Prosecution Insights
Last updated: April 19, 2026
Application No. 16/605,740

OPTIMIZED LENTIVIRAL VECTOR FOR XLA GENE THERAPY

Non-Final OA §112
Filed
Oct 16, 2019
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children'S Hospital (Dba Seattle Children'S Research Institute)
OA Round
7 (Non-Final)
38%
Grant Probability
At Risk
7-8
OA Rounds
3y 11m
To Grant
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
280 granted / 734 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
65 currently pending
Career history
799
Total Applications
across all art units

Statute-Specific Performance

§101
1.9%
-38.1% vs TC avg
§103
37.9%
-2.1% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
27.8%
-12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 734 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 11/21/2025 has been entered. Amended claims 85-87, 89-90, 93, 97-103, 109 and 111-166 are pending in the present application. Applicant elected previously without traverse of the following species: (a) a BTK promoter; (b) SEQ ID NO: 2 for the first polynucleotide encoding an UCOE; (c) SEQ D NO: 6 for the third polynucleotide encoding BTK; (d) SEQ ID NO: 3 for a DNase hypersensitive site (DHS) of a human BTK gene; and (d) a hematopoietic stem cell. SEQ ID NO: 1 was rejoined and examined together with the elected SEQ ID NO: 2; and SEQ ID NO: 7 was also rejoined and examined together with the elected SEQ ID NO: 6. Claims 103 was withdrawn previously from further consideration because it is directed to a non-elected invention. Accordingly, amended claims 85-87, 89-90, 93, 97-102, 109 and 111-116 are examined on the merits herein. Claim Rejections - 35 USC § 112 (New Matter) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Amended claims 85-87, 89-90, 93, 97-102, 109 and 111-114 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new ground of rejection. Amended independent claims 85 and 109 recite the new limitation “wherein the UCOE consists of a fragment from a human CBX3 gene, wherein the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 to 1 k, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1”. The claims encompass an isolated nucleic acid comprising a transgene for sustained Bruton’s tyrosine kinase (BTK) expression, the nucleic acid comprising a first polynucleotide encoding a ubiquitous chromatin opening element (UCOE), wherein the UCO consists of a fragment from a human CBX3 gene, wherein the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 kb to 1 kb, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1. The specification does not have a written support for this new limitation. As an initial matter, amended claims 85-87, 89-90, 93, 97-102, 109 and 111-114 have been introduced in the Amendment dated 11/21/2025, so the claims themselves are not part of the original disclosure. 37 CFR § 1.115(a)(2). “New or amended claims which introduce elements or limitations that are not supported by the as-filed disclosure violate the written description requirement. . . . While there is no in haec verba requirement, newly added claims or claim limitations must be supported in the specification through express, implicit, or inherent disclosure. . . . The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed.” MPEP § 2163, part (I)(B); see also MPEP § 2163.02. In this case, the original specification does not convey the particular invention recited in amended claims 85-87, 89-90, 93, 97-102, 109 and 111-114 with reasonable clarity to skilled artisans. “The trouble is that there is no such disclosure, easy though it is to imagine it.” MPEP § 2163.05, part (II) (quoting In re Ruschig, 379 F.2d 990, 995, 154 USPQ 118, 123 (CCPA 1967)). In the Amendment filed on 11/21/2025 (page 5, first paragraph), Applicant stated that currently amended claims have an alleged written support in Figures 67 and 93A, along with SEQ ID NO: 1 and SEQ ID NO: 2. Figures 93A and 67 are reproduced below. PNG media_image1.png 149 378 media_image1.png Greyscale PNG media_image2.png 718 537 media_image2.png Greyscale As shown in both Figures 93A and 67, a UCOE that consists of a fragment from a human CBX3 gene of the present application, is comprised of a complete exon 1 of the human CBX3 gene, a complete alternative exon 1 of the human CBX3 gene, a full intronic region located between said exon 1 and said alternative exon 1 of the human CBX3 gene, and an intronic region that is 3’ of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 kb to 1 kb. Since each of the UCOE nucleotide sequence of SEQ ID NO: 1 (668-nucleotide sequence) or SEQ ID NO: 2 (668-nucleotide sequence that is in reverse orientation to SEQ ID NO: 1) has an end of the UCOE is 97 to 100 base pairs from a BSmB1 recognition site located in the alternative exon 1, a UCOE with a length longer than 0.668 kb and up to 1 kb (an extra 332 basepairs) and still possessing an end that is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1, such UCOE must possess an extra nucleotide region having a length of 1 and up to 332 basepairs that is 5’ of the exon 1 of the CBX3 gene as encompassed by the instant claims. This is an embodiment of currently amended claims that does not have a written support provided by any of Figures 67, 93A, and SEQ ID NOs. 1-2 of the present application. Accordingly, the as-filed specification does not have a written support for the above new limitation recited in currently amended claims. The fact that the person of ordinary skill in the art could have carried out the claimed invention without undue experimentation based on applicants’ disclosure is inadequate to meet this requirement. “The Federal Circuit has pointed out that, under United States law, a description that merely renders a claimed invention obvious may not sufficiently describe the invention for the purposes of the written description requirement of 35 U.S.C. 112.” MPEP § 2163, part (I)(A). Therefore, given the lack of sufficient guidance provided by the originally filed specification, it would appear that Applicants did not contemplate or have possession of invention as now claimed at the time the application was filed. Response to Arguments Applicant’s arguments related in part to the above modified 112(a) rejection for New Matter in the Amendment dated 11/21/2025 (pages 5-9) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below. Applicant argued basically that Figure 67 and 93A, along with SEQ ID NOs. 1-2 fully support for currently amended independent claims 85 and 109; and a skilled artisan would have understood the inventor to be in possession of the claimed invention at the time of filing. First, please refer to the above modified 112(a) rejection for detail, particularly for an embodiment of currently amended claims that does not have a written support provided by any of Figures 67, 93A, and SEQ ID NOs. 1-2 of the present application. Second, the fact that the person of ordinary skill in the art could have carried out the claimed invention without undue experimentation based on applicants’ disclosure is inadequate to meet this requirement. “The Federal Circuit has pointed out that, under United States law, a description that merely renders a claimed invention obvious may not sufficiently describe the invention for the purposes of the written description requirement of 35 U.S.C. 112.” MPEP § 2163, part (I)(A). Claim Rejections - 35 USC § 112 (Lack of Written Description) Amended claims 85-86, 89-90, 93, 97-102, 109 and 111-114 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new ground of rejection. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc). Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116. The instant claims encompass an isolated nucleic acid comprising a transgene for sustained Bruton’s tyrosine kinase (BTK) expression, the nucleic acid comprising: (i) a first polynucleotide encoding a ubiquitous chromatin opening element (UCOE), wherein the UCOE consists of any fragment from a human CBX3 gene, as long as the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 to 1 k, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1; (ii) a second polynucleotide encoding a BTK promoter, and (iii) a third polynucleotide encoding BTK, wherein (i), (ii), and (iii) are operably linked to one another in a 5’ to 3’ order; a vector, a genetically modified cell comprising the same nucleic acid and a pharmaceutical composition comprising a genetically modified cell, wherein the genetically modified cell is selected from a B cell, a myeloid cell, or a hematopoietic stem cell. It is noted that currently amended claims encompass the use of a UCOE consisting of a fragment from a human CBX3 gene that may or may not contain any intronic region located between the exon 1 and the alternative exon 1 of the human CBX3 gene. Apart from disclosing a nucleic acid construct for sustained BTK expression comprising the following elements that are operably linked in the 5’ to 3’ order: (i) a first polynucleotide encoding a UCOE with the shortest disclosed 0.7kb-UCOE element comprising the sequence of SEQ ID NO: 1 (668 bps) or SEQ ID NO: 2 (668 bps), (ii) a second polynucleotide encoding a promoter, and (iii) a third polynucleotide encoding BTK (see at least Summary of the Invention; particularly paragraphs [0105], [0232]; Figures 67 and 93A); the instant disclosure fails to provide sufficient written description for any other isolated nucleic acid for sustained BTK expression comprising a UCOE element consisting of any fragment from a human CBX3 gene as long as the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 kb to 1kb, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmB1 recognition site located in the alternative exon 1 as encompassed broadly by the instant claims. For example, apart from SEQ ID Nos. 1-2 containing a complete exon 1 of the human CBX3 gene, a complete alternative exon 1 of the human CBX3 gene, a full intronic region located between said exon 1 and said alternative exon 1 of the human CBX3 gene, and an intronic region that is 3’ of the alternative exon 1, and wherein each of their end is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1 (Figures 67 and 93A), which essential or critical elements that other UCOEs possesses, particularly those that may not contain a full intronic region or only a partial intronic region located between the exon 1 and the alternative exon 1 of the human CBX3 gene, and yet they still endow a sustained Brutton’s tyrosine kinase (BTK) expression for the claimed isolated nucleic acids as encompassed by the instant claims? Before the effective filing date of the present application (04/21/2017), Muller-Kuller et al already disclosed the minimal 0.7kb UCOE (CBX3-UCOE) which is a 674 bp, uni-directional CBX3 core promoter fragment comprising the two alternative first exons of the CBX3 gene and a CpG-rich intragenic region between the CBX3 and HNRPA2B1 promoters as depicted in Figure 1A below. PNG media_image3.png 243 288 media_image3.png Greyscale Moreover, Muller-Kuller et al noted the essential role of the CpG density within the intragenic region between the two alternative first exons of the CBX3 gene and a certain level of transcription for the CBX3-UCOE function in anti-silencing activity (page 1590, left column, second full paragraph). Since the prior art before the effective filing date of the present application (05/03/2017) did not provide sufficient guidance for the aforementioned issue as evidenced at least by the teachings of Zhang et al (Blood 110:1448-1457, 2007; IDS), Bandaranayake et al (Nucleic Acids Research 39: e143; doi:10.1093/nar/gkr706, 11 pages; 2011; IDS), Kern et al (Molecular Therapy, Volume 19, Supplement 1, Abstract 349, S136, 2013; IDS), Singh et al (Molecular Therapy, Volume 23, Supplement 1, Abstract 238, S93, 2015; IDS), Muller-Kuller et al (Nucleic Acids Research 43:1577-1592, 2015; IDS); it is incumbent upon the present specification to do so. The present application also fails to provide a representative number of species for a broad genus of an isolated nucleic acid comprising a transgene for sustained Bruton’s tyrosine kinase (BTK) expression with an encoded UCOE consisting of any fragment from a human CBX3 gene, as long as the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 to 1 k, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1; a vector and a genetically modified cell comprising the same nucleic acid as claimed broadly. The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision the complete detailed structure of a representative number of species for a broad genus of an isolated nucleic acid comprising a transgene for sustained Bruton’s tyrosine kinase (BTK) expression with an encoded UCOE consisting of any fragment from a human CBX3 gene, as long as the fragment comprises an exon 1 and an alternative exon 1 of the CBX3 gene, and a 3’ end of the alternative exon 1, and wherein the UCOE has a length in a range from 0.668 to 1 k, and wherein an end of the UCOE is 97 to 100 base pairs from a BsmBI recognition site located in the alternative exon 1; a vector and a genetically modified cell comprising the same nucleic acid as claimed broadly; and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). Examiner’s Comment The prior art does not teach nor fairly suggest a first polynucleotide encoding a UCOE comprising the nucleotide sequence of SEQ ID NO:01 or SEQ ID NO:02. With respect to the nucleotide sequence of SEQ ID NO:01 or SEQ ID NO:02 of the present application, the closest prior art is Trinklein et al (US 20070161031) disclosing high throughput methods for structural and functional characterization of gene expression regulatory elements (e.g., transcriptional promoters) in a human genome, including SEQ ID NO: 37854 (2,300 nucleotides) having the sequence of nucleotides 1614-2281 that is 99.5% identical to SEQ ID NO: 2 (668 nucleotides) with 2 mismatches at nucleotide residues #3 and #495 in SEQ ID NO: 2. SEQ ID NO: 37854 also comprises the sequence of nucleotides 2284-1617 that is 99.8% identical to SEQ ID NO: 1 (668 nucleotides) with 1 mismatch at nucleotide residue #177 in SEQ ID NO: 1 (Abstract; Summary of the Invention; particularly paragraphs [0008], [0013] and [0311]; and attached sequence searches below). However, there is no suggestion whatsoever in the prior art to target and substitute these specific nucleotide residues (residues #3 and #495 of SEQ ID NO: 2 of the present application; and residue #177 of SEQ ID NO:1 of the present application) in the 668-nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2. Conclusion Claims 115-116 are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Sequence 37854 (relative to SEQ ID NO: 2 of the present application), Publication No. US20070161031A1 Query Match 99.5%; Score 664.8; DB 27; Length 2300; Best Local Similarity 99.7%; Matches 666; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 1 CGCAAACACCCGAATCAACTTCTAGTCAAATTATTGTTCACGCCGCAATGACCCACCCCT 60 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1614 CGGAAACACCCGAATCAACTTCTAGTCAAATTATTGTTCACGCCGCAATGACCCACCCCT 1673 Qy 61 GGCCCGCGTCTGTGGAACTGACCCCTGGTGTACAGGAGAGTTCGCTGCTGAAAGTGGTCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1674 GGCCCGCGTCTGTGGAACTGACCCCTGGTGTACAGGAGAGTTCGCTGCTGAAAGTGGTCC 1733 Qy 121 CAAAGGGGTACTAGTTTTTAAGCTCCCAACTCCCCCTCCCCCAGCGTCTGGAGGATTCCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1734 CAAAGGGGTACTAGTTTTTAAGCTCCCAACTCCCCCTCCCCCAGCGTCTGGAGGATTCCA 1793 Qy 181 CACCCTCGCACCGCAGGGGCGAGGAAGTGGGCGGAGTCCGGTTTTGGCGCCAGCCGCTGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1794 CACCCTCGCACCGCAGGGGCGAGGAAGTGGGCGGAGTCCGGTTTTGGCGCCAGCCGCTGA 1853 Qy 241 GGCTGCCAAGCAGAAAAGCCACCGCTGAGGAGACTCCGGTCACTGTCCTCGCCCCGCCTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1854 GGCTGCCAAGCAGAAAAGCCACCGCTGAGGAGACTCCGGTCACTGTCCTCGCCCCGCCTC 1913 Qy 301 CCCCTTCCCTCCCCTTGGGGACCACCGGGCGCCACGCCGCGAACGGTAAGTGCCGCGGTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1914 CCCCTTCCCTCCCCTTGGGGACCACCGGGCGCCACGCCGCGAACGGTAAGTGCCGCGGTC 1973 Qy 361 GTCGGCGCCTCCGCCCTCCCCCTAGGGCCCCAATTCCCAGCGGGCGCGGCGCGCGGCCCC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1974 GTCGGCGCCTCCGCCCTCCCCCTAGGGCCCCAATTCCCAGCGGGCGCGGCGCGCGGCCCC 2033 Qy 421 TCCCCCCGCCGGGCGCGCGCCCGCTGCCCCGCCCTTCGTGGCCGCCCGGCGTGGGCGGTG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2034 TCCCCCCGCCGGGCGCGCGCCCGCTGCCCCGCCCTTCGTGGCCGCCCGGCGTGGGCGGTG 2093 Qy 481 CCACCCCTCCCCCCAGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGG 540 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 2094 CCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGG 2153 Qy 541 CTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2154 CTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGG 2213 Qy 601 AGGCGGTGAAGTCGGTGGCTTTCCTTCTCTCTAGCTCTCGCTCGCTGGTGGTGCTTCAGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2214 AGGCGGTGAAGTCGGTGGCTTTCCTTCTCTCTAGCTCTCGCTCGCTGGTGGTGCTTCAGA 2273 Qy 661 TGCCACAC 668 |||||||| Db 2274 TGCCACAC 2281 Sequence 37854 (relative to SEQ ID NO:1 of the present application), Publication No. US20070161031A1 Query Match 99.8%; Score 666.4; DB 27; Length 2300; Best Local Similarity 99.9%; Matches 667; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 CGCGTGTGGCATCTGAAGCACCACCAGCGAGCGAGAGCTAGAGAGAAGGAAAGCCACCGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2284 CGCGTGTGGCATCTGAAGCACCACCAGCGAGCGAGAGCTAGAGAGAAGGAAAGCCACCGA 2225 Qy 61 CTTCACCGCCTCCGAGCTGCTCCGGGTCGCGGGTCTGCAGCGTCTCCGGCCCTCCGCGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2224 CTTCACCGCCTCCGAGCTGCTCCGGGTCGCGGGTCTGCAGCGTCTCCGGCCCTCCGCGCC 2165 Qy 121 TACAGCTCAAGCCACATCCGAAGGGGGAGGGAGCCGGGAGCTGCGCGCGGGGCCGCTGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 2164 TACAGCTCAAGCCACATCCGAAGGGGGAGGGAGCCGGGAGCTGCGCGCGGGGCCGCCGGG 2105 Qy 181 GGGAGGGGTGGCACCGCCCACGCCGGGCGGCCACGAAGGGCGGGGCAGCGGGCGCGCGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2104 GGGAGGGGTGGCACCGCCCACGCCGGGCGGCCACGAAGGGCGGGGCAGCGGGCGCGCGCC 2045 Qy 241 CGGCGGGGGGAGGGGCCGCGCGCCGCGCCCGCTGGGAATTGGGGCCCTAGGGGGAGGGCG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2044 CGGCGGGGGGAGGGGCCGCGCGCCGCGCCCGCTGGGAATTGGGGCCCTAGGGGGAGGGCG 1985 Qy 301 GAGGCGCCGACGACCGCGGCACTTACCGTTCGCGGCGTGGCGCCCGGTGGTCCCCAAGGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1984 GAGGCGCCGACGACCGCGGCACTTACCGTTCGCGGCGTGGCGCCCGGTGGTCCCCAAGGG 1925 Qy 361 GAGGGAAGGGGGAGGCGGGGCGAGGACAGTGACCGGAGTCTCCTCAGCGGTGGCTTTTCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1924 GAGGGAAGGGGGAGGCGGGGCGAGGACAGTGACCGGAGTCTCCTCAGCGGTGGCTTTTCT 1865 Qy 421 GCTTGGCAGCCTCAGCGGCTGGCGCCAAAACCGGACTCCGCCCACTTCCTCGCCCCTGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1864 GCTTGGCAGCCTCAGCGGCTGGCGCCAAAACCGGACTCCGCCCACTTCCTCGCCCCTGCG 1805 Qy 481 GTGCGAGGGTGTGGAATCCTCCAGACGCTGGGGGAGGGGGAGTTGGGAGCTTAAAAACTA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1804 GTGCGAGGGTGTGGAATCCTCCAGACGCTGGGGGAGGGGGAGTTGGGAGCTTAAAAACTA 1745 Qy 541 GTACCCCTTTGGGACCACTTTCAGCAGCGAACTCTCCTGTACACCAGGGGTCAGTTCCAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1744 GTACCCCTTTGGGACCACTTTCAGCAGCGAACTCTCCTGTACACCAGGGGTCAGTTCCAC 1685 Qy 601 AGACGCGGGCCAGGGGTGGGTCATTGCGGCGTGAACAATAATTTGACTAGAAGTTGATTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1684 AGACGCGGGCCAGGGGTGGGTCATTGCGGCGTGAACAATAATTTGACTAGAAGTTGATTC 1625 Qy 661 GGGTGTTT 668 |||||||| Db 1624 GGGTGTTT 1617
Read full office action

Prosecution Timeline

Oct 16, 2019
Application Filed
May 06, 2021
Response after Non-Final Action
Apr 24, 2022
Non-Final Rejection — §112
Sep 26, 2022
Response Filed
Nov 21, 2022
Final Rejection — §112
May 23, 2023
Request for Continued Examination
May 30, 2023
Response after Non-Final Action
Sep 18, 2023
Non-Final Rejection — §112
Dec 20, 2023
Response Filed
Feb 26, 2024
Final Rejection — §112
Jun 27, 2024
Request for Continued Examination
Jul 10, 2024
Response after Non-Final Action
Jan 02, 2025
Non-Final Rejection — §112
Mar 26, 2025
Response Filed
May 29, 2025
Final Rejection — §112
Nov 21, 2025
Request for Continued Examination
Nov 24, 2025
Response after Non-Final Action
Dec 11, 2025
Applicant Interview (Telephonic)
Jan 12, 2026
Non-Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454689
INTEGRATION OF MESA RECEPTORS AND PROMOTORS TO IMPLEMENT CUSTOMIZED CELLULAR FUNCTION
2y 5m to grant Granted Oct 28, 2025
Patent 12454702
MINIGENE THERAPY
2y 5m to grant Granted Oct 28, 2025
Patent 12448426
CHIMERIC ANTIGEN RECEPTORS WITH MYD88 AND CD40 COSTIMULATORY DOMAINS
2y 5m to grant Granted Oct 21, 2025
Patent 12385048
CONSTRUCT AND SEQUENCE FOR ENHANCED GENE EXPRESSION
2y 5m to grant Granted Aug 12, 2025
Patent 12371474
RECOMBINANT ADENO-ASSOCIATED VIRAL VECTORS FOR TREATING BIETTI CRYSTALLINE DYSTROPHY
2y 5m to grant Granted Jul 29, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

7-8
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.7%)
3y 11m
Median Time to Grant
High
PTA Risk
Based on 734 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month