DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 05/21/2025 has been entered.
Application Status
This action is written in response to applicant’s correspondence received 05/07/2025. Claims 1-28, 30, and 47-48 are cancelled. Claims 29, 31-46, and 49 are currently pending and examined herein.
Claim Objections
Claim 29 is objected to because of the following informalities: claim 29 contains periods throughout the claim (e.g., “a.”, “b.”, etc.). MPEP 608.01(m) states, “Each claim begins with a capital letter and ends with a period. Periods may not be used elsewhere in the claims except for abbreviations.”. Appropriate correction is required.
Claim Rejections - 35 USC § 103 - withdrawn
Rejection of claims 29 and 31-46 under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US20160153005A1; published June 2, 2016, as cited in the IDS filed December 31, 2019) and McIvor et al. (US20180185487A1; published July 5, 2018) is withdrawn in view of Applicant's arguments regarding McIvor's invention and the tube connected to the venous lumen for collecting and removing excess gene editing reagent from the organ.
Rejection of claims 49 under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US20160153005A1; published June 2, 2016, as cited in the IDS filed December 31, 2019) and McIvor et al. (US20180185487A1; published July 5, 2018) as applied to claims 29 and 31-46 above, and further in view of Chen et al. (CN109055434A; published December 21, 2018, with priority to July 5, 2018) is withdrawn in view of Applicant's arguments regarding McIvor's invention and the tube connected to the venous lumen for collecting and removing excess gene editing reagent from the organ.
Response to Arguments
Applicant’s arguments, see pages 1-7, filed 05/07/2025, with respect to the rejection(s) of claim(s) 29, 31-46, and 49 under 103 have been fully considered and are persuasive. Applicant argues that McIvor’s first, second and more catheters are not designed or intended to remove gene editing reagents, but rather are specifically designed to either: 1) deliver DNA or 2) occlude blood flow to promote efficacy of the hydrodynamic injection process. Applicant further argues that the blood samples collected before, during, and after infusions (in McIvor’s paragraphs 0011, 0013, 0054) was not to remove gene editing agents, but to assess the blood for evidence of gene expression of the transgene from hepatocytes and that it is also not clear where these samples collected from. While, McIvor describes a tube connected to the venous lumen, Applicant’s arguments that they differ from that of the instant invention are persuasive.
Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of Zhang (US20160153005A1; published June 2, 2016, as cited in the IDS filed December 31, 2019, in view of Fierens (US20150018597A1; published 01/15/2015).
Claim Rejections - 35 USC § 103 – new rejection
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 29 and 31-46 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US20160153005A1; published June 2, 2016, as cited in the IDS filed December 31, 2019, in view of Fierens (US20150018597A1; published 01/15/2015).
Zhang’s disclosure is directed to delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and/or activities of target sequences (see abstract)
Regarding claim 29, Zhang teaches delivery systems and tissues or organs which are targeted as sites for delivery of gene editing reagents to edit or modify a target site in a genomic locus of interest (see abstract). Zhang teaches connecting said organ to a perfusion system (see para 0626 and 1191). Zhang further teaches administering gene editing reagents to ex vivo liver cells (see paras 0009-0011, 0023, 0026-0029, 0047, and 0052, 0627; and claims 8, 28, and 29). Zhang teaches that the perfusion systems with intravenous delivery (see paras 0245-0247, 0314, 0378, 0408, 0459, 0857, and Example 38).
However, Zhang teaches a tube connected to the arterial lumen and a tube connected to the venous lumen of an organ, but does not specifically teach that the same perfusion system includes both a tube connected to an arterial lumen and a tube connected to a venous lumen of said organ.
Fierens’ disclosure is directed to an organ perfusion system and a kit for the delivery a therapeutic agent to an organ blood flow and the removal of excess therapeutic agent from said organ blood flow (see title and abstract).
Regarding claim 29, Fierens teaches perfusion systems for delivering therapeutic agents to organs and further teaches reducing unwanted effects on non-targeted organs in the body (see para 0003). Fierens teaches a kit for the delivery of a therapeutic agent to an organ blood flow and the removal of the excess therapeutic agent from said organ flow, wherein the kit comprises a first catheter connected to an arterial lumen and a second catheter for isolating organ outflow having a distal end and a proximal end comprising a catheter suitable for deploying a self-expanding hollow tubular member (see claim 1, paras 0008-0010 and 0025-0027). Fierens teaches that a preferred embodiment for liver treatment comprises a catheter connected to the hepatic arterial lumen (see paras 0070-0071). Fierens further teaches a separation device comprising at least one filter able to separate the therapeutic agent excess from the organ outflow, having an inlet for the organ outflow having a therapeutic agent excess and an outlet for filtered organ outflow blood, wherein the separation device is located in the second retrievable medical device, wherein said separation device comprises at least one filter which is positioned at the inner proximal end of the tubular member of the second retrievable medical device (see claims 1d, 13-15 and paras 0012, 0025-0027, 0165, and 0188-0189).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute Zhang’s delivery methods with Fierens’ perfusion system that includes a catheter connected to an arterial lumen and a catheter connected to a venous lumen of the organ because it would have amounted to a simple substitution of one known intravenous delivery method with another. As discussed above, Fierens teaches perfusion systems for delivering therapeutic agents to organs and further teaches reducing unwanted effects on non-targeted organs in the body by removing excess therapeutic agents via a second medical device connected to the venous lumen (see paras 0003, 0012, and 0025-0027). One of ordinary skill in the art could have tried of Fierens’ catheter perfusion system and would have had a reasonable expectation of success with predictable results because both Zhang’s and Fierens’ disclosures teach delivering therapeutic agents to organs using perfusion systems. Thus, the claimed invention as a whole is prima facie obvious.
Regarding claim 31, Zhang teaches that the organ is selected from a liver, pancreas, spleen, lungs, prostate, kidney or heart (see paras 0272-0284 and 0472-0473).
Regarding claim 32, Zhang teaches that the organ is selected from a host selected from a human, mouse, rat, dog, pig, sheep, non-human primates (chimpanzee, monkey) or cow (see paras 0352 and 0597; and Figures 72A-E and 75A-B).
Regarding claims 33-35, Zhang teaches that the gene editing reagent is the rare-cutting CRISPR Cas9 nuclease (see paras 0010-0012, 0050 and claim 14).
Regarding claim 36, Zhang teaches that the gene editing reagent is delivered in the form of a protein, nucleic acid or virus particle (see paras 0016-0017, 0019, 0029, 0045 and 0091; and Figures 28A-C).
Regarding claim 37, Zhang teaches that the gene editing reagent is encoded on an AAV vector (see paras 0051, 0091, and 0096-0107).
Regarding claim 38, Zhang teaches that the composition further comprises magnetic nanoparticles or lipid nanoparticles (see paras 0042, 0375, 0670, 0408, 0449, and 0908).
Regarding claim 39, Zhang teaches that the composition comprises the CRISPR nuclease and lipid nanoparticles (see paras 0042, 0375, 0908 and claim 3).
Regarding claim 40, Zhang teaches that the composition comprises the CRISPR nuclease and magnetic nanoparticles (see paras 0670 and 0908).
Regarding claim 41, Zhang teaches that the CRISPR nuclease is encoded as RNA and the composition comprises lipid nanoparticles (see paras 0144, 0375 and 0390; and Figures 28A-C).
Regarding claim 42, Zhang teaches administering an electrical pulse, sound energy or a magnetic field to the organ (see paras 0306, 0468, 0475, 0608, and 0670).
Regarding claim 43, Zhang teaches that the organ is a liver and the host is a pig (see paras 0005, 0472-0473, 0496, 0809, and 0352).
Regarding claims 44 and 45, Zhang teaches that the perfusion system include a peristaltic pump (see para 0626).
Regarding claim 46, Zhang teaches that the medical fluid is blood (see paras 0517-0518).
Claim 49 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US20160153005A1; published June 2, 2016, as cited in the IDS filed December 31, 2019, in view of Fierens (US20150018597A1; published 01/15/2015) as applied to claims 29 and 31-46 above, and further in view of Chen et al. (CN109055434A; published December 21, 2018, with priority to July 5, 2018).
The teachings of Zhang and Fierens are applied to claim 49 as they have been applied to claims 29 and 31-46 in the 35 U.S.C. 103 discussion above. Zhang teaches delivery systems and tissues or organs which are targeted as sites for delivery of gene editing reagents to edit or modify a target site in a genomic locus of interest (see abstract). Zhang further teaches targeting the KIT gene to treat diseases and disorders (see Table A; para 0675-0678).
However, Zhang does not teach that the CRISPR nuclease specifically targets SEQ ID NO: 2.
Chen’s disclosure is directed to method of correcting pig KIT gene structural mutation using CRISPR/Cas9 technology (see abstract).
Regarding claim 49, Chen teaches that CRISPR nuclease targets SEQ ID NO: 1 representing an area of the pig KIT gene, comprising 100% sequence identity to the sequence set for in Applicant’s SEQ ID NO: 2. (See alignment below. Qy is SEQ ID NO: 2 and DB is SEQ ID NO: 1.)
(Applicant SEQ ID NO: 2)
Qy 1 AGTGGAGGTGATTCTCATGG 20
||||||||||||||||||||
Db 1 AGTGGAGGTGATTCTCATGG 20
(Chen et al. SEQ ID NO: 1)
It further would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant application to arrive at the instant invention by further modifying the combined perfusion techniques of Zhang and Fierens to specifically target the genomic site having the sequence of SEQ ID NO: 2 because Zhang teaches targeting the KIT gene using CRISPR-Cas systems (see Table A; paras 0675-0678) and Chen provides a specific target within the KIT gene and demonstrates editing the site using CRISPR-Cas systems. The ordinary artisan would have had a reasonable expectation of success because both Zhang and Chen teach methods of delivering CRISPR/Cas9 to cells in organs of pigs for gene editing and all three prior art references teach delivering therapeutic agents to organs. Thus, the claimed invention as a whole is prima facie obvious.
Allowable Subject Matter
SEQ ID NO: 1 in claim 49 is a 20 bp region of the pig KIT gene. The closest prior Bancel et al. (US20140010861A1; published January 9, 2014), directed to modified polynucleotides for the production of proteins associated with human disease teaches SEQ ID NO: 238252 (with a length of 852 nucleotides; see OA Appendix for sequence alignment) with 87% sequence identity to the sequence of Applicant’s SEQ ID NO: 1. (See alignment below. Qy is SEQ ID NO: 1 and DB is SEQ ID NO: 238252.)
(Applicant SEQ ID NO: 1)
Qy 2 CCCTGAGGAGGTAGTTCAA 20
||||||||| |||||||||
Db 195 CCCTGAGGACGTAGTTCAA 213
(Bancel et al. SEQ ID NO: 1)
SEQ ID NO: 1 is free of the prior art in the context of CRISPR/Cas9 targeting SEQ ID NO: 1.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KHALEDA B HASAN whose telephone number is (571)272-0239. The examiner can normally be reached IFP, Monday - Friday 7:30am-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KHALEDA B HASAN/Examiner, Art Unit 1636 /BRIAN WHITEMAN/Primary Examiner, Art Unit 1636
Prosecution Insights