Prosecution Insights
Last updated: April 19, 2026
Application No. 16/474,198

SYNTHETIC GUIDE MOLECULES, COMPOSITIONS AND METHODS RELATING THERETO

Final Rejection §103§112§DP
Filed
Jun 27, 2019
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Editas Medicine Inc.
OA Round
4 (Final)
52%
Grant Probability
Moderate
5-6
OA Rounds
3y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
32 granted / 61 resolved
-7.5% vs TC avg
Strong +60% interview lift
Without
With
+60.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
49 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
7.3%
-32.7% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.5%
-17.5% vs TC avg
§112
28.4%
-11.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 251-266, 274 are pending. Claims 265-266, 274 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/12/2023. Claims 251-264 are examined here along with elected species of structure 1 of instant cl. 254; phosphodiester linkage; OH group for R2’ and/or R3’; L and R comprises polyethylene glycol; SEQ ID NO: 39 and SEQ ID NO: 61 for instant cl. 258. Priority Acknowledgement is made of applicant’s claim of benefit of PCT application US17/69019, filed on 12/29/2017, which claims benefit of U.S. provisional applications 62/492,001 and 62/441,046, filed on 04/28/2017 and 12/30/2016, respectively. All the examined claims enjoy the filing date of ‘046 filing. Information Disclosure Statement The information disclosure statement (IDS) submitted on 12/17/2025 was filed before the mailing of this Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Nucleotide and/or Amino Acid Sequence Disclosures The objection regarding sequence disclosure is withdrawn. The Remarks (of 12/17/2025, pg. 11-12) are persuasive. The Remarks note that the sequences in Fig. 8A-8H, 9A-9D, 10A-D may contain one or more nucleotide sequences for the purposes of a sequence listing as required by 37 C.F.R. 1.821-1.825. Claim Rejections - 35 USC § 112 Rejection of claims 256 is withdrawn, it is amended and 3rd and 4th unimolecular guide molecules are deleted. Claim Rejections - 35 USC § 103 The rejection of claims 251-264 is maintained. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 251-252, 254-257, 259-264 are rejected under 35 U.S.C. 103 as being unpatentable over Aoki et al. (US20190382758, pub: 12/19/2019, EFD: 1/30/2016, hereinafter referred as Aoki, of record) and, as evidenced by NEB Protocol for In Vitro Digestion of DNA with Cas9 Nuclease, S. pyogenes, accessed from NEB.com 09/27/23, of record, for claims 259, 260. Regarding instant cl. 251, Aoki discloses an invention of artificial single guide RNA (sgRNA, i.e. similar to instant unimolecular guide molecule) and CRISPR/Cas9 system to lower the off-target cleavage issues caused by introducing DNA expression vectors encoding sgRNA (Abstract, par. 4). Because introducing unmodified RNA molecule is sensitive to nucleases (par. 5, 170), Aoki discloses using non-nucleotide linkers to conjugate the 3’ end of CRISPR RNA (crRNA), which contains the desired targeting nucleotide sequence (i.e. guide region), and 5’ end of trans-activating crRNA (tracrRNA), which is required for recruitment of Cas9 nuclease, to increase stability of artificial sgRNA without interfering Cas9’s cleavage activity (par. 18-19). Aoki discloses chemically-modified single guide RNA (sgRNA) represented by formula A: PNG media_image1.png 321 706 media_image1.png Greyscale where Xa is an amino acid derivative linker represented by the following formula (I): PNG media_image2.png 238 868 media_image2.png Greyscale where X2 is O and Y2 is NH, providing a non-nucleotide linker with urea moiety; L1 is either a polyether (CH2CH2O) chain or alkylene chain with n carbon atoms, L2 is either a polyether chain or an alkylene chain with m carbon atoms, with (n)20 is a nucleotide (nt.) sequence consisting of 20+/-5 nt. residues on Formula I; while 3’ end nt. sequence 3’ of Xa formula is greater than 20 nt. (claim 1). R1 and R2 may be each independently a nucleotide (claim 1). Aoki discloses Xa with L2 as alkylene chain with alkylene is methylene (-CH2-) or ethylene (-CH2CH2-)(par. 147) and L1 as polyether chain, which maybe polyethylene glycol (par. 80). Although Aoki discloses that n of L1 and m of L2 are not particularly limited, but due to manufacturing cost and yield, preferably n and m are more preferably 0 to 20 or more preferably n + m is, more preferably 0 to 15 (par. 82). MPEP 2144.05 provides that when the claimed ranges lie within ranges disclosed by prior art, a prima facie case of obviousness exists; here Aoki discloses 0-20 for polyethylene glycol ((CH2CH2O), so a prima facie case of obviousness exists (relevant to instant cl. 251’s L1 and R1). In Formula I, Xc and Xd, may or may not be present, and when present, they are each independently an amino acid derivative linker represented by formula (I) (claim 1). Xb and Y are independently 1-5 optional nt. linkers or amino acid derivative linker of formula I. Aoki discloses unmodified nucleotide residue (par. 176), thus implicitly containing a phosphodiester linkage. Further, unmodified ribo-nucleotide residue also contain OH group in the 2’ of the ribose, thus R2’ is an OH group; further notes that 2’-position can be substituted with hydrogen or fluoro (par. 179). A is any atomic group. Aoki discloses that the sgRNA with the ribophosphate backbone with the non-linking oxygen, i.e. the oxygen atom not linked to the sugar residues, can be oxygen (par. 181, relevant for R2 and R3). Aoki’s Formula A sequence (see fig. 1 below, read from 5’ to 3’)) has a duplex nt. sequence comprising UUUUA (relevant to instant s with value of 5), a duplex nt. sequence comprising CUA (relevant to instant u of 3), bulge sequences of 2 nt. (GA) at 5’ end and 4 nt. (AAGU) at 3’ end of Xa (relevant to instant x and y values of 2 and 4, respectively; thus y > x) and has a sequence at 5’ end of (n)20, which is greater than 15 (relevant to instant m value), while sequence at 3’ end is ~40 nt. (greater than 30; relevant to instant n value). Further, the single-guide RNA formula(I), representing Xa, indicates R1 and R2, when present, are each independently a nucleotide residue, thus when present results in p and q being zero (claim 1, relevant to instant p and q with integer of zero). Fig. 1: Aoki Formula A with depiction of instant s, x, y, u values. PNG media_image3.png 321 706 media_image3.png Greyscale Aoki discloses substituting nt. linker loop sequence (for e.g. GAAA) that connects 3’ terminal crRNA and 5’ terminal tracrRNA with non-nt. linker with amino acid derivative(s) results in equal or higher activity compared to original two separate sgRNA and provides greater stability (par. 16-17). Here, although the amino acid derivative still has the following structure in formula(I) PNG media_image4.png 74 75 media_image4.png Greyscale , the inclusion of the structure in formula(I) is not patentably distinct from instant structure. Therefore, claim 251 is obvious. Regarding instant cl. 252, Aoki discloses single-guide RNA of formula A where R1 and R2 are each independently a nucleotide residue (claim 1) and immediately adjacent to the complementary sequence comprising CUA (see Fig. 1 above, represented by “u”), thus resulting in lacking instant p and q values in formula A and thus are 0. Regarding instant cl. 254, wherein the guide molecule is of elected formula: PNG media_image5.png 217 205 media_image5.png Greyscale wherein: u′ is an integer between 2 and 22, inclusive; and p′ and q′ are each independently an integer between 0 and 4, inclusive, and p′+q′ is an integer between 0 and 4, inclusive. Aoki discloses formula A comprising a nt. sequence (see Fig. 1 above) and comprising formula(I), with R1 and R2 read as independently being a nt. (claim 1) immediately adjacent to nt. sequence CUA (relevant to instant u’ value of 3), thus, the sequence of formula A lacks instant p’ and instant q’, thus the p’ and q’ values are 0, with designated nt. sequence of GA represented as x in figure 1 above (relevant to instant 2 nt. in the bulge) and the designated sequence of AAGU represented by y in figure 1 above (relevant to instant 4 nt. in the bulge). Regarding instant cl. 255, Aoki’s sequence in Formula A lacks p’ and q’, thus are 0. Regarding instant cl. 256, 257, Aoki discloses Xa with L2 as alkylene chain with alkylene being methylene (-CH2-) or ethylene (-CH2CH2-) (par. 147) and L1 as polyether chain, which maybe polyethylene glycol (par. 80). Aoki discloses the number of L1 linker(s) and L2 linker(s) in formula(I), as generally “not particularly limited” but adds that the number of each L1 and L2 linkers is more preferably between 0 to 15 due to manufacturing cost and yield (par. 82), which encompasses instant n with a value of 6 and instant m with a value of 4 with total as 10 total number of linkers. Under MPEP 2131.03 (II): When the prior art discloses a range which touches or overlaps the claimed range, but no specific examples falling within the claimed range are disclosed, a case by case determination must be made as to anticipation. In order to anticipate the claims, the claimed subject matter must be disclosed in the reference with "sufficient specificity to constitute an anticipation under the statute." What constitutes a "sufficient specificity" is fact dependent. Here, Aoki’s range is narrow, since it notes that it is preferably between 0 to 15 and the total of n+m falls within the range noted in prior art. Further Aoki discloses that a 2’-position carbon can be modified from a hydroxyl group to hydrogen, thus it is possible to substitute the ribose residue with deoxyribose (par. 179); thus here the instant 2’ ribose has either a hydroxyl or hydrogen and the substitution is obvious. Regarding instant cl. 259 and 260, Aoki discloses a composition of substrate DNA mixed with sgRNA and Cas9 using reagents from New England Biolabs (par. 216), as evidenced by New England S. Pyogenes Cas9 digestion protocol, the reagents are constituted in NEBuffer. Regarding instant cl. 261, the “wherein the guide molecule and the Cas9 protein form a complex capable of interacting with a target nucleic acid” indicates the inherent property of the components, i.e. to form a complex capable of interacting with a target nucleic acid. Aoki discloses the exemplary studies where substrate target plasmid DNA is mixed with Cas9/sgRNA to study the cleavage of target plasmid DNA, e.g. Fig. 1 (par. 216-219). Aoki discloses that Cas9 can be recruited by sgRNA of present invention to the target double-stranded DNA and the PAM motif (par. 206). Regarding instant cl. 262-264, the specification defines substantially free of molecules as “molecules are not major components in the recited composition. For example, a composition substantially free of a molecule means that the molecule is less than 5% . . . (by mass or molarity) in the composition” (par. 141). Various methods for determination of purity of guide molecule are providing, including chromatography (HPLC) (par. 185). All the “substantially free of formulas” are considered byproducts, and are interpreted as such and noted as such. The instant claims 262-264 are obvious over Aoki and although the art does not teach that the composition is “substantially free of” byproduct molecules of claims 262, 263 and 264, absent evidence of the contrary, it would have been prima facie obvious to make the composition as pure as possible such that it would be “substantially free of” byproduct molecules. Aoki discloses using HPLC (par. 214) or gel chromatography (par. 228) to purify sgRNA. Claims 253 and 258 are rejected under 35 U.S.C. 103 as being unpatentable over Aoki (US20190382758, pub: 12/19/2019, EFD: 1/30/2016) as applied to claims 251-252, 254-257, 259-261 above, and further in view of Friedland et al. (WO2015148863, pub: 10/01/2015, as a 102(a)(1) reference published by applicant but is before the one year exception; of record, hereinafter referred as Friedland). Regarding instant cl. 253 and 258, SEQ ID NO: 61 is a 67 nt. tracrRNA: gcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggc accgagucggugcuuuu: while SEQ ID NO: 39 is a 35 nt. crRNA sequence: guaacggcagacuucuccuc guuuuagagcuaugc, with the first 20 nt. sequence being a guide RNA that binds to the genomic region (bold, underlined portion) while the last 15 nt. comprises the repeat region and anti-repeat region (designated by s and u, respectively, in fig. 1 above). SEQ ID NO:39 comprises a sequence, the underlined portion, that targets the human beta-globin gene (HBB), since the sequence is complementary to the human globin gene. Aoki discloses substituting nt. linker loop sequence that connects the 3’ terminal crRNA and 5’ terminal tracrRNA with non-nt. linker, which results in equal or higher activity compared to original two separate sgRNA and provides greater stability (par. 16-17). Aoki discloses a portion of consensus sequences of instant SEQ ID NO: 39 and SEQ ID NO: 61. Aoki discloses a consensus portion of instant SEQ ID NO: 39 (the repeat and anti-repeat region: GUUUUAGAGCUAUAGC). Aoki discloses a tracrRNA sequence SEQ ID NO: 2 derived from S. pyogenes in par. 62, a 69 nt. sequence which is identical to 64/67nt. of instant SEQ ID NO: 67 but lacks the three terminal uracils at the 3’ end, see alignment below (Qy is instant SEQ ID NO: 61, Db is SEQ ID NO: 2 of Aoki). Qy 1 GCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG 60 Db 6 GCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG 65 Qy 61 UGCUUUU 67 Db 66 UGCU 69 Aoki discloses that sgRNA can include several (up to 10) nt. residue substitution, insertion or addition and still be functional for both the binding and performing a double stranded break (DSB) in the target nucleic acid as long as the characteristic hairpin structure of sgRNA is maintained (par. 171). Thus, the instant SEQ ID NO: 61 is not patentably distinct from SEQ ID NO: 2 of Aoki. Aoki does not disclose u is an integer between 4 and 14 (cl. 253) nor a guide sequence that targets the HBB gene of SEQ ID NO: 39 (cl. 258). Friedland discloses Crispr/Cas-related methods and compositions for treating sickle cell disease (title). Friedland discloses a guide RNA sequence SEQ ID NO:27 for which only the proximal 5’ end sequence flanking the GAAA tetraloop sequence is noted here: (N)20GUUUUAGAgcuaugcuGAAAagcauagcAAGUUAAAA, and (N)20 can incorporate any targeting domain or guide sequence of interest (pg. 83, line 14-19). The lowercase italicized nt. sequences flanking the GAAA tetraloop are 8 nt. in length that are complementary to each other, i.e. the anti-repeat region termed in Aoki, see fig. 1 above for illustrative purposes. Thus u has a value of 8 and is between 4 and 14 (relevant to instant cl. 253). Regarding the N20 sequence, i.e. the guide RNA sequence, Friedland also discloses a guide RNA sequence SEQ ID NO: 388 (GUAACGGCAGACUUCUCCUC) (pg. 704), which comprises the first 20 nt. of instant SEQ ID NO: 39. Fig. 14 illustrates that SEQ ID NO: 388 is a one of the best pairs of gRNA (pg. 704). Freidland’s SEQ ID NO: 388 can be incorporated into the N20 portion of SEQ ID NO:27, which when combined read on instant SEQ ID NO: 39. Both SEQ ID NO: 388 and instant SEQ ID NO: 39 are targeted against (human beta-globin) HBB gene that is associated with sickle cell disease. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the guide region of Aoki in view of Friedland and arrive at the claimed invention with a reasonable expectation of success. Based on Friedman’s results that sgRNA comprising SEQ ID NO: 388 is one of the best pairs of gRNA for editing HBB gene, one of ordinary skill in the art would reasonably expect success when the N20 guide region of Aoki is substituted with guide RNA sequence of Friedman to target the HBB gene for treating sickle cell disease as taught by Friedland and to substitute anti-repeat region of Aoki with anti-repeat region taught by Friedland. Response to Arguments Applicant's arguments filed 12/17/2025 (“the Remarks”) have been fully considered but they are not persuasive. Under the umbrella of the Office Action has not provided a reason as to why the particular urea containing species of Aoki would be selected, the Remarks argue the following: Due to the “myriad variables of formula (I) and a person of ordinary skill in the art would therefore be required to select specific substituents from an extensive list of alternatives” (pg. 13), and with lack of examples for II-4 or II-7 species, i.e. the urea containing species (pg. 14), of Aoki, there lacks a motivation or rationale for a skilled artisan to select these species (pg. 13-14). Aoki’s II-4 and II-7, illustrated below, are distinct from instant claimed linkers and no rationale is provided why a modifications (e.g., remove the ring moiety of proline amino acid) would be made to arrive to the claimed linkers (pg. 14-15). PNG media_image6.png 125 470 media_image6.png Greyscale The arguments are not persuasive. First, the Action (pg. 9) noted that Aoki provides sufficient rationale, i.e. to protect sgRNA from nucleases for increased stability, for selecting the non-nucleotide linkers containing amino acids that link the two or more portions of single guide molecule. Further, they test various amino acid linkers, including proline amino acid containing linker (see Table 5, pg. 38). Thus, Aoki has provided examples of several species of the genus of Formula I. Further, Aoki also notes that similar linkers have been applied to other nucleotide sequences (siRNA, miRNA, par. 6) and the amino acid derivates are interchangeable (see par. 18, 170). Addressing argument 1), thus not all the species disclosed need to be tested. Here, the illustration is sufficient. Addressing argument 2), the Examiner does not contest that there is a distinction between the instant claimed urea-containing linkers and those of Aoki, but rather that they are not patentably distinct. Thus, the Examiner is not suggesting the modifications noted by the Remarks. Aoki’s urea containing a tertiary amine versus instant claimed urea containing a secondary amine is not patentably distinct, both contain urea and based on disclosure are equally efficient or even more efficient in nuclease degradation (see, e.g., Fig. 1). Since if urea is the critical component of the claimed non-nucleotide linker and Aoki discloses a species of non-nucleotide linker with urea, the Arguments fail to note why instant claimed structure is functionally distinct. Applicant can provide evidence of secondary considerations. Although not an argument, the Remarks “remind[s]” the use of blaze marks is for written description and not to an obviousness rejection (pg. 13); the Examiner notes that the language used was in response to the earlier Remarks arguing that “one of ordinary skill in the art would not at once envisage the linker of the claimed guide molecules” (pg. 21 of 11/11/2024, underline added for emphasis, envisage suggests a written description issue). Thus the rejection of examined claims is maintained. Double Patenting The rejection of Claims 251-256, 258-264 is maintained. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 251-256, 259-260, 262-264 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 4, 7, 10-11, 15 of U.S. Patent No. 12,338,436 to Editas (referred as Editas). Although the claims at issue are not identical, they are not patentably distinct from each other. Regarding instant cl. 251, Editas teaches in claim 1, a synthetic unimolecular guide molecule of CRISPR system with the formula of A2’-ii (see structure below), comprising the non-nt. linker with the formula (La)f-M-(La)f, with M is N(F)C(O)N(R) and R is H, thus a urea moiety of NH-C(O)-NH. PNG media_image7.png 920 631 media_image7.png Greyscale Claim 1 of Editas teaches formulas comprising a (La)f-M-(La)f motif, with La defined as including a substituted, saturated C1-C50 hydrocarbon chain, wherein one or more methylene units are optionally replaced by various moieties, including C(O)N(R), with R being further encompassing C1-6 aliphatic chain. Thus, e.g. for (La)g, if the methylene at position 1 of La is replaced with a C(O)N(R) moiety adjacent to a nitrogen moiety, the replacement will result in an at least one urea moiety in the formula. Further if (La)f is a covalent bond or another substituted carbon moiety, the Editas structure(s) of claim 1 is not patentably distinct from instant formulas of claim 251. The limitations of R2’, R3’, B1, B2 of instant cl. 251 corresponds with Editas’s claim 1 limitations of R2’, R3’, B1, B2 (underlined in claim 1 above). Regarding phospho-linkage, Editas’s claim 10-11 discloses a (R2)-P-(R3), with R2 and R3 defined as same as instant cl. 251 and teaches a linkage involving the phosphorous group (see excerpt below of cl. 10 and 11). PNG media_image8.png 186 315 media_image8.png Greyscale . Thus, the instant non-nucleotide linker conjugated to the phosphate group is obvious. While limitations of instant m, x, p, q, u, y, s, n of claim 251 are recited in Editas’s claim 3 (see excerpt of cl. 3 below): PNG media_image9.png 711 423 media_image9.png Greyscale Thus, claim 251 is obvious. Regarding instant cl. 252, Editas’s claim 3 teaches limitations of p and q each independently an integer between 0 and 6, which encompasses the instant p and q are each 0, thus claim 252 is obvious. Regarding instant cl. 253, Editas’s claim 3 teaches limitation of u is an integer between 2 and 22, inclusive, which encompasses instant u is an integer between 4 and 14. Thus cl. 253 is obvious. Regarding instant cl. 254, 256, claim 7 of Editas teaches a guide molecule of C3’-ii (see below for excerpt of claim 7) and with interpretation of La as noted above, instant cl. 254 and 256 are obvious. PNG media_image10.png 499 328 media_image10.png Greyscale Regarding instant cl. 255, the range of p’ and q’ of claim 7 of Editas p’ and q’ encompasses the p’ and q’ integers are each 0 of instant cl. 255, thus claim 255 is obvious. Regarding instant cl. 259, claim 1 and 4 of Editas teaches a pharmaceutically acceptable salt; Regarding instant cl. 260, claim 15 teaches where the guide molecule is suspended in solution or in a pharmaceutically carrier. Regarding instant cl. 262-264, although Editas does not teach that the composition is “substantially free of” byproduct molecules of claims 262, 263 and 264, absent evidence of the contrary, it would have been prima facie obvious to make the composition as pure as possible such that it would be “substantially free of” byproduct molecules. Claims 258 and 261 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 4, 7, 10-11, 15 of U.S. Patent No. 12,338,436 to Editas (referred as Editas) in view of Friedland et al. (WO2015148863, pub: 10/01/2015, as a 102(a)(1) reference published by applicant but is before the one year exception; hereinafter referred as Friedland). The disclosure of Editas reference is noted above. Editas does not teach SEQ ID NO: 39 and SEQ ID NO: 61 (cl. 258) and that composition of guide molecule further comprising a Cas9 protein, wherein the guide molecule and Cas9 protein form a complex capable of interacting with a target nucleic acid comprising (i) a sequence complementary to the targeting domain sequence of the guide molecule; and (ii) a PAM sequence that is recognized by the Cas9 protein (cl. 261). Friedland discloses Crispr/Cas-related methods and compositions for treating sickle cell disease (title). Friedland discloses a single guide RNA sequence SEQ ID NO:27 for which only the proximal sequence flanking the GAAA tetraloop sequence is noted here: (N)20GUUUUAGAgcuaugcuGAAAagcauagcAAGUUAAAA, and (N)20 can incorporate any targeting domain or guide region of interest (pg. 83, line 14-19). SEQ ID NO: 27 comprises a sequence 3’ of GAAA sequence that is capable of recruiting an endonuclease, such as Cas9 (pg. 82, lines 12-14). Regarding the N20 sequence in SEQ ID NO: 27, i.e. the guide RNA sequence, Friedland also discloses a guide RNA sequence SEQ ID NO: 388 (GUAACGGCAGACUUCUCCUC) (pg. 704), which comprises the first 20 nt. of SEQ ID NO: 27. SEQ ID NO: 388 incorporated in SEQ ID NO: 27 comprises the instant SEQ ID NO: 39 and SEQ ID NO: 61, except for the 4 Us at the end of SEQ ID NO: 61 (see alignment below, top Qy is instant SEQ ID NO: 39 (solid line underline) and SEQ ID NO: 61 (dashed underline), Db is Friedland’s SEQ ID NO: 388 and SEQ ID NO: 27) (relevant to instant cl. 258). Friedland Fig. 14 illustrates that SEQ ID NO: 388 is a one of the best pairs of gRNA when tested in culture cells with wild type and nickases version of Cas9 molecule (pg. 704, relevant to instant cl. 261; successfully editing requires that Cas9 protein interacted with target nucleic acid by targeting domain of the guide molecule and Cas9 was recruited to the genome and recognized the PAM sequence for cleavage). SEQ ID NO: 388 targets (human beta-globin) HBB gene that is associated with sickle cell disease. PNG media_image11.png 238 598 media_image11.png Greyscale One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the nucleotides of Editas structure in cl. 7 in view of Friedland and arrive at the claimed invention with a reasonable expectation of success. Based on the positive outcome of CRISPR system using SEQ ID NO: 388 and a Cas9 tracrRNA to target HBB gene of Friedland, a skilled artisan would reasonably expect successful editing of HBB gene following replacing Ns in claim 1 or 7 of Editas and replace them with SEQ ID NO: 388 and a tracrRNA sequence to recruit an endonuclease of Friedland to edit HBB gene to treat sickle cell disease. Thus claims 258 and 261 are obvious. Response to Arguments Applicant's arguments filed 12/17/2025 have been fully considered but they are not persuasive. The Remarks insist that “[n]o reasoning has been provided by the Office Action” of removing a defining feature of the linker of claim 1 of the ‘436 patent and “merely points to the selection of a single chemical moiety, from a multitude of other potential chemical moieties contained within a significantly larger structure” (pg. 16), thus failing to fulfill a prima facie obviousness requirement (pg. 16). The argument is not persuasive. As noted in prior response, the broad reading of the Editas still incorporates the urea linking moiety by the “La” modification along with the taught M structure. The action did not remove any moieties nor is modifying the M structure, thus no modification is required. The claims specifically teach what La can be replaced with, i.e. what is permitted, and R can be modified with additional substituted groups (see claim 1). There is no picking or selecting required from a “larger” group. Claim 1 is a Markush claim and each species is an alternative useable member and the action merely replaces those alternative useable member. Thus, a case for obviousness has been established. The rejection is maintained. Allowable Subject Matter No claim allowed. Conclusion THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Jun 27, 2019
Application Filed
Sep 29, 2023
Non-Final Rejection — §103, §112, §DP
Feb 05, 2024
Response Filed
Apr 30, 2024
Final Rejection — §103, §112, §DP
Nov 11, 2024
Request for Continued Examination
Nov 12, 2024
Response after Non-Final Action
Jul 10, 2025
Non-Final Rejection — §103, §112, §DP
Dec 17, 2025
Response Filed
Feb 25, 2026
Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
2y 5m to grant Granted Apr 14, 2026
Patent 12570974
OLIGONUCLEOTIDES FOR CONTROLLING TAU SPLICING, AND USES THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12516322
MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12509716
FUNCTIONAL LIGANDS TO TARGET MOLECULES
2y 5m to grant Granted Dec 30, 2025
Patent 12509681
COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+60.4%)
3y 8m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month