DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after 16 March 2013, is being examined under the first-inventor-to-file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action was withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 17 October 2025 was entered.
Status
1. The first Office action in the prosecution of this application was a restriction requirement posted 9 June 2021. Applicant elected the invention of Group I, drawn to a DNA construct comprising a heterologous promoter operably linked to a DNA polynucleotide encoding an RNA transcript comprising a 5' regulatory sequence located 5' to an insert site, wherein the 5' regulatory sequence comprises an R-motif, without traverse in the response filed 26 August 26 2021. In addition, the following species were elected: SEQ ID NO:141, SEQ ID NO:25 and SEQ ID NO:322.
Following that, there were a non-final rejection on 12 November 2021, and a final rejection on 31 March 2022. Applicant filed an RCE which was followed by a non-final rejection on 11 March 2022, and a final rejection on 26 May 2023. Applicant filed an RCE in August of 2023 and that was followed by a restriction requirement on26 December 2023. Applicant responded first on 26 February 2024 and then on 18 July 2024 electing SEQ ID NO:191.
Claims 1, 2, 4, 5, 6, 7, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 35 and 38 as filed on 26 July 2023 were examined and rejected in a non-final action posted on 31 October 2024. Claims 8, 25, 26, 27, 28, 29, 35 remained withdrawn. Applicant responded on 6 February 2025. The above claims remained rejected (and withdrawn) in a final rejection posted on 19 May 2025. Applicant responded on 19 August 1015; an Advisory Action followed on 29 September 2025.
Applicant filed an RCE on 17 October 2025.
Claims 1, 2, 4, 6, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 35 and 38 as filed on 19 August 2025 are examined herein. . Claims 8, 25, 26, 27, 28, 29, and 35 remain withdrawn.
Applicant is reminded that upon the cancellation of claims, the inventorship should be amended in compliance with 37 CFR 1.48(b) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. Any amendment of inventorship must be accompanied by a request under 37 CFR 1.48(b) and by the fee required under 37 CFR 1.17(i).
Examiner’s Notes & Claim Interpretation
Citations to Applicant’s specification are abbreviated herein “Spec.”
Occasionally herein the abbreviation “SIN” may be used for “SEQ ID NO.”
Claim 1 is drawn to a DNA construct. The only defined structural element of the DNA construct is the requirement for two heterologous R-motifs.
SEQ ID NO:191 was previously elected and examined.
The claim also requires an “insert site” or an open reading frame (“ORF”) referenced as “major.”
In a minimalist interpretation “insert site” and given the capabilities of CRISPR, that could be any DNA sequence. Although the ORF is referenced as “major” the limitation “major” only appears to mean “non-trivial.” Certainly the claim allows the ORF to be a gene encoding a polypeptide.
The claim also requires that the R-motifs, which must be heterologous, be present in a transcribed RNA.
The claim includes the, probably preferred, embodiment that the R-motifs are transcribed together with a gene encoding a polypeptide into a single RNA where the R-motifs are 5′ prime to the ORF and will sever to enhance translation of the RNA. But the claim is much broader than that.
SEQ ID NO:191 appears to be free of the prior art of record when used in the preferred embodiment of one of two 5′UTR elements in an mRNA. Since SEQ ID NO:191 appears free of the art, other sequences are used in further examination.
SEQ ID NO:191 itself is known to the prior art. For example, it is in SEQ ID NO: 82276 in Krieg et al. (cited infra).
Krieg et al. (cited infra) teaches several thousand sequences. One of them, SEQ ID NO:2, is referenced as a PRC2-associated” DNA sequence. It comprises instant SEQ ID NO:142 and SEQ ID NO:114. Applicant’s sequence listing teaches that these sequences are also found in Arabidopsis and are therefore heterologous to the human DNA taught by Krieg et al.
All the sequences recited in claim 6 are relatively short and thus it is reasonable to expect numerous matches in the available sequence databases.
35 USC § 112(b)-Based Claim Rejections
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
2. Claims 1 2, 4, 6, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 35 and 38 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is rejected because it recites the limitation “the mRNA” and that limitation lacks an antecedent basis. For one thing, a DNA construct is being claimed which may included a coding sequence, for example, but the composition itself does not include RNAs. This is emphasized by the limitation “capable of producing an mRNA in a cell.
Claim 1 is also rejected because it recites the limitation “similar” in reference to a comparative gene in line 14.
Applicant could have used the word “same” but Applicant chose not to do so. Therefore the scope of “similar” is indefinite. Does it mean encoding a similar protein in terms of its function? Does it mean a certain unspecified amount of sequence identity? Does it mean the same G/C ratios? Since expression of bacterial genes, with a higher A/T ratio, in plants is known to be inefficient. E.g., Adang & Murray, U.S. Patent No. 6,015,89 (e.g. abstract)..
Claim 1 is the only independent claim.
Dependent claims are included in this rejection because they fail to provide limitation obviating this rejection.
35 USC § 112(a) based Claim Rejections under the written description requirement
The following is a quotation of 35 U.S.C. 112(a):
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
3. Claims 1, 2, 4, 6, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 38 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Applicant’s arguments (Response of 19 August, pp. (9-10) have been fully considered but are not persuasive. They are tailored to the prior Office action and corresponding claims.
Claim 1 is drawn to a DNA construct. The only well-defined structural element of the DNA construct, in terms of polynucleotide sequence, is the requirement for two poly-purine heterologous R-motifs. At one point SEQ ID NO:191 was elected and examined.
Claim 1 is interpreted supra and that interpretation is incorporated by reference herein.
In the response filed on 2 February, Applicant provided a heavily amended claim 1.
In that response, for example, Applicant added "capable of producing an mRNA in a cell. The word "capable" only occurs 4 places in the specification and never in that context.
Likewise, "producing an mRNA" is not present in the specification with "producing" only occurring once and not in that context.
Also not present is "similar mRNA."
The above limitations also do not appear in the original claims nor the abstract.
Further, "encoded" does not appear in the specification except in the title of publication #29 on page 90. Additionally, it appears in the claims-as-initially filed (claim 1 ), not in the context of an ORF.
This is a New Matter rejection.
In a 1997 case, the Federal Circuit held that, for defining an invention, it was the disclosure of the application that matters and that that the invention must described in the specification. The court held that:
It is the disclosures of the applications that count. Entitlement to a filing date does not extend to subject matter which is not disclosed, but would be obvious over what is expressly disclosed. It extends only to that which is disclosed. While the meaning of terms, phrases, or diagrams in a disclosure is to be explained or interpreted from the vantage point of one skilled in the art, all the limitations must appear in the specification. The question is not whether a claimed invention is an obvious variant of that which is disclosed in the specification. Rather, a prior application itself must describe an invention, and do so in sufficient detail that one skilled in the art can clearly conclude that the inventor invented the claimed invention as of the filing date sought.
Lockwood v. American Airlines Inc., 107 F3d 1565, 41 USPQ2d 1961, 1966 (Fed. Cir.
1997).
Thus, thus the claims as amended comprise NEW MATTER. In response to this rejection, Applicant was required to point to support for the claims or to cancel the new matter.
Dependent claims are included in this rejection because none provide limitations obviating this rejection. Claim 1 is the only independent claim.
Applicant’s Arguments and Response
Applicant cites to MPEP(II)(3)(a) which cites to a 1972 case. Pp. 6-7. Applicant returns to this case later in page 7. Applicant points to an amendment removing “independently.” At the top of page 8, Applicant points to MPEP § 2163,07(I).
In response to Applicant’s citation to this section of the MPEP, the amendments submitted by Applicant are far beyond a ‘mere rephrasing.’ The amended claim is 18 lines long. Only two lines are unmodified.
Then in the first full paragraph of page 8, Applicant turns to a 1973 case. Lockwood v. American Airlines Inc.is a 1997 decision.
In aggregate, Applicant filed an extensively modified claim that introduced a number of concepts though language that was not supported by the specification. As seen above, some of the changes resulted in rejections under 35 USC 112(b).
Further, the introduced word “capable” is tricky. A “DNA construct comprising a promoter and a DNA polynucleotide encoding an RNA transcript” is reasonably interpreted as inherently able to produce an mRNA in a cell, so is the introduced limitation redundant of does it have additional meaning?
Further, except for the definition of an R-motif which uses the word “consisting of” the claim uses open language throughout. So additional elements can be added to the core structure.
Additionally, lines 6 and 7, questions are raided. Part (a) references “a downstream major open reading frame.” Is that the same thing that is referenced as a “polynucleotide encoding an RNA transcript” in line 2 or something different? Further, part (b) references an insert site. Does that replace the polynucleotide in line 2 or is the limitation effectively meaningless because given CRISPR (e.g. Spec., p. 13, ll. 25-28) any sequence can be targeted.
It is also noted that Applicant makes numerous assertions as to how one of skill in the art would interpret the added claim limitations. For example:
one skilled in the art would readily recognize Applicant was in possession of a DNA construct comprising a promoter, a 5' UTR comprising R motif sequences, and a downstream mORF wherein the construct is capable of "capable of producing an mRNA in a cell," and analyzing expression by comparing with a "similar" mRNA.
Response, p. 10, ll. 3-6. The assertions, however, are not supported by any intrinsic or extrinsic evidence. As seen above, a detailed analysis of the claim language as amended presents difficulties.
Thus, Applicant’s arguments fail to persuade.
In the end, the claims are examined herein.
35 USC § 103-based Claim Rejections
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
§ 103. Conditions for patentability; non-obvious subject matter
A patent for a claimed invention may not be obtained, . . . . if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
4. Claims 1, 2, 4, 9, 16, 18, 19, 20, 21, 22, 23, 24, and 38 are rejected under 35 U.S.C. 103 as being unpatentable over
Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06
in view of Gleba et al. WO 2002/029068 A2
The factual inquiries set forth in Graham v. John Deere Co.of Kansas City, 383 U.S. 1, 17-18, 148 USPQ 459, 467 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:a. Determining the scope and contents of the prior art.b. Ascertaining the differences between the prior art and the claims at issue.c. Resolving the level of ordinary skill in the pertinent art.d. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 1 is interpreted supra, and that interpretation is incorporated by reference here.
Neither reference appear to fully teach the rather convoluted claim 1, but in combination, as seen below, they do.
Dorokhov et al. teaches AAAGAAGAGAGAAAACUGAAAAGGCAGAAAA as an IRES (internal ribosome entry site). P. 5305 (1st text). The first segment, AAAGAAGAGAGAAAA, is 15 purines at a ratio of 4 Gs to 11 As. The second segment, GAAAAGGCAGAAAA, is 14 purines at a ratio of 4 Gs to 11 As.
Figure 4’s legend also references AAAGAAGGAAAAAGAAGG (18, 12 As to 6 Gs) and references “multiple G(A)3 modules.” The authors abbreviate internal ribosome entry site as IRES.
In the WO publication by some of the authors, the publication teaches making non-natural IRES (p. 39) and at the top of page 40 teach an embodiment where the first poly-purine element is 38 nucleotides and the second is 42. By inspection, there are more As than Gs in each. Immediately below that sequence, they teach using it to express a heterologous polypeptide. At the top of page 42, Gleba et al. teaches using plant cells.
Since claim 1 uses open language – “comprises” the extended length does not distinguish the claim from the teachings.
Further, given the numerous embodiments taught above, using heterologous poly-purine segments to enhance expression is an obvious variant.
Thus it would have been prima facie obvious to one of ordinary skill in the art as of the effective filing date of the claimed invention to combine the known elements according to the language of the claims.
Given the level of skill in the art as of the effective filing date of the claimed invention one of ordinary skill in the art would have had a reasonable expectation of success.
Given the generic phrasing of claim 1 referencing poly-purine motifs with more As than Gs is obvious of a certain minimum length in order to enhance expression is obvious and thus claim 1 is obvious.
Since claim 38 encompasses minor sequence features, it is an obvious species in view of the above teachings and thus claim 38 is obvious.
Since Gleba et al. teaches viral genomes with one transcript encoding multiple ORFs (e.g., p. 5, 2nd para., claim 2 is obvious.
Given the teachings above, using multiple IRESs / R-motifs is obvious and thus claim 4 is obvious.
Given that the embodiment at the top of page 4 can be thought of as 4 R-motifs either poly-purine stretch is reasonably interpreted as 2 R-motifs separated by 0 nucleotides, and thus clam 9 is obvious.
Dorokhov et al. teaches the 35S promoter (1st pg. lwr. rt.), known as a plant promoter, and thus claim 16 is obvious. (See also p. 5302, lwr.rt.; “appropriate promoter.”) Since this last-cited section teaches plasmids, claims 18 and 19 are obvious. Dorokhov et al.’s abstract teaches plant protoplasts and thus claims 20 and 21 are obvious. On page 5302, Dorokhov et al. teaches tobacco protoplasts (see heading in upper left) and thus claims 22, 23 and 24 are obvious.
5. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over
Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06 in view of
Gleba et al. WO 2002/029068 A2 in further view of
Krieg et al., US Patent Publication 2015/0232836 A1
As seen above, claim 1 is obvious in view of the first two references.
The third reference, Krieg et al., teaches several thousand sequences. One of them, SEQ ID NO:2, is referenced as a PRC2-associated” DNA sequence (para. 0007)
Claim 6 recites various sequences. Below are the sequences of the SEQ ID NOs recited in claim 6 in approximate order.
gaaagagagagagag
gagagagagagagag
gagaaagaaagagag
aagagagaaagagag
gaagaagaagaagag
gaagaagaagaagaa
ggaagagaagaagaa
agaagagagagagag
ggaggagaagaagaa
aaaagaaagaaagaa
gaaaaagaaagaaaa
aagagagaagaagaa
gaaagaaaaaaaaaa
aaagaaaagagagaa
gagaaagaaagaaaa
ggaggaggaagagaa
agaagaaagaaagaa
gaaaaaaaaaaaaaa
aaaggaaaaagaaaa
aaaagaaaaaaaaaa
aaagaagaaaaaaaa
ggaaaagaagaaaaa
aaaaaaagaggagaa
gaaagaaggagaaaa
gggagaagagaagag
aaaaaggaagaagag
aaaaagaaaaaagaa
gaaggagaagaaaga
In the aggregate the listed sequences are obvious variations on the theme of poly-purines with at least as many As as Gs. Therefore, claim 6, which in aggregate claims variations on the theme, is obvious.
Further, according to the sequence listing, most, if not all, are from Arabidopsis. Additionally, at least SEQ ID NOs:114; 127; and 142 are found in Krieg et al.’s SEQ ID NO:2. (SEQ ID NO:127 actually appears twice in Krieg et al.’s SEQ ID NO:2.
6. Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over
Dorokhov et al. (2002) Proc Natl Acad Sci 99(8):5301-06
in view of Gleba et al. WO 2002/029068 A2 in further view of
Lomonossoff et al., U.S. Patent Publication No. 2009/0181460 A1.
As seen above, claim 1 is obvious over the first two references. Neither of those references explicitly teaches an inducible promoter.
Lomonossoff et al., which also teaches a translational enhancer, further teaches an inducible promoter (para. 0004) in connection with expression-enhancing invention. Thus claim 17 is obvious.
Conclusion
No claim is allowed.
7. The prior art made of record and not relied upon is considered pertinent to Applicant's patent application.
Dorokhov et al. S 20050015830 A1 covers some of the same material as the Dorokhov et al. publication cited above in the rejection under 35 USC 103.
Ivanov et al. (1997) Virol 232:32-43 teaches a poly-purine tract for enhancing translation. Fig. 6.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached on 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUSSELL T BOGGS/
Examiner, Art Unit 1663