DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after 16 March 2013, is being examined under the first-inventor-to-file provisions of the AIA .
Status
1. The first Office action in the prosecution of this application was a restriction requirement posted 9 June 2021. Applicant elected the invention of Group I, drawn to a DNA construct comprising a heterologous promoter operably linked to a DNA polynucleotide encoding an RNA transcript comprising a 5' regulatory sequence located 5' to an insert site, wherein the 5' regulatory sequence comprises an R-motif, without traverse in the response filed 26 August 2021. In addition, the following species were elected: SEQ ID NO:141, SEQ ID NO:25 and SEQ ID NO:322.
Following that, there were a non-final rejection on 12 November 2021 and a final rejection on 31 March 2022. Applicant filed an RCE which was followed by a non-final rejection on 11 March 2022, and a final rejection on 26 May 2023. Applicant filed an RCE in August of 2023 and that was followed by a restriction requirement on26 December 2023. Applicant responded first on 26 February 2024 and then on 18 July 2024 electing SEQ ID NO:191.
Claims 1, 2, 4, 5, 6, 7, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 35 and 38 as filed on 26 July 2023 were examined and rejected in a non-final action posted on 31 October 2024. Claims 8, 25, 26, 27, 28, 29, 35 remained withdrawn. Applicant responded on 6 February 2025. The above claims remained rejected (and withdrawn) in a final rejection posted on 19 May 2025. Applicant responded on 19 August 1015; an Advisory Action followed on 29 September 2025.
Applicant filed an RCE on 17 October 2025. The Office posted a non-final action on 9 February 2026. Applicant responded on 9 June 2026.
Claims 1, 2, 4, 5, 6, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 35 and 38 as filed on 26 July 2023 are examined herein. Claims 8, and 25-29 remain withdrawn.
Applicant is reminded that upon the cancellation of claims, the inventorship should be amended in compliance with 37 CFR 1.48(b) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. Any amendment of inventorship must be accompanied by a request under 37 CFR 1.48(b) and by the fee required under 37 CFR 1.17(i).
Examiner’s Notes & Claim Interpretation
Citations to Applicant’s specification are abbreviated herein “Spec.”
Occasionally herein the abbreviation “SIN” may be used for “SEQ ID NO:”
Claim 1 is drawn to a DNA construct which includes both a promoter and a transcribable polynucleotide (in other words, a gene). An “mRNA” transcribed from this construct has, in one embodiment “(a)” the mRNA has its normal meaning, that is a coding polynucleotide sequence and a 5′ UTR (and presumably a 3′ UTR. In the other embodiment “(b)” instead of the gene sequence in RNA nucleotides, there is an insert site. As an aside, In a minimalist interpretation “insert site” and given the capabilities of CRISPR, that could be any DNA sequence.
The 5′ UTR has two heterologous R-motifs. Each is a polynucleotide 15-20 nucleotides in length consisting of G and A nucleotides in a ratio from 1G:1A to 1G:14A, wherein each of the R-motif sequences is separated by 0-60 nucleotides.
SEQ ID NO:191 was previously elected and examined.
Since the transitional phrase “consisting of” is used, the R motif has no pyrimidines.
The open reading frame (“ORF”) referenced as “major.” the limitation “major” only appears to mean “non-trivial.” Certainly the claim allows the ORF to be a gene encoding a polypeptide.
The claim also requires that the R-motifs, which must be heterologous, be present in a transcribed RNA. Although it recites the limitation “heterologous” there is no requirement as to how the “heterologous” comparison is made. They do not need to be “heterologous” to each other and may be “heterologous” to either the mORF or the insert site.
Withdrawal of Objections and Rejections
The rejections of the claims under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite is withdrawn in view of Applicant’s amendments to the claims.
The rejection of the claims under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement regarding “new matter” is withdrawn in view of Applicant’s amendments to the claims.
8. Any rejection or objection applying to a cancelled claim is rendered moot in view of the claim’s cancellation.
Claim Objections
Claim 1 is objected to for the following informality.
Claim 1 is objected to because it recites the limitation “the heterologous polypeptide” in lines 12-13 but the antecedent basis of the limitation is only in regards to an insert site (part (b)) that allows insertion of a coding polynucleotide.
Setting aside the question of the value of creating an mRNA consisting of a 5′ UTR and an insert site.
Appropriate correction is requested.
35 USC § 103-based Claim Rejections
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
§ 103. Conditions for patentability; non-obvious subject matter
A patent for a claimed invention may not be obtained, . . . . if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 2, 4, 9, 16, 18, 19, 20, 21, 22, 23, 24, and 38 are rejected under 35 U.S.C. 103 as being unpatentable over
Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06
in view of Gleba et al. WO 2002/029068 A2
The factual inquiries set forth in Graham v. John Deere Co .of Kansas City, 383 U.S. 1, 17-18, 148 USPQ 459, 467 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
a. Determining the scope and contents of the prior art.
b. Ascertaining the differences between the prior art and the claims at issue.
c. Resolving the level of ordinary skill in the pertinent art.
d. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 1 is interpreted supra, and that interpretation is incorporated by reference here.
Neither of the cited references appear to fully teach the claim limitations but in combination, as seen below, they do.
Dorokhov et al. teaches AAAGAAGAGAGAAAACUGAAAAGGCAGAAAA as an IRES (internal ribosome entry site). P. 5305 (1st text). Since no pyrimidines are present, this falls within the scope of the limitation requiring “consisting of G and A nucleotides.”
The first segment, AAAGAAGAGAGAAAA, of this sequence is 15 purines at a ratio of 4 Gs to 11 As. The second segment, GAAAAGGCAGAAAA, is 14 purines at a ratio of 4 Gs to 11 As.
Figure 4’s legend also references AAAGAAGGAAAAAGAAGG (18, 12 As to 6 Gs) and references “multiple G(A)3 modules.” The authors abbreviate internal ribosome entry site as IRES.
In the WO publication by some of the authors, the publication teaches making non-natural IRES (p. 39) and at the top of page 40 teach an embodiment where the first poly-purine element is 38 nucleotides and the second is 42. By inspection, there are more As than Gs in each. Immediately below that sequence, they teach using it to express a heterologous polypeptide. At the top of page 42, Gleba et al. teaches using plant cells.
Since claim 1 uses open language – “comprises” the extended length does not distinguish the claim from the teachings.
Further, given the numerous embodiments taught above, using heterologous poly-purine segments to enhance expression is an obvious variant.
Thus it would have been prima facie obvious to one of ordinary skill in the art as of the effective filing date of the claimed invention to combine the known elements according to the language of the claims.
Given the level of skill in the art as of the effective filing date of the claimed invention one of ordinary skill in the art would have had a reasonable expectation of success.
Given the generic phrasing of claim 1 referencing poly-purine motifs with more As than Gs is obvious of a certain minimum length in order to enhance expression is obvious. Further, extending the IRES of Dorokhov et al. by a single nucleotide is an obvious variant.
Thus claim 1 is obvious.
Since claim 38 encompasses minor sequence features, it is an obvious species in view of the above teachings and thus claim 38 is obvious.
Since Gleba et al. teaches viral genomes with one transcript encoding multiple ORFs (e.g., p. 5, 2nd para., claim 2 is obvious.
Given the teachings above, using multiple IRESs / R-motifs is obvious and thus claim 4 is obvious.
Given that the embodiment at the top of page 4 can be thought of as 4 R-motifs either poly-purine stretch is reasonably interpreted as 2 R-motifs separated by 0 nucleotides, and thus clam 9 is obvious.
Dorokhov et al. teaches the 35S promoter (1st pg. lwr. rt.), known as a plant promoter, and thus claim 16 is obvious. (See also p. 5302, lwr.rt.; “appropriate promoter.”) Since this last-cited section teaches plasmids, claims 18 and 19 are obvious. Dorokhov et al.’s abstract teaches plant protoplasts and thus claims 20 and 21 are obvious. On page 5302, Dorokhov et al. teaches tobacco protoplasts (see heading in upper left) and thus claims 22, 23 and 24 are obvious.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06 in view of
Gleba et al. WO 2002/029068 A2 in further view of
Krieg et al., US Patent Publication 2015/0232836 A1
As seen above, claim 1 is obvious in view of the first two references.
The third reference, Krieg et al., teaches several thousand sequences. One of them, SEQ ID NO:2, is referenced as a PRC2-associated” DNA sequence (para. 0007)
Claim 6 recites various sequences. Below are the sequences of the SEQ ID NOs recited in claim 6 in approximate order.
gaaagagagagagag
gagagagagagagag
gagaaagaaagagag
aagagagaaagagag
gaagaagaagaagag
gaagaagaagaagaa
ggaagagaagaagaa
agaagagagagagag
ggaggagaagaagaa
aaaagaaagaaagaa
gaaaaagaaagaaaa
aagagagaagaagaa
gaaagaaaaaaaaaa
aaagaaaagagagaa
gagaaagaaagaaaa
ggaggaggaagagaa
agaagaaagaaagaa
gaaaaaaaaaaaaaa
aaaggaaaaagaaaa
aaaagaaaaaaaaaa
aaagaagaaaaaaaa
ggaaaagaagaaaaa
aaaaaaagaggagaa
gaaagaaggagaaaa
gggagaagagaagag
aaaaaggaagaagag
aaaaagaaaaaagaa
gaaggagaagaaaga
In the aggregate the listed sequences are obvious variations on the theme of poly-purines with at least as many As as Gs. Therefore, claim 6, which in aggregate claims variations on the theme, is obvious.
Further, according to the sequence listing, most, if not all, are from Arabidopsis. Additionally, at least SEQ ID NOs:114; 127; and 142 are found in Krieg et al.’s SEQ ID NO:2. (SEQ ID NO:127 actually appears twice in Krieg et al.’s SEQ ID NO:2.
Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over
Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06
in view of Gleba et al. WO 2002/029068 A2 in further view of
Lomonossoff et al., U.S. Patent Publication No. 2009/0181460 A1.
As seen above, claim 1 is obvious over the first two references. Neither of those references explicitly teaches an inducible promoter.
Lomonossoff et al., which also teaches a translational enhancer, further teaches an inducible promoter (para. 0004) in connection with expression-enhancing invention. Thus claim 17 is obvious.
Applicant’s Argument & Response
Applicant traverses the rejection beginning on page 9.
Applicant analyzes the teachings of Dorokhov et al. Applicant states:
Intercistronic sequences, containing the IRES elements, were inserted between the main ORF and downstream ORF (i.e., downstream of the main ORF and not in the 5' UTR.
Response, p. 9, ll. 7-8.
In response, is Applicant arguing the Dorokhov et al. anticipates claim 1?
5' UTR is a relative term that mans the UTR 5' of a coding sequence.
Applicant’s specification provides no particular meaning to a “mORF” that excludes the second (or more) ORF taught in Dorokhov et al.
. Nothing in the specification or the claim requires that the mORF be the FIRST ORF in a dicistronic message. Again, the claim uses open language – “comprising” and “comprises.” “5' UTR” is a relative term that denotes a UTR upstream of a reading frame. Applicant admits that the IRES are inserted into the 5' UTR of the second message.
In any case, Dorokhov et al. cites to an earlier publication for details – Skulachev et al. Dorokhov et al., p. 5301, 2nd col., l. 14 (“23”).
See in particular Figure 3, diagram E. Skulachev et al. (1999) Virol 263:139-54.
Applicant’s argument fails to persuade because the claim uses open language and nothing in the claim excludes dicistronic messages.
Further the prior art teaches placing IRES in 5′ UTRs to enhance expression. See, for example,
Woolaway et al. (2001) J Virol 75(21):10244–49, e.g., the title.
On the bottom of page 9, Applicant alleges that
one of ordinary skill in the art would not look to Dorokhov for a way to increase expression by modifying a 5'UTR.
This is unsupported attorney argument. If it works in the internal 5′UTR of a dicistronic message, why wouldn’t it w0ork in other 5′UTRs?
On page 10, Applicant turns to the rejections of claims 6 and 17, but rests the argument solely on the previous argument.
Thus Applicant’s argument was fully considered but is not persuasive.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached on 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUSSELL T BOGGS/
Examiner, Art Unit 1663
Prosecution Insights