DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/16/2026 has been entered.
Claim Status
Claims 1, 7, 8, 11, 20, 24, 29, 31, 35, 47-51, 53, 55-56 and new claims 57-60 are pending and are under consideration. As noted in earlier actions the elected SEQ ID NOs: 112 and 113 will be considered; noting that unmodified, passenger/sense sequence for SEQ ID NO: 114 is the same as SEQ ID NO: 112 (5’ auauuaucuuggugu – 15 nt.); while the complementary unmodified, guide/antisense sequence of SEQ ID NO: 115 is the same as SEQ ID NO: 113 (5’ uauaauagaaccacagggaa – 20 nt.).
Priority
It is recognized the application claims the benefit of U.S. Provisional Applications 62/542043 filed on August 7, 2017 and 62/558183 filed on 9/13/2017. All the examined claims enjoy the benefit of ‘043 filing.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 03/16/2026 was filed before the mailing date of this Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Declarations Under 1.132
The Declaration of James Cardia dated 03/16/2026 is received and entered.
Claim Rejections - 35 USC § 103
Rejection of claims 1, 7, 8, 11, 20, 24, 29, 31, 35, 47-51, 53, 55-56 is maintained and new claims 57-60 are rejected, see below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 7, 20, 24, 29, 31, 35, 49-50, 55-56, 60 are rejected under 35 U.S.C. 103 as being unpatentable over Wolfson et al. (WO2015084897, pub. 06/11/2015, shares co-inventor/assignee but is outside the 102(b) grace period) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. (U.S. Patent No. 9175289, issued 11/03/2015, referred as Khvorova ‘289; in IDS).
The modified SEQ ID NOs: 112 and 113 are as follows:
PNG
media_image1.png
416
890
media_image1.png
Greyscale
Instant specification defines “host cell” is a cell and provides various embodiments of a host cell (pg. 73, line 30), thus under BRI encompasses any cell.
Regarding instant cl. 1, 7, 20, and 60 Wolfson discloses immunogenic composition comprising cells and oligonucleotide capable of suppressing expression of immune checkpoint gene (cl. 2, 6), with one of the genes involved in immune suppression is PDCD1/PD1 (cl. 8, see par. 110) and discloses a self-delivery RNAi (sdRNA, also referred to as sd-rxRNA) for inhibiting expression of PDCD1/PD1 (cl. 20, relevant to instant cl. 20). Of the 20 targeting sequences of PD1 disclosed on pg. 36, one of the targeting sequence disclosed is Oligo_ID: PDCD1_NM_005018_human_2057 with following sequence: TTCCCTGTGGTTCTATTATA (will be referred as Wolfson-2057), a 20 nt. sequence, which comprises a 15 nt. sequence of instant SEQ ID NO: 112 (see bolded, underlined sequence of Wolfson-2057). Fig. 1 of Wolfson discloses a schematic of a sdRNA (see below) and Fig. 5 demonstrates sdRNA-induced knock-down of PD1 in activated human primary T cells (par. 38). The sdRNA is described as “self-deliverable” RNAi agent, that is asymmetric double-stranded RNA, i.e. guide strand of about 19-25 nt. and a passenger strand of about 10-19 nt. with a single-stranded phosphorothioated tail of 5-9 nt. (par. 65) and do not require a delivery vehicle to enter cells (par. 71); from Fig. 1 below the sdRNA has an inorganic phosphate and a TEG-cholesterol-glyceryl and has various modifications, including with 2’-O-methyl (2OMe) and/or 2’-fluoro (2F) ribose modifications at various positions on the sdRNA.
PNG
media_image2.png
353
785
media_image2.png
Greyscale
As evidenced by Khvorova ‘289, sdRNA has a TEG-Chl at the 3’ end of the passenger/sense strand for aiding in cellular uptake of the molecule (Fig. 50) and a 5’ inorganic phosphate at the 5’ end of the guide strand and phosphorothioate (PS) modifications at the single-stranded 3’ end of antisense strand and 2 PS mod. at 5’ end of sense strand (see e.g. fig. 50, relevant to instant cl. 1, 60); Khvorova ‘289 highlights that the sd-rxRNA, is a “new class of RNAI molecules has superior efficacy both in vitro and in vivo than previously described RNAi molecules” (Col. 2, line 12-15). Khvorova discloses that modification with 2’F, 2’OMe, phosphorothioate linkage and cholesterol resulted in passive uptake transfection, i.e. without any transfection agent, and the highest level of activity (Description in Fig. 23).
Regarding the 20 nt. length antisense strand, a skilled artisan can design a standard 19-21 nt. complementary antisense strand of the targeting sequence, which is UAUAAUAGAACCACAgggaa, and would comprise the instant SEQ ID NO: 113 (if 21 nt.) or is the SEQ ID NO: 113 (if 20 nt.), or is not patentably distinct from instant SEQ ID NO: 113 (if 19 nt.) since the AS strand is targeting the same region (relevant to instant cl. 1, 60).
Wolfson does not disclose whether Wolfson-2057 actually inhibits PD1 expression, nor discloses the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113.
Zhang ‘277 discloses using an expression vector to express siRNA targeting PDCD1 with SEQ ID No: 693 (claim 8, and pg. 144, par. 393), labeled sequence number 1 in Table 15: CCCUGUGGUUCUAUUAUAU (pg. 25). (Claim 8 in the publication erroneously refers to SEQ ID NO:693 as of PDL1 siRNA). Zhang ‘277 discloses Fig. 52 and 53, demonstrating the ability of “SEQ 1” to decrease the expression levels of PD1 mRNA and protein levels. The PDCD1 siRNA sense strand sequence comprises instant SEQ ID NO: 112 (relevant to instant cl. 1, 60) and targets the same region as Wolfson-2057. Further, Zhang ‘277 discloses use of excipient to administer a therapeutic agent in humans or mammals (paragraphs 211-212, pg. 8, relevant to instant cl. 7).
Neither Wolfson nor Zhang ‘277 disclose the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113.
Khvorova ‘289 figures illustrate the balancing of 2OMe and 2F and PS modifications of the dsNA molecule to understand their effect of delivery and potency into the cell (Fig. 22-53, see Fig. 5, Tables 2/3 testing numerous 2OMe, 2F modifications). In addition to delivery into the cell, the ribose sugar modifications comprising 2’OMe and 2’F provide stability and improve efficacy (Col 69, line 4-5) and phosphorothioate internucleotide modification affect loading on to the RISC machinery and stabilization (Col. 14, lines 18-21). Further, Khvorova ‘289 also discloses that 2F modifications may be associated with toxicity in vivo and thus suggests reducing 2F content of a sdRNA (Col. 18, line 12-13). Thus, all the aforementioned modifications ultimately affect potency of the dsNA molecule as noted in Fig. 34 and Fig. 50 (both figures provided below). The second generation sdRNA also has a 6-PS at the 3’ end of the antisense strand (the single stranded region, see sd-rxRNAnano GII) (relevant to instant cl. 1, 60). Instant dsRNA SEQ ID NOs: 112/113 has increased 2OMe (57%) content than 2F content.
PNG
media_image3.png
281
692
media_image3.png
Greyscale
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have designed a sdRNA targeting Wolfson-2057 sequence of PD1 transcript in view of Zhang ‘277 and arrive at the claimed invention with a reasonable expectation of success. Realizing the success of Zhang’s SEQ ID NO: 693 to inhibit PD1’s mRNA and protein expression, a skilled artisan would expect reasonable success by targeting the PD1 transcript as Wolfson-2057 targeting sequence, which is the same targeting region of SEQ ID NO: 693 of Zhang.
Additionally, the KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to design a sdRNA of Wolfson in view of Khvorova ‘289 and arrive at the claimed invention with a reasonable expectation of success. First, Khvorova ‘289 recognizes the issue of toxicity based on a 2F content in a sdRNA. Khvorova ‘289, altering a finite number of the 2OMe and 2F modifications at various positions on a dsRNA molecule, identified an efficient sdRNA that is fully modified. Thus, a skilled artisan would reasonably expect success by altering 2OMe and 2F modifications at select positions of sdRNA of Wolfson as taught by Khvorova ‘289 to improve the overall stability of a sdRNA targeting PD1, specifically targeting noted Wolfson-2057 sequence of PD1. Thus, claims 1, 7, 20 are obvious.
Regarding instant cl. 29, Wolfson cl. 19 discloses a method of transforming at least one cell with one or more dsRNA agent, and Fig. 5 of Wolfson demonstrates sdRNA-induced knock-down of PD1 in activated human primary T cells (par. 38).
Regarding instant cl. 24, 31, cl. 21 of Wolfson discloses a transformed cell as a T-cell.
Regarding instant cl. 35, Wolfson discloses a method of treating a cell proliferative disorder or infectious disease by administering to a subject in need thereof, an immunogenic composition comprising cells that have been treated with one or more oligonucleotide to modulate the expression of one or more target gene involved in tumor immune resistance mechanisms, including PD1 (par. 27) and one proliferative disorder includes breast cancer (par. 45).
Regarding instant cl. 49 and 50, Wolfson cl. 10 discloses a transformed cell as NK-cell.
Regarding instant cl. 55, 56, Wolfson discloses immunogenic composition comprising T-cells that may be genetically engineered to express high affinity T-cell receptors (TCR).
Claims 51, 53 are rejected under 35 U.S.C. 103 as being unpatentable over Wolfson et al. (WO2015084897, pub. 06/11/2015, shares co-inventor/assignee but is outside the 102(b) grace period) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. U.S. Patent No. 9175289 (referred as Khvorova ‘289; in IDS) and as applied to claims 1, 7, 20, 24, 29, 31, 35, 49-50, 52, 54-56 above, and as evidenced by AllCells® Product Sheet for T-cells and Leukopaks (allcells.com/isolated-cell-products/t-cells/; allcells.com/research-grade-tissue-products/leukopak/; accessed 09/08/2025).
Disclosure of rejection of claims 1, 7, 20, 24, 29, 31, 35, 49-50, 55-56 is noted above.
Regarding instant cl. 51, 53, Wolfson discloses sdRNA efficiently reduced surface expression of PD1 in activated human primary T-cells that were obtained from AllCells® (par. 38, 106). AllCells® T-cell product sheet notes that human primary T-cells are derived from leukopaks, which are collected from healthy and consenting donors (AllCells® T-cells [allcells.com/isolated-cell-products/t-cells/] and Leukopaks product sheets [allcells.com/research-grade-tissue-products/leukopak/], accessed 09/08/2025). Thus, claims 51, 53 are obvious.
Claims 8, 11, 57 are rejected under 35 U.S.C. 103 as being unpatentable over Wolfson et al. (WO2015084897, pub. 06/11/2015) and Zhang (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. (U.S. Patent No. 9175289, referred as Khvorova ‘289; in IDS) as applied to claims 1, 7, 20, 24, 29, 31, 35, 49-50, 55-56, 60 above, and further in view of Chang et al. (2009, Mol. Ther., 17, 725-732, referred as Chang).
Disclosure of rejection of cl. 1, 7, 20, 24, 29, 31, 35, 49-50, 55-56, 60 is noted above. Briefly, Wolfson-2057 sequence is the following targeting sequence TTCCCTGTGGTTCTATTATA, a 20 nt. sequence of PD1 transcript.
Wolfson, Zhang, and Khvorova do not disclose an asymmetric siRNA targeting PD1 transcript comprising a sense strand of 15 nt..
Chang discloses that a canonical 19+2 siRNA structure (19-base pair duplex region with 2 nt. overhang at 3’ end) have demonstrated nonspecific effects (pg. 725). Chang demonstrates that asymmetric shorter-duplex siRNA (AsiRNAs) backbone structures, i.e. with the sense strands ranging from 19 nt. to 13 nt., are capable of inhibiting the target gene at the similar levels (Fig. 1), however, the AsiRNAs demonstrated reduced sense-strand mediated off-target silencing (Fig. 3) and reduced ability to saturate RNAi machinery (pg. 728, 729). A siRNA comprising 15 nt. in length sense strand when co-transfected with another 19+2 siRNA targeting a different transcript does not disrupt RNAi machinery function (pg. 730, Fig. 4a).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the teaching of sdRNA of Wolfson in view of Chang and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the sdRNA targeting PD1 of Wolfson to an asymmetric siRNA comprising 15 nt. in length sense strand of Chang, since as Chang disclosed an asymmetric siRNA with a 15 nt. sense strand with efficient inhibition and reduced off-target effects. Since Wolfson-2057 is a 20 nt. sequence (TTCCCTGTGGTTCTATTATA) and based on the teaching of Chang, a skilled artisan would design a few finite number of 15 nt. length sense strand (6 different sense strands of 15 nt., if shifting by one nt.) to identify an optimal complementary sense strand to the antisense strand. Chang’s AsiRNAs addresses the recognized problem of off-target effects of a canonical 19+2 siRNA. Here there’s a finite number of identified, predictable potential sense strands (6 potential 15 nt. length sense strand). A skilled artisan, based on the results of Wolfson and Zhang ‘277 SEQ ID NO: 693 would target a region of the transcript that is known to result in inhibition, i.e. Wolfson-2057 target sequence confirmed by Zhang ‘277, and would reasonably expect success since targeting said region would result in inhibition and, further, Wolfson discloses sdRNAs, also asymmetric siRNAs, targeting PD1 with almost 60-75% level of inhibition at 2 uM (see Fig. 5). Thus, claims 8, 11 are obvious.
Regarding instant cl. 57, Wolfson discloses a method of treating a subject suffering from a proliferative disorder by administering to a therapeutic modulator of the invention (cl. 25) and cl. 26 discloses proliferative disease is cancer.
Claims 47, 48, 58, and 59 are rejected under 35 U.S.C. 103 as being unpatentable over Wolfson et al. (WO2015084897, pub. 06/11/2015, shares co-inventor/assignee but is outside the 102(b) grace period) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. U.S. Patent No. 9175289 (referred as Khvorova ‘289; in IDS)) as applied to claims 1, 7, 20, 24, 29, 31, 35, 49-50, 55-56, 60 and further in view of Chang et al. (2009, Mol. Ther., 17, 725-732, referred as Chang) as evidenced by
Wolfson discloses a self-delivery RNAi (sdRNA, also referred as sd-rxRNA) for inhibition expression of PDCD1/PD1 (par. 38). Wolfson discloses 20 targeting sequences of PDCD1/PD1 transcript on pg. 36, one of the targeting sequence of a sdRNA targeting PD1 is referred as Oligo_ID: PDCD1_NM_005018_human_2057 with the following sequence: TTCCCTGTGGTTCTATTATA (will be referred as Wolfson-2057), a 20 nt. sequence, which comprises a 15 nt. sequence of instant SEQ ID NO: 112 (see bolded, underlined sequence of Wolfson-2057). Fig. 1 of Wolfson discloses a sdRNA (see below) and Fig. 5 demonstrates sdRNA-induced knock-down of PD1 in activated human primary T cells (par. 38). The sdRNA is described as “self-deliverable” RNAi agent, that is asymmetric double-stranded RNA, i.e. guide strand of about 19-25 nt. and a passenger strand of about 10-19 nt. with a single-stranded phosphorothioated tail of 5-9 nt. (par. 65) and do not require a delivery vehicle to enter cells (par. 71); from Fig. 1 below the sdRNA has an inorganic phosphate and a TEG-cholesterol-glyceryl and is modified with 2’-O-methyl (2OMe) and 2’-fluoro (2F) ribose modifications at various positions.
PNG
media_image2.png
353
785
media_image2.png
Greyscale
As evidenced by Khvorova ‘289, sdRNA have TEG-Chl at the 3’ end of the passenger/sense strand for aiding in cellular uptake of the molecule (Fig. 50) and the 5’ inorganic phosphate at the end of 5’ of the guide strand and at least 6 phosphorothioate (PS) modification at the 3’ end of antisense strand and 2 PS mod. at 5’ end of sense strand (see e.g. fig. 50); Khvorova ‘289 highlights that the sd-rxRNA, is a “new class of RNAI molecules has superior efficacy both in vitro and in vivo than previously described RNAi molecules” (Col. 2, line 12-15). Khvorova discloses that modification with 2’F, 2’OMe, phosphorothioate linkage and cholesterol resulted in passive uptake transfection, i.e. without any transfection agent, and the highest level of inhibition (Description in Fig. 23).
Regarding the 20 nt. length antisense strand, a skilled artisan can design a standard 19-21 nt. complementary antisense strand of the targeting sequence, which is UAUAAUAGAACCACAgggaa, and would comprise the instant SEQ ID NO: 113 (if 21 nt.) or is the SEQ ID NO: 113 (if 20 nt.), or is not patentably distinct from instant SEQ ID NO: 113 (if 19 nt.) since the AS strand is targeting the same region.
Wolfson does not disclose whether targeting Wolfson-2057 region actually inhibits PD1 expression, nor discloses the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113, nor discloses an asymmetric siRNA targeting PD1 comprising a 15 nt. sense strand.
Zhang ‘277 discloses using an expression vector to express siRNA targeting PDCD1 with SEQ ID No: 693 (claim 8, and pg. 144, par. 393), labeled sequence number 1 in Table 15: CCCUGUGGUUCUAUUAUAU (pg. 25). (Claim 8 in the publication erroneously refers to SEQ ID NO:693 as of PDL1 siRNA). Zhang ‘277 discloses Fig. 52 and 53, demonstrating the ability of “SEQ 1” to decrease the expression levels of PD1 mRNA and protein levels. The PDCD1 siRNA sense strand sequence comprises instant SEQ ID NO: 112 and targets the same region as Wolfson-2057.
Neither Wolfson nor Zhang ‘277 disclose the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113, nor disclose an asymmetric siRNA targeting PD1 comprising a 15 nt. sense strand.
Khvorova ‘289 in their figures illustrate the balancing of 2OMe and 2F and PS modifications of the dsNA molecule to understand their effect of delivery into the cell. Ribose sugar modifications with 2’OMe and 2’F, which provide stability and efficacy (Col 69, line 4-5), and phosphorothioate internucleotide modification affect loading on to the RISC machinery and stabilization (Figs. 5-6). Further, Khvorova ‘289 also discloses that 2F modifications may be associated with toxicity in vivo and thus suggests reducing 2F content of a sdRNA (Col. 18, line 12-13). Thus, all the aforementioned modifications ultimately affect potency of the dsNA molecule as noted in Fig. 34 and Fig. 50, which illustrate the distinction between the 1st generation and 2nd generation, respectively, of self-delivery asymmetric RNA (see Fig. 34, left, and Fig. 50, right, which illustrates the 1st Generation on top and 2nd generation on bottom). The second generation sdRNA also has a 6-PS at the 3’ end of the antisense strand (the single stranded region, see sd-rxRNAnano GII). Instant dsRNA SEQ ID NO: 112/113 has increased 2OMe (57%) content than 2F content.
Wolfson, Zhang, Khvorova do not disclose an asymmetric siRNA targeting PD1 comprising a 15 nt. sense strand.
Chang discloses that a canonical 19+2 siRNA structure (19-base pair duplex region with 2 nt. overhang at 3’ end) have demonstrated nonspecific effects (pg. 725). Chang demonstrates that asymmetric shorter-duplex siRNA (AsiRNAs) backbone structures, i.e. with the sense strands ranging from 19 nt. to 13 nt., are capable of inhibiting the target gene at the similar levels (Fig. 1), however, the AsiRNAs demonstrated reduced sense-strand mediated off-target silencing (Fig. 3)and reduced ability to saturate RNAi machinery (pg. 728, 729), especially the 15 length sense strand when co-transfected with another 19+2 siRNA targeting a different transcript still resulted in strongest inhibition demonstrating that it does not affect RNAi machinery compared to a longer siRNA (pg. 730, Fig. 4a).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have designed a sdRNA targeting Wolfson-2057 sequence of PD1 transcript in view of Zhang ‘277 and arrive at the claimed invention with a reasonable expectation of success. Realizing the success of Zhang’s SEQ ID NO: 693 to inhibit PD1’s mRNA and protein expression, a skilled artisan would expect reasonable success by targeting the PD1 transcript as Wolfson-2057 targeting sequence, which is the same targeting region of SEQ ID NO: 693 of Zhang.
Additionally, the KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to design a sdRNA of Wolfson in view of Khvorova ‘289 and arrive at the claimed invention with a reasonable expectation of success. First, Khvorova ‘289 recognizes the issue of toxicity based on a 2F content in a sdRNA. Khvorova ‘289, altering a finite number of the 2OMe and 2F modifications at various positions on a dsRNA molecule, identified an efficient sdRNA. Thus, a skilled artisan would reasonably expect success by altering 2OMe and 2F modifications at select positions of sdRNA of Wolfson as taught by Khvorova ‘289 to improve the overall stability of a sdRNA targeting PD1, specifically targeting noted Wolfson-2057 sequence of PD1.
Further, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify a sdRNA targeting PD1 of Wolfson in view of Chang and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the sdRNA targeting PD1 of Wolfson to an asymmetric siRNA comprising 15 nt. in length sense strand of Chang, since Chang disclosed an asymmetric siRNA with a 15 nt. sense strand with efficient inhibition and reduced off-target effects. Since Wolfson-2057 is a 20 nt. sequence (TTCCCTGTGGTTCTATTATA) and based on the teaching of Chang, a skilled artisan would design a few finite number of 15 nt. length sense strand (6 different sense strands of 15 nt., if shifting by one nt.) to identify an optimal complementary sense strand to the antisense strand. The AsiRNA addresses the recognized problem of off-target effects of a canonical 19+2 siRNA. Here there’s a finite number of identified, predictable potential sense strands (6 potential 15 nt. length sense strand). A skilled artisan, based on the results of Wolfson and Zhang ‘277 would target a region of the transcript that is known to result in inhibition, i.e. Wolfson-2057 target sequence confirmed by Zhang ‘277, and would reasonably expect success since targeting said region would result in inhibition and, further, Wolfson discloses sdRNAs, also asymmetric siRNAs, targeting PD1 with almost 60-75% level of inhibition at 2 uM (see Fig. 5). Thus, claims 47, 48 are obvious.
Regarding instant cl. 58, Wolfson discloses a method of treating a subject suffering from a proliferative disorder by administering to therapeutic modulator that suppresses expression of target genes of the invention (cl. 1, 25) and cl. 26 discloses proliferative disease is cancer (see par. 86). One modulator is sdRNA targeting PD1 as noted above.
Regarding instant cl. 59, Wolfson discloses that sdRNA may be administered in dermal layer via intradermal injection (par. 71).
Response to Arguments
Applicant's arguments filed 03/16/2026 (hereinafter referred to as the Remarks) have been fully considered but they are not persuasive.
The Remarks argue the following:
The Remarks note that Wolfson discloses 20 different “targeting sequences” but does not provide guidance as to which targeting sequence to select or which specific region to target, nor dsRNA targeting the “targeting sequences”(pg. 9).
The Remarks add that Wolfson, Zhang, nor ‘289 patent teach the specific chemical modification patterns and indicates that the 2F content of instant claimed products, which have 2F content ranging from 35% (SEQ ID NO: 113) to 55% (SEQ ID NO: 115), is in contrast to the teaching of ‘289 patent noting that 2F generates toxicity (pg. 9).
The Remarks argue that the obvious to try rationale does not apply since “there is an enormous number of possible combinations of nucleotide sequences and modifications” to try (pg. 10). Wolfson discloses multiple different “targeting regions” and then vast number of dsRNA types could be tried, the length of each strand ranging from 10-25 nt., and then vast number of chemical modification patterns (pg. 10).
The Remarks add that predictability of PD1 mRNA reduction of noted in Maxwell’s Declaration (~80%) based on Zhang’s data of (~66% reduction) amounts to “improper hindsight reasoning” (pg. 10).
Then Remarks contend that the Cardia Declaration indicating that SEQ ID NO: 112/113 (“PH-762”) was selected as a lead compound in a clinical development in a Phase 1b clinical trial of various cancer types and patients responded well to the compound. Further Cardia Declaration indicates that “PH-762 is a promising candidate in a field where there has been little success by others to date” (pg. 11). Also, the claimed compound PH-762 was recently named Immunomodulatory Solution of the Year in the BioTech Breakthrough Award Program (pg. 11).
The argument is not persuasive.
Addressing 1, 3) that Wolfson-2057 is one of 20 different “targeting sequences” and there is not sufficient guidance to select the specific region. Wolfson provides sufficient rationale/guidance to select Wolfson-2057 “targeting sequence.” Ten of the 20 “gene_region” of the PDCD1 mRNA also mentioned on pg. 36 comprise “the targeting sequence” (see highlighted sequences below), thus indicating that 50% of the targeting regions comprise the “targeting sequence” thus pointing out that it would be an reasonable region to select for targeting by a skilled artisan.
PNG
media_image4.png
425
832
media_image4.png
Greyscale
Further as noted in the Response to Argument in prior Action of 09/16/2025: “Wolfson in Fig. 5 . . . discloses sdRNA targeting PD1 also achieves similar inhibition levels at 2 µM concentration. Thus, providing an impetus to use a sdRNA structure of Wolfson, as evidenced by Khvorova.” (pg. 17).
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Zhang ‘277 demonstrates that SEQ ID NO: 693 results in ~66% inhibition and SEQ ID NO: 693 comprises the “targeting sequence” of Wolfson and instant SEQ ID NO: 112. Thus providing another reason that the transcript region of PDCD1 mRNA comprising SEQ ID NO: 693 or Wolfson-2057 is accessible for inhibition. Thus, based on the evidence of Zhang ‘277 and Wolfson, there is a finite number of sequence to try.
Addressing 2,3) that obvious to try rationale cannot apply when there are enormous number of chemical modification pattern possible. Focusing on SEQ ID NO: 112/113, the alternating modification pattern of the sense strand SEQ ID NO: 112 is well known in the art (see prior Action of 01/08/2025, citing Podbevsek, noting that alternating 2OMe/2F pattern in a siRNA product demonstrates 500-fold increase in vitro potency, pg. 9). Regarding the modification pattern of SEQ ID NO: 113, Khvorova ‘289 indicates that 2OMe, 2F and PS modification pattern is a balancing act and based on the suggestion that 2F may have in vivo toxic properties, a skilled artisan would attempt to reduce the 2F content, and not that its potency will be reduced. Thus, for overall siRNA compound, there is aim to select a siRNA with less 2F content (~43%, and the antisense SEQ ID NO: 113 has 35% 2F content) when used in vivo. The purpose of each 2’-ribose and internucleotide linkage modification is known in the art and a skilled artisan can modify the placement of each modification across the antisense strand to optimize the potency while reducing potential toxicity, as noted by Khvorova ‘289.
It should be pointed out that although the siRNA duplex (PD26, compound 27762) comprising antisense strand SEQ ID NO: 113 and the siRNA duplex (PD27, compound 27763) comprising antisense strand SEQ ID NO: 115 have different modification pattern (2F content ranging from 35% (SEQ ID NO: 113) to 55% (SEQ ID NO: 115)), they have similar inhibitory activity, indicating that despite different modification pattern, the potency is similar, see Fig. 1 and also chart of Exhibit C of Maxwell’s Declaration (provided below).
PNG
media_image5.png
267
404
media_image5.png
Greyscale
Thus, although the PD26 and PD27 have similar potency, it was PD26 (“PH-762”) that was selected as a lead compound for the clinical trial, possibly based on the fact, as noted above, that it has decreased 2F content. Further suggesting it is not critical that the exact pattern is taught in the prior art but rather the overall content of 2OMe and 2F in the duplex and that a range of chemical modification pattern differences are not patentably distinct in their result. Thus, there is a finite number of 2’-ribose modifications that would need to be tried, i.e. solely 2OMe and 2F modifications.
Addressing 3) the selection of asymmetric siRNA from the potential number of siRNA lengths, first, the independent claims do not require limitation in the length of the strands, since it recites “comprises”, and it appears only some dependent claim, e.g., cl. 8, 47, have the closed language of “consists.” Thus, length limitation of the strand and the requirement of a sdRNA would not apply for independent claims. Second, regarding the closed language and specifically the sdRNA of noted length, Wolfson and Khvorova ‘289 indicate an asymmetric siRNA is preferable. Chang provides a strong suggestion to use a 15 nt. sense strand along with a 19+2 (2 is length of overhang) antisense strand since it resulted in strongest inhibition without affecting RNAi machinery and reduced nonspecific effects. Further, as noted in prior Action (09/16/2025, pg. 17) that Wolfson discloses using several “sdRNAs” targeting PD1 (aka PDCD1) that achieved similar outcome as instant PD26 at 2 uM concentration. Thus, the prior art of record provides sufficient rationale in selecting the 15 nt. length of sense and 19-21 nt. length of antisense strands, and there is no patentable distinction between the length of 19 or 21 antisense strand from the claimed antisense strand of 20 nt. Thus, there is a finite number of length of sense strand/antisense strands that would need to be tried.
Addressing 4) in response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Here, it is known that a fully modified siRNA is more stable and more potent than an unmodified siRNA of Zhang produced using a vector system. Both, the results of Khvorova ‘289 and Chang disclose that an asymmetric siRNA would also improve potency while reducing the off-target effects. Chang points out that asymmetric siRNA also prevents saturation of the cellular RNAi machinery, one of the side-effects of vector produced siRNA. Thus, illustrated by the prior art of the record, the 14% difference in potency can be understood by a skilled artisan based on the differences of the systems (asymmetric, fully modified siRNA v. vector produced, unmodified siRNA).
Addressing 5) Cardia’s Declaration, first, the results are not commensurate with the independent claims, Cardia’s Declaration demonstrates results of SEQ ID NO: 112/113, while the claims have additional SEQ ID NOs. SEQ ID NO: 115 modification pattern is distinct from SEQ ID NO: 113. Second, considering solely SEQ ID NO: 112/113, Cardia’s Declaration does not provide a comparable data for secondary consideration, such as, of unexpected results. Third, a similar argument can be made for SEQ ID NO: 112/113 product’s award, the Declaration and Remarks do not provide what other drugs it was compared to or the basis for its selection. Further an award appears to be an opinion evidence that is directed to the ultimate legal conclusion at issue and is not entitled to any consideration or given weight (see MPEP 716.01(c)III). Although the underlying basis, i.e. the facts, are entitled to be given weight, here, the Declaration/Remarks do not provide sufficient facts. Third, a need for a drug to treat cancer has existed for quite some time and will continue to exist. It may be posited that Zhang’s cited product or any of the sdRNAs targeting PD1 disclosed in Fig. 5 of Wolfson also seems promising and may qualify under long felt need consideration.
Thus the rejection is maintained.
Double Patenting
The double patenting rejection of examined claims is maintained and new claims are rejected as noted below.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1, 7, 20, 24, 29, 31, 35, 49, 50, 55, 56, 58-60 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 8, 11, 12, 15, 17 of U.S. Patent No. 10934550 (issued 3/2/2021; referred as ‘550, in IDS) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. (U.S. Patent No. 9175289, issued 11/03/2015, referred as Khvorova ‘289; in IDS).
Patent ‘550 and the instant application share a common inventor/applicant Alexey Eliseev and the assignee is the same, Phio Pharmaceuticals. The instant application is not a divisional application of Patent application ‘550.
Claim 1 of ‘550 discloses an “immune modulator” sdRNA with guide strand “about 19-25 nucleotides long” and passenger strand “about 10-19 nucleotides long” and the sdRNA includes a double stranded (ds) region and a single stranded (ss) region, and the ss region includes 5-9 phosphorothioate modifications and the sdRNA is chemically modified, including at least one 2’-O-methyl modification or 2’-fluoro modification, and the sdRNA targets a sequence selected from SEQ ID NOs: 281-300 and sdRNA capable of suppressing expression of PD1 (relevant to instant cl. 1, 60). Claim 2 of Patent ‘550 teaches an immunogenic composition (relevant to instant cl. 20) comprising an sdRNA, which comprises a guide strand of 19-25 nt. and a passenger strand of 10-19 nt., with the sdRNA comprising a double stranded region and a single stranded region, wherein the single stranded region includes 5-9 phosphorothioate modifications and the sdRNA is modified with at least one 2OMe and 2F, with the sdRNA targeting a sequence selected from SEQ ID NOs: 281-300 suppressing expression of PD1, and immunogenic composition further comprises immune cells modified by the sdRNA to suppress expression of PD1, correspond to instant cl. 1, 20. Claim 13 of Pat. ‘550 teach the sdRNA comprises at least one cholesterol molecule.
Out the 20 target sequences taught, SEQ ID NOs 286, 291, 295, 296, and 299 (a quarter of recited SEQ ID NOs) comprise the instant SEQ ID NO: 112 (tgtggttctattata) (T=U). Further, the SEQ ID NOs: 281-300 is a Markush group and each sequence is expected to be a list of alternatively useable member, relevant to instant cl. 1, 20.
As evidenced by Khvorova ‘289, sdRNA have TEG-Chl at the 3’ end of the passenger/sense strand for aiding in cellular uptake of the molecule (Fig. 50) and a 5’ inorganic phosphate at the 5’ end of the guide strand and phosphorothioate (PS) modifications at the single-stranded 3’ end of antisense strand and 2 PS mod. at 5’ end of sense strand (see e.g. fig. 50, relevant to instant cl. 1); Khvorova ‘289 highlights that the sd-rxRNA, is a “new class of RNAI molecules has superior efficacy both in vitro and in vivo than previously described RNAi molecules” (Col. 2, line 12-15). Khvorova discloses that modification with 2’F, 2’OMe, phosphorothioate linkage and cholesterol resulted in passive uptake transfection, i.e. without any transfection agent, and the highest level of activity (Description in Fig. 23).
Regarding the 20 nt. length antisense strand, a skilled artisan can design a standard 19-25 nt. complementary antisense strand of the targeting sequence, which is UAUAAUAGAACCACAgggaa, and would comprise the instant SEQ ID NO: 113 (if 21-25 nt.) or is the SEQ ID NO: 113 (if 20 nt.), or is not patentably distinct from instant SEQ ID NO: 113 (if 19 nt.) since the AS strand would be targeting the same region.
‘550 does not disclose whether the targeting sequence comprising tgtggttctattata region actually inhibits PD1 expression, nor discloses the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113.
Zhang ‘277 discloses using an expression vector to express siRNA targeting PDCD1 with SEQ ID No: 693 (claim 8, and pg. 144, par. 393), labeled sequence number 1 in Table 15: CCCUGUGGUUCUAUUAUAU (T=U, pg. 25). (Claim 8 in the publication erroneously refers to SEQ ID NO:693 as of PDL1 siRNA). Zhang ‘277 discloses Fig. 52 and 53, demonstrating the ability of “SEQ 1” to decrease the expression levels of PD1 mRNA and protein levels. The PDCD1 siRNA sense strand sequence comprises instant SEQ ID NO: 112 (relevant to instant cl. 1) and targets the same tgtggttctattata region of PD1 transcript as ‘550. Further, Zhang ‘277 discloses use of excipient to administer a therapeutic agent in humans or mammals (paragraphs 211-212, pg. 8, relevant to instant cl. 7).
Neither ‘550 nor Zhang ‘277 disclose the 2OMe and 2F modification pattern of instant SEQ ID NO: 112/113.
Khvorova ‘289 in their figures illustrate the balancing of 2OMe and 2F and PS modifications of the dsNA molecule to understand their effect of delivery into the cell. Ribose sugar modifications with 2’OMe and 2’F, which provide stability and efficacy (Col 69, line 4-5), and phosphorothioate internucleotide modification affect loading on to the RISC machinery and stabilization (Figs. 5-6). Further, Khvorova ‘289 also discloses that 2F modifications may be associated with toxicity in vivo and thus suggests reducing 2F content of a sdRNA (Col. 18, line 12-13). Thus, all the aforementioned modifications ultimately affect potency of the dsNA molecule as noted in Fig. 34 and Fig. 50, which illustrate the distinction between the 1st generation and 2nd generation, respectively, of self-delivery asymmetric RNA (see Fig. 34, left, and Fig. 50, right, which illustrates the 1st Generation on top and 2nd generation on bottom). The second generation sdRNA also has a 6-PS at the 3’ end of the antisense strand (the single stranded region, see sd-rxRNAnano GII).
PNG
media_image3.png
281
692
media_image3.png
Greyscale
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have designed a sdRNA targeting ‘550 tgtggttctattata region of PD1 transcript in view of Zhang ‘277 and arrive at the claimed invention with a reasonable expectation of success. Realizing the success of Zhang’s SEQ ID NO: 693 to inhibit PD1’s mRNA and protein expression, a skilled artisan would expect reasonable success by targeting the tgtggttctattata region of PD1 transcript.
Additionally, the KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to design a sdRNA of Wolfson in view of Khvorova ‘289 and arrive at the claimed invention with a reasonable expectation of success. First, Khvorova ‘289 recognizes the issue of toxicity based on a 2F content in a sdRNA. Khvorova ‘289, altering a finite number of the 2OMe and 2F modifications at various positions on a dsRNA molecule, identified an efficient sdRNA. Thus, a skilled artisan would reasonably expect success by altering 2OMe and 2F modifications at select positions of sdRNA of Wolfson as taught by Khvorova ‘289 to improve the overall stability of a sdRNA targeting PD1, specifically targeting noted Wolfson-2057 sequence of PD1. Thus, claims 1, 7, 20 are obvious.
Claim 15 of Pat. ‘550 teaching method of producing of immunogenic composition of claim 2 by transforming an immune cell with an sdRNA, corresponds to instant cl. 29.
Claims 8 and 17 of Pat. ‘550, teaching cells, include T-cells or NK-cells, correspond to instant cl. 24, 31, 49, 50.
Claim 9, 18 of ‘550 teaches cells are T-cells comprising one or more transgene expressing high affinity T-cell receptors (TCR) and/or chimeric antibody-T-cell receptors (CAR), relevant to instant cl. 55, 56.
Regarding instant cl. 35, there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims. Instant application is not a divisional application and therefore method of instant cl. 35 is not patentably distinct from ‘550.
Regarding instant cl. 58, 59, the claims are directed to method of treatment of administration of sdRNA (cl. 1) or the immunogenic composition (cl. 2) of ‘550, thus are obvious.
Claims 51, 53 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 8, 11, 12, 15, 17 of U.S. Patent No. 10934550 (issued 3/2/2021; referred as ‘550, in IDS) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. (U.S. Patent No. 9175289, issued 11/03/2015, referred as Khvorova ‘289; in IDS) and further in view of Wolfson et al. (WO2015084897, pub. 06/11/2015)
Rejection of claims 1, 7, 20 is noted above.
‘550, Zhang, and Khvorova ‘289 do not disclose deriving cells from a healthy donor or from subject having proliferative disease.
Regarding instant claims 51, 53, Wolfson discloses sdRNA efficiently reduced surface expression of PD1 in activated human primary T-cells that were obtained from AllCells® (par. 38, 106), which are healthy donors, as noted above.
Claims 8, 11, 47, 48, and 57 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 8, 11, 12, 15, 17 of U.S. Patent No. 10934550 (issued 3/2/2021; referred as ‘550, in IDS) and Zhang et al. (U.S. Pub# US20180223277, pub date 8/9/2018, priority date 5/5/2015; referred as Zhang ‘277, of record) and Khvorova et al. (U.S. Patent No. 9175289, issued 11/03/2015, referred as Khvorova ‘289; in IDS) and further in view of Chang et al. (2009, Mol. Ther., 17, 725-732, referred as Chang).
Rejection of claims 1, 7, 20 is noted above.
‘550, Zhang, and Khvorova do not disclose a sdRNA, an asymmetric siRNA, comprising 15 nt. sense strand.
Chang discloses that a canonical 19+2 siRNA structure (19-base pair duplex region with 2 nt. overhang at 3’ end) have demonstrated nonspecific effects (pg. 725). Chang demonstrates that asymmetric shorter-duplex siRNA (AsiRNAs) backbone structures, i.e. with the sense strands ranging from 19 nt. to 13 nt., are capable of inhibiting the target gene at the similar levels (Fig. 1), however, the AsiRNAs demonstrated reduced sense-strand mediated off-target silencing (Fig. 3) and reduced ability to saturate RNAi machinery (pg. 728, 729). A siRNA comprising 15 nt. in length sense strand when co-transfected with another 19+2 siRNA targeting a different transcript does not disrupt RNAi machinery function (pg. 730, Fig. 4a).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the teaching of sdRNA of ‘550 in view of Chang and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the sdRNA targeting PD1 of ‘550 to an asymmetric siRNA comprising 15 nt. in length sense strand of Chang, since as Chang disclosed an asymmetric siRNA with a 15 nt. sense strand with efficient inhibition and reduced off-target effects. Since ‘550 SEQ ID NO: 299 is a 20 nt. sequence (TTCCCTGTGGTTCTATTATA) and based on the teaching of Chang, a skilled artisan would design a few finite number of 15 nt. length sense strand (6 different sense strands of 15 nt., if shifting by one nt.) to identify an optimal complementary sense strand to the antisense strand. Chang’s AsiRNAs addresses the recognized problem of off-target effects of a canonical 19+2 siRNA. Here there’s a finite number of identified, predictable potential sense strands (6 potential 15 nt. length sense strand). A skilled artisan, based on the results of Zhang ‘277 SEQ ID NO: 693 would target a region of the transcript that is known to result in inhibition, i.e. ‘550 target sequence confirmed by Zhang ‘277, and would reasonably expect success since targeting said region would result in inhibition. Thus, claims 8, 11, 47, 48 are obvious.
Regarding instant cl. 57, the claims are directed to method of treatment of administration of sdRNA (cl. 1) of ‘550, thus is obvious.
Response to Arguments
Applicant's arguments filed 03/16/2026 (hereinafter referred as the Remarks) have been fully considered but they are not persuasive.
The Remarks argue that instant subject matter is not obvious based on ‘550 patent since it does not teach the SEQ ID NOs: 112/113 nor the TEG-Chl-glyceryl at the 3’ end of the passenger end, nor the 5’ inorganic phosphate (pg. 14).
For rejections of the claims, the Remarks raise similar arguments as noted in Remarks 1), 2), and 3) above suggesting obvious to try is improperly applied due to the “enormous number of possible combinations of nucleotide sequences and modifications” that would need to be tried (pg. 14-15).
The argument is not persuasive.
As noted above in the rejection and in Response to Arguments to the 103 above and in prior action:
First, the SEQ ID NOs of ‘550 and Zhang teach a specific consensus targeting sequence to target: tgtggttctattata of PD1. Further, the SEQ ID NOs of ‘550 are a Markush group thus are understood to be equivalent in their activity and thus will have similar inhibitory effects. Further, a patent is presumed to be enabled thus each species of the Markush would be successful in inhibiting it target transcript. Thus, each taught SEQ ID NO species of Patent ‘550 will fulfill its function.
Second, by ‘550 claiming sdRNA, and its Fig. 1 discloses a general guidance for a structure of a sdRNA, i.e. comprising TEG-Chl-Glyceryl and 5’-inorganic phosphate and based on Khvorova ‘289, one would conjugate them at the appropriate sites on the sdRNA.
Regarding the chemical modification pattern, Khvorova ‘289 discloses the importance of 2OMe and 2F modification, which are known to provide stability, improved binding affinity to target sequence, nuclease resistance, and aid in cellular delivery, but also cautions of toxicity of increased 2F modifications. Thus, a skilled artisan would try to fully modify a sdRNA to identify the optimal stable sdRNA that is fully modified that does not interfere with RNAi activity.
Further reasoning is noted above in Response to Arguments for 103 rejection.
Thus the argument is not persuasive and the rejection is maintained.
Allowable Subject Matter
No claims are allowed.
References Not Relied Upon
The following references are noted but have not been relied upon herein:
Zhang et al. CN201510224944.1
Zhang et a. WO2016177343
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600