70 aa). By Sequence alignment (pairing), both SEQ ID NO: 60 and SEQ ID NO: 61 match 100% to SEQ ID NO: 59. Thus, SEQ ID NO: 59 comprises sequences encoding SEQ ID NO: 60 and SEQ ID NO: 61, SDH peptides. Posada-Buitrago et al further specifically indicate that the sequence is from a soybean rust pathogen from Phakopsora pachyrhizi.
Burk
The applicant argues that Burk teaches/notes that SDH is a drug target and such that drugs could specifically inhibit fungal SDH because of the structure of this enzyme. However,
the claims are not directed to a drug interacting with the structure of the enzyme; rather, the claims recite transgenic products (e.g., plants) that prevents synthesis of the enzyme. Accordingly, the instant claims address a stage where no enzyme exists and thus Burk is not pertinent.
The argument is fully considered but not deemed persuasive. Burk et al teach that SDH from fungi is pathogenic to humans and plants and is a suitable target for antimicrobial drug development (p745, Abstract, Introduction in left and right cols), and teach making inhibitors of the fungal SDH.
Regarding “instant claims address a stage where no enzyme exists”, it is not a claim requirement. Scientifically, if the SDH gene is present, some mRNAs and some SDH proteins are made. Either an inhibit and a dsRNA are for reducing the SDH proteins although they act in a different stage. Reducing expression and reducing activity are alternatives to each other.
Puzio and Battur
The applicant argues that Puzio discloses over 16,000 sequences, none of which are relevant to the elected sequences. Moreover, while Puzio generally discusses RNAi and
other technologies, it is silent on cross-species effectiveness of RNAi. The applicant cites a few paragraphs of Puzio, and argues that Puzio is broad and generic, and nothing in Puzio suggests using plant-produced RNAi to reduce SDH in fungi, let alone a reasonable expectation of success of doing so.
The applicant argues that Battur discloses that SDH appears in fungi, plants, mammals and arthropods, and RNAi for reducing LKR/SDH expression in ticks, i.e. arthropods. The document does not disclose any dsRNA targeting of the SDH gene in plants or fungi. Accordingly, Battur is also not pertinent.
The applicant then argues that none of the references alone or in combination would have provided a reason for one of ordinary skill in the art to reduce SDH expression in plant pathogenic fungi, nor would one of ordinary skill in the have a reasonable expectation that the expression of a dsRNA in plants would be sufficient to inhibit expression of SDH in fungi.
The arguments are fully considered but not deemed persuasive.
Because Puzio is broad and generic, Battur is cited to provide the needed expectation of success. Puzio et al and Battur et al collectively teach using dsRNA to inhibit and silence fungal SDH, as an alternative of fungal SDH inhibitors of Burk et al, as analyzed above. At the very least, Battur teaches and demonstrates the techniques and methods of inhibiting SDH.
In response to applicant's arguments against the references individually, one cannot show non-obviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
An invention would have been obvious to one ordinary skill in the art if any teaching, suggestion or motivation in prior art leading the one to combine the teaching(s) or suggestion(s) of the cited references to arrive the claimed invention.
In this particular case, although none of the individual references teaches the claimed subject matter, the references in combination clearly suggest the claims, and provide strong motivation to reduce the suggestions to practice by one ordinary skill in the art:
Posada-Buitrago et al and Duplessis et al (F4S1J2_MELLP) collectively teach a sequence encoding SDH from Phakopsora pachyrhizi 100% identical to SEQ ID NO: 59, and indicate that the sequence is a soybean rust pathogen sequence. Accordingly, Posada-Buitrago et al and Duplessis et al teach a strong motivation to inhibit such sequence.
The teaching of the methods of inhibiting such sequence, by inhibitor (reducing activity) or by dsRNA (reducing expression) is provided by the supporting references.
Making and using inhibitors and/or dsRNA to inhibit known fungal pathogen had been known technique and taught in prior art. In this case, making and using dsRNA to inhibit fungal SDH would have been obvious in view of Burk et al, Puzio et al, and Battur et al, as analyzed above. Burk also additionally teaches that fungal SDH is a pathogen to plants, supporting the motivation to inhibit SEQ ID NO: 59 (a known fungal-soybean rust pathogen sequence).
Accordingly, the references in combination, not only teach or suggest all aspects of the claims, but also provide a strong motivation to reduce the teaching in practice by one ordinary skill in the art. The references also teach and demonstrate that the dsRNA, as a technique, works on SDH.
In addition, for compact prosecution, the examiner went through the applicant’s examples in the specification, but did not find any paras that the applicant actually targeted SEQ ID NO: 59, not to mention provides any result of targeting SEQ ID NO: 59, not to mention to have any unexpected result. in Example 12 ([0424]), the specification does not describe/demonstrate if the targeting by the dsRNA was effective, not to mention provided any data to demonstrate if such dsRNA and such targeting were effective controlling the fungus pathogen. Thus, the applicant merely claims using dsRNA to target a genus of SEQ ID NOs, SEQ ID NO: 59 being one of the many species, which is deemed obvious in view of the cited prior art.
If the applicant can indicate or provide any demonstrated success (without new matter), the examiner would consider and analyze.
Regarding unexpected result, please note
Pursuant to MPEP 716.02(b), the evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992) (Mere conclusions in appellants’ brief that the claimed polymer had an unexpectedly increased impact strength "are not entitled to the weight of conclusions accompanying the evidence, either in the specification or in a declaration."); Ex parte C, 27 USPQ2d 1492 (Bd. Pat. App. & Inter. 1992). In another word, the results demonstrated by the applicant must be both statistical and practical significant, and that they are in fact unexpected.
In addition, even if the applicant can make such a showing, MPEP 716.02(c) provides that the evidence of unexpected results must be weighed against evidence supporting prima facie obviousness in making a final determination of the obviousness of the claimed invention. MPEP 716.02(c) directs the examiner to MPEP 716.01(d), which establishes that although the record may establish evidence of secondary considerations which are indicia of non-obviousness, the record may also establish such a strong case of obviousness that the objective evidence of non-obviousness is not sufficient to outweigh the evidence of obviousness. Newell Cos. v. Kenney Mfg. Co., 864 F.2d 757, 769, 9 USPQ2d 1417, 1427 (Fed. Cir. 1988), cert. denied, 493 U.S. 814 (1989); Richardson-Vicks, Inc., v. The Upjohn Co., 122 F.3d 1476, 1484, 44 USPQ2d 1181, 1187 (Fed. Cir. 1997) (showing of unexpected results and commercial success of claimed ibuprofen and pseudoephedrine combination in single tablet form, while supported by substantial evidence, held not to overcome strong prima facie case of obviousness). The showing, when made, must outweigh the rationale in support of a finding of prima facie obviousness provided in the 103 rejection(s). In another word, does the evidence outweigh the obviousness rationale?
Furthermore, MPEP 716.02(d) provides that whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of non-obviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980). In another word, is the evidence commensurate with the scope of the claims? In this case, for example, the independent claim recites all plant cells, not cells of specific plant species.
Sequence matches
Against instant SEQ ID NO: 59
EH244602
LOCUS EH244602 364 bp mRNA linear EST 01-JAN-2007
DEFINITION JGI_ACAC11309.fwd ACAC Phakopsora pachyrhizi TW72-1 germinating
urediniospores on water surface (20C/16 hours/dark) Phakopsora
pachyrhizi cDNA clone ACAC11309 5', mRNA sequence.
ACCESSION EH244602
VERSION EH244602.1
DBLINK BioSample: SAMN00152503
KEYWORDS EST.
SOURCE Phakopsora pachyrhizi
ORGANISM Phakopsora pachyrhizi
Eukaryota; Fungi; Dikarya; Basidiomycota; Pucciniomycotina;
Pucciniomycetes; Pucciniales; Phakopsoraceae; Phakopsora.
REFERENCE 1 (bases 1 to 364)
AUTHORS Posada-Buitrago,M.L., Brokstein,P.B., Boore,J.L. and Frederick,R.D.
TITLE Comparative Analysis of expressed sequence tags in the soybean rust
pathogen Phakopsora pachyrhizi at different stages of the infection process
JOURNAL Unpublished
COMMENT Other_ESTs: JGI_ACAC11309.rev
Contact: Dr. Reid D. Frederick, Ph.D.
USDA-ARS-NAA Foreign Disease-Weed Science Research Unit
1301 Ditto Avenue, Ft. Detrick, MD 21702-5023, USA
Tel: 301 619 7386
Fax: 301 619 2880
Email: Reid.Frederick@ars.usda.gov
cDNA Library Preparation: USDA
DNA Sequencing: DOE Joint Genome Institute: http://www.jgi.doe.gov
Naming Conventions: EST name is generated by the concatenation of
the JGI Clone Id and the direction of sequencing. The suffix '.fwd'
indicates a forward sequencing read of the insert.
Poly-A: Based upon the presence of a run of 14 or more A residues
at the end of this sequence, this clone was polyadenylated. The
resulting Poly-A sequence has been removed.
Small Insert: Based upon one or more sequencing reads of this clone
where vector sequence was present at both ends, this clone has been
determined to contain a cDNA insert on the order of 600-1000 bases.
Plate: ACAC 0117 row: j column: 19
POLYA=Yes.
FEATURES Location/Qualifiers
source 1..364
/organism="Phakopsora pachyrhizi"
/mol_type="mRNA"
/strain="Taiwan 72-1"
/db_xref="taxon:170000"
/clone="ACAC11309"
/clone_lib="SAMN00152503 ACAC deh pachyrhizi TW72-1
germinating urediniospores on water surface (20C/16
hours/dark)"
/dev_stage="Germinating urediniospores"
/lab_host="DH10B"
/note="Vector: pSPORT1; Site_1: NotI; Site_2: SalI; 1.
Total RNA was isolated from germinating spores of P.
pachyrhizi isolate TW 72-1 using the ToTally RNA kit
(Ambion, Inc., Austin, TX), and the poly(A)+ mRNA was
purified using the OLIGOTEX mRNA purification kit (Qiagen,
Valencia, CA). 2. First strand cDNA was primed with a NotI
primer-adapter (5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3'
3. Double-stranded cDNA was ligated to Sal I adapter,
digested with NotI and cloned into the pSPORT1 vector
pre-cut with NotI and SalI. 4. The ligation mix was
transformed into DH10B cells."
Query Match 100.0%; Score 364; DB 81; Length 364;
Best Local Similarity 100.0%;
Matches 364; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AATTGCCTGAAGAATTACCCGGGTTGGAAGTTTGTTCAATTGATCATTTACCTACCCTTT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 AATTGCCTGAAGAATTACCCGGGTTGGAAGTTTGTTCAATTGATCATTTACCTACCCTTT 60
Qy 61 TACCTAGAGAATCATCTCAGCAGTTTTCAGAAGACTTGTTACCAACAATAGTTCAGTTAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TACCTAGAGAATCATCTCAGCAGTTTTCAGAAGACTTGTTACCAACAATAGTTCAGTTAA 120
Qy 121 AGAGTTATATAAATCAGAGTGGAGATTGTAAAGATGGTCCAAAAGTTTGGAATGAAGCGA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 AGAGTTATATAAATCAGAGTGGAGATTGTAAAGATGGTCCAAAAGTTTGGAATGAAGCGA 180
Qy 181 AGGATCTGTTTGATAAGATGATTGGAGAGATTTGAATGGATGAGATTCGAAAAGTTTGTT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 AGGATCTGTTTGATAAGATGATTGGAGAGATTTGAATGGATGAGATTCGAAAAGTTTGTT 240
Qy 241 TTCTTGTTTTGAAGATGCTATATATGATTTACCAAAGAAAAAAAGGGGGGGAGAGAAGCG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 TTCTTGTTTTGAAGATGCTATATATGATTTACCAAAGAAAAAAAGGGGGGGAGAGAAGCG 300
Qy 301 AGCAAATTTTATTGCTTTCTTTTTTTTATCTCGCTTTTAATTAATTAAACAATAATTCCA 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 AGCAAATTTTATTGCTTTCTTTTTTTTATCTCGCTTTTAATTAATTAAACAATAATTCCA 360
Qy 361 TCTT 364
||||
Db 361 TCTT 364
Against instant SEQ ID NO: 60 (encoded peptide sequence)
RESULT 1
F4S1J2_MELLP
ID F4S1J2_MELLP Unreviewed; 373 AA.
AC F4S1J2;
DT 28-JUN-2011, integrated into UniProtKB/TrEMBL.
DT 28-JUN-2011, sequence version 1.
DT 11-DEC-2019, entry version 44.
DE RecName: Full=Saccharopine dehydrogenase [NAD(+), L-lysine-forming] {ECO:0000256|PIRNR:PIRNR018250};
DE Short=SDH {ECO:0000256|PIRNR:PIRNR018250};
DE EC=1.5.1.7 {ECO:0000256|PIRNR:PIRNR018250};
DE AltName: Full=Lysine--2-oxoglutarate reductase {ECO:0000256|PIRNR:PIRNR018250};
GN ORFNames=MELLADRAFT_117783 {ECO:0000313|EMBL:EGG01496.1};
OS Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7) (Poplar leaf
OS rust fungus).
OC Eukaryota; Fungi; Dikarya; Basidiomycota; Pucciniomycotina;
OC Pucciniomycetes; Pucciniales; Melampsoraceae; Melampsora.
OX NCBI_TaxID=747676 {ECO:0000313|Proteomes:UP000001072};
RN [1] {ECO:0000313|Proteomes:UP000001072}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=98AG31 / pathotype 3-4-7 {ECO:0000313|Proteomes:UP000001072};
RX PubMed=21536894; DOI=10.1073/pnas.1019315108;
RA Duplessis S., Cuomo C.A., Lin Y.-C., Aerts A., Tisserant E.,
RA Veneault-Fourrey C., Joly D.L., Hacquard S., Amselem J., Cantarel B.L.,
RA Chiu R., Coutinho P.M., Feau N., Field M., Frey P., Gelhaye E.,
RA Goldberg J., Grabherr M.G., Kodira C.D., Kohler A., Kuees U.,
RA Lindquist E.A., Lucas S.M., Mago R., Mauceli E., Morin E., Murat C.,
RA Pangilinan J.L., Park R., Pearson M., Quesneville H., Rouhier N.,
RA Sakthikumar S., Salamov A.A., Schmutz J., Selles B., Shapiro H.,
RA Tanguay P., Tuskan G.A., Henrissat B., Van de Peer Y., Rouze P.,
RA Ellis J.G., Dodds P.N., Schein J.E., Zhong S., Hamelin R.C.,
RA Grigoriev I.V., Szabo L.J., Martin F.;
RT "Obligate biotrophy features unraveled by the genomic analysis of rust
RT fungi.";
RL Proc. Natl. Acad. Sci. U.S.A. 108:9166-9171(2011).
CC -!- CATALYTIC ACTIVITY:
CC Reaction=H2O + L-saccharopine + NAD(+) = 2-oxoglutarate + H(+) + L-
CC lysine + NADH; Xref=Rhea:RHEA:12440, ChEBI:CHEBI:15377,
CC ChEBI:CHEBI:15378, ChEBI:CHEBI:16810, ChEBI:CHEBI:32551,
CC ChEBI:CHEBI:57540, ChEBI:CHEBI:57945, ChEBI:CHEBI:57951; EC=1.5.1.7;
CC Evidence={ECO:0000256|PIRNR:PIRNR018250};
CC -!- PATHWAY: Amino-acid biosynthesis; L-lysine biosynthesis via AAA
CC pathway; L-lysine from L-alpha-aminoadipate (fungal route): step 3/3.
CC {ECO:0000256|PIRNR:PIRNR018250}.
CC -!- SIMILARITY: Belongs to the AlaDH/PNT family.
CC {ECO:0000256|PIRNR:PIRNR018250}.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; GL883138; EGG01496.1; -; Genomic_DNA.
DR RefSeq; XP_007415346.1; XM_007415284.1.
DR STRING; 203908.EGG01496; -.
DR EnsemblFungi; EGG01496; EGG01496; MELLADRAFT_117783.
DR GeneID; 18926093; -.
DR KEGG; mlr:MELLADRAFT_117783; -.
DR EuPathDB; FungiDB:MELLADRAFT_117783; -.
DR InParanoid; F4S1J2; -.
DR KO; K00290; -.
DR OrthoDB; 498994at2759; -.
DR UniPathway; UPA00033; UER00034.
DR Proteomes; UP000001072; Unassembled WGS sequence.
DR GO; GO:0003729; F:mRNA binding; IEA:EnsemblFungi.
DR GO; GO:0004754; F:saccharopine dehydrogenase (NAD+, L-lysine-forming) activity; IEA:UniProtKB-EC.
DR GO; GO:0019878; P:lysine biosynthetic process via aminoadipic acid; IEA:UniProtKB-UniPathway.
DR CDD; cd12188; SDH; 1.
DR InterPro; IPR007886; AlaDH/PNT_N.
DR InterPro; IPR007698; AlaDH/PNT_NAD(H)-bd.
DR InterPro; IPR027281; Lys1.
DR InterPro; IPR036291; NAD(P)-bd_dom_sf.
DR PANTHER; PTHR11133:SF15; PTHR11133:SF15; 1.
DR Pfam; PF05222; AlaDh_PNT_N; 1.
DR PIRSF; PIRSF018250; Saccharopine_DH_Lys; 1.
DR SMART; SM01002; AlaDh_PNT_C; 1.
DR SMART; SM01003; AlaDh_PNT_N; 1.
DR SUPFAM; SSF51735; SSF51735; 1.
PE 3: Inferred from homology;
KW Amino-acid biosynthesis {ECO:0000256|PIRNR:PIRNR018250};
KW Lysine biosynthesis {ECO:0000256|PIRNR:PIRNR018250};
KW NAD {ECO:0000256|PIRNR:PIRNR018250, ECO:0000256|PIRSR:PIRSR018250-3};
KW Oxidoreductase {ECO:0000256|PIRNR:PIRNR018250};
KW Reference proteome {ECO:0000313|Proteomes:UP000001072}.
FT DOMAIN 11..147
FT /note="AlaDh_PNT_N"
FT /evidence="ECO:0000259|SMART:SM01003"
FT DOMAIN 178..323
FT /note="AlaDh_PNT_C"
FT /evidence="ECO:0000259|SMART:SM01002"
FT NP_BIND 206..207
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT NP_BIND 324..327
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT ACT_SITE 81
FT /note="Proton acceptor"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-1"
FT ACT_SITE 100
FT /note="Proton donor"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-1"
FT BINDING 135
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 230
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 234
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 254
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 283
FT /note="NAD; via carbonyl oxygen"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT DISULFID 208..252
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-4"
SQ SEQUENCE 373 AA; 41789 MW; D52414FEB4163FF8 CRC64;
Query Match 80.6%; Score 137; DB 22; Length 373;
Best Local Similarity 75.8%;
Matches 25; Conservative 5; Mismatches 3; Indels 0; Gaps 0;
Qy 1 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLL 33
: ::|| ||||||||||||||||:|:||| |||
Db 312 IDDQLPSLEVCSIDHLPTLLPREASEQFSNDLL 344
Instant SEQ ID NO: 60 Against Instant SEQ ID NO: 59 (BLAST TN 2 sequences)
Score
Expect
Method
Identities
Positives
Gaps
66.2 bits(160)
1e-21
Compositional matrix adjust.
33/33(100%)
33/33(100%)
0/33(0%)
Query 1 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLL 33
LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLL
Sbjct 3 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLL 101
Against instant SEQ ID NO: 61 (encoded peptide sequence)
F4S1J2_MELLP
ID F4S1J2_MELLP Unreviewed; 373 AA.
AC F4S1J2;
DT 28-JUN-2011, integrated into UniProtKB/TrEMBL.
DT 28-JUN-2011, sequence version 1.
DT 10-FEB-2021, entry version 48.
DE RecName: Full=Saccharopine dehydrogenase [NAD(+), L-lysine-forming] {ECO:0000256|PIRNR:PIRNR018250};
DE Short=SDH {ECO:0000256|PIRNR:PIRNR018250};
DE EC=1.5.1.7 {ECO:0000256|PIRNR:PIRNR018250};
DE AltName: Full=Lysine--2-oxoglutarate reductase {ECO:0000256|PIRNR:PIRNR018250};
GN ORFNames=MELLADRAFT_117783 {ECO:0000313|EMBL:EGG01496.1};
OS Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7) (Poplar leaf
OS rust fungus).
OC Eukaryota; Fungi; Dikarya; Basidiomycota; Pucciniomycotina;
OC Pucciniomycetes; Pucciniales; Melampsoraceae; Melampsora.
OX NCBI_TaxID=747676 {ECO:0000313|Proteomes:UP000001072};
RN [1] {ECO:0000313|Proteomes:UP000001072}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=98AG31 / pathotype 3-4-7 {ECO:0000313|Proteomes:UP000001072};
RX PubMed=21536894; DOI=10.1073/pnas.1019315108;
RA Duplessis S., Cuomo C.A., Lin Y.-C., Aerts A., Tisserant E.,
RA Veneault-Fourrey C., Joly D.L., Hacquard S., Amselem J., Cantarel B.L.,
RA Chiu R., Coutinho P.M., Feau N., Field M., Frey P., Gelhaye E.,
RA Goldberg J., Grabherr M.G., Kodira C.D., Kohler A., Kuees U.,
RA Lindquist E.A., Lucas S.M., Mago R., Mauceli E., Morin E., Murat C.,
RA Pangilinan J.L., Park R., Pearson M., Quesneville H., Rouhier N.,
RA Sakthikumar S., Salamov A.A., Schmutz J., Selles B., Shapiro H.,
RA Tanguay P., Tuskan G.A., Henrissat B., Van de Peer Y., Rouze P.,
RA Ellis J.G., Dodds P.N., Schein J.E., Zhong S., Hamelin R.C.,
RA Grigoriev I.V., Szabo L.J., Martin F.;
RT "Obligate biotrophy features unraveled by the genomic analysis of rust
RT fungi.";
RL Proc. Natl. Acad. Sci. U.S.A. 108:9166-9171(2011).
CC -!- FUNCTION: Catalyzes the NAD(+)-dependent cleavage of saccharopine to L-
CC lysine and 2-oxoglutarate, the final step in the alpha-aminoadipate
CC (AAA) pathway for lysin biosynthesis. {ECO:0000256|ARBA:ARBA00004078}.
CC -!- CATALYTIC ACTIVITY:
CC Reaction=H2O + L-saccharopine + NAD(+) = 2-oxoglutarate + H(+) + L-
CC lysine + NADH; Xref=Rhea:RHEA:12440, ChEBI:CHEBI:15377,
CC ChEBI:CHEBI:15378, ChEBI:CHEBI:16810, ChEBI:CHEBI:32551,
CC ChEBI:CHEBI:57540, ChEBI:CHEBI:57945, ChEBI:CHEBI:57951; EC=1.5.1.7;
CC Evidence={ECO:0000256|ARBA:ARBA00001177,
CC ECO:0000256|PIRNR:PIRNR018250};
CC -!- PATHWAY: Amino-acid biosynthesis; L-lysine biosynthesis via AAA
CC pathway; L-lysine from L-alpha-aminoadipate (fungal route): step 3/3.
CC {ECO:0000256|ARBA:ARBA00004884, ECO:0000256|PIRNR:PIRNR018250}.
CC -!- SUBUNIT: Monomer. {ECO:0000256|ARBA:ARBA00011245}.
CC -!- SIMILARITY: Belongs to the AlaDH/PNT family.
CC {ECO:0000256|ARBA:ARBA00005689, ECO:0000256|PIRNR:PIRNR018250}.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; GL883138; EGG01496.1; -; Genomic_DNA.
DR RefSeq; XP_007415346.1; XM_007415284.1.
DR STRING; 203908.EGG01496; -.
DR EnsemblFungi; EGG01496; EGG01496; MELLADRAFT_117783.
DR GeneID; 18926093; -.
DR KEGG; mlr:MELLADRAFT_117783; -.
DR VEuPathDB; FungiDB:MELLADRAFT_117783; -.
DR eggNOG; KOG0172; Eukaryota.
DR HOGENOM; CLU_063085_0_0_1; -.
DR InParanoid; F4S1J2; -.
DR OrthoDB; 498994at2759; -.
DR UniPathway; UPA00033; UER00034.
DR Proteomes; UP000001072; Unassembled WGS sequence.
DR GO; GO:0003729; F:mRNA binding; IEA:EnsemblFungi.
DR GO; GO:0004754; F:saccharopine dehydrogenase (NAD+, L-lysine-forming) activity; IEA:UniProtKB-EC.
DR GO; GO:0019878; P:lysine biosynthetic process via aminoadipic acid; IEA:UniProtKB-UniPathway.
DR CDD; cd12188; SDH; 1.
DR InterPro; IPR007886; AlaDH/PNT_N.
DR InterPro; IPR007698; AlaDH/PNT_NAD(H)-bd.
DR InterPro; IPR027281; Lys1.
DR InterPro; IPR036291; NAD(P)-bd_dom_sf.
DR Pfam; PF05222; AlaDh_PNT_N; 1.
DR PIRSF; PIRSF018250; Saccharopine_DH_Lys; 1.
DR SMART; SM01002; AlaDh_PNT_C; 1.
DR SMART; SM01003; AlaDh_PNT_N; 1.
DR SUPFAM; SSF51735; SSF51735; 1.
PE 3: Inferred from homology;
KW Amino-acid biosynthesis {ECO:0000256|ARBA:ARBA00022605,
KW ECO:0000256|PIRNR:PIRNR018250};
KW Disulfide bond {ECO:0000256|ARBA:ARBA00023157};
KW Lysine biosynthesis {ECO:0000256|ARBA:ARBA00023154,
KW ECO:0000256|PIRNR:PIRNR018250};
KW NAD {ECO:0000256|PIRNR:PIRNR018250, ECO:0000256|PIRSR:PIRSR018250-3};
KW Oxidoreductase {ECO:0000256|PIRNR:PIRNR018250};
KW Reference proteome {ECO:0000313|Proteomes:UP000001072}.
FT DOMAIN 11..147
FT /note="AlaDh_PNT_N"
FT /evidence="ECO:0000259|SMART:SM01003"
FT DOMAIN 178..323
FT /note="AlaDh_PNT_C"
FT /evidence="ECO:0000259|SMART:SM01002"
FT NP_BIND 206..207
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT NP_BIND 324..327
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT ACT_SITE 81
FT /note="Proton acceptor"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-1"
FT ACT_SITE 100
FT /note="Proton donor"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-1"
FT BINDING 135
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 230
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 234
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 254
FT /note="NAD"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT BINDING 283
FT /note="NAD; via carbonyl oxygen"
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-3"
FT DISULFID 208..252
FT /evidence="ECO:0000256|PIRSR:PIRSR018250-4"
SQ SEQUENCE 373 AA; 41789 MW; D52414FEB4163FF8 CRC64;
Query Match 58.6%; Score 217; DB 25; Length 373;
Best Local Similarity 58.6%;
Matches 41; Conservative 12; Mismatches 9; Indels 8; Gaps 1;
Qy 1 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLLPTIVQLKSYINQSGDCKDGPKVWNEAK 60
: ::|| ||||||||||||||||:|:||| |||||::||| | |||::|
Db 312 IDDQLPSLEVCSIDHLPTLLPREASEQFSNDLLPTLLQLKDLSNS--------KVWSDAN 363
Qy 61 DLFDKMIGEI 70
|||::|: ||
Db 364 DLFNQMVNEI 373
Instant SEQ ID NO: 61 Against Instant SEQ ID NO: 59 (BLAST TN 2 sequences)
Score
Expect
Method
Identities
Positives
Gaps
Frame
143 bits(361)
2e-51
Compositional matrix adjust.
70/70(100%)
70/70(100%)
0/70(0%)
+3
Query 1 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLLPTIVQLKSYINQSGDCKDGPKVWNEAK 60
LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLLPTIVQLKSYINQSGDCKDGPKVWNEAK
Sbjct 3 LPEELPGLEVCSIDHLPTLLPRESSQQFSEDLLPTIVQLKSYINQSGDCKDGPKVWNEAK 182
Query 61 DLFDKMIGEI 70
DLFDKMIGEI
Sbjct 183 DLFDKMIGEI 212
Conclusion
No claim is allowed.
THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). The applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Contact information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Wayne Zhong/
Primary Examiner, Art Unit 1662