DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
2. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on September 18, 2025 has been entered.
3. Claims 1, 2, 7, 8, 15, 16, 21, 22, 62, 63, 71, 72, 77 and 78 are pending.
Claims 62, 63, 71, 72, 77 and 78, drawn to non-elected inventions and non-elected species are withdrawn from examination.
Claims 1 and 15 have been amended.
Claims 1, 2, 7, 8, 15, 16, 21 and 22 with species (agent): RNA interfering inhibitor and a BAF complex inhibitor are examined on the merits.
New and Maintained Grounds of Rejection
4. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
5. Claim 16 recites the limitation "the cancer" in steps (9) and (11). There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 103
6. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
8. The rejection of claim(s) 1, 2, 7, 8, 15, 16, 21 and 22 under 35 U.S.C. 103 as being unpatentable over Li et al., (Oncotarget 8(26): 41975-41987, published online March 30, 2017), and further in view of WO 00/56931 document (published 28 September 2000), Wong et al. (Cancer Research 60: 6171-6177, November 1, 2000) and Ring et al., US 2016/0039903 A1 (effectively filed April 21, 2015) is maintained.
Foremost, Applicant states “the Examiner is of the opinion that “[t]he combination of all the references teach the claimed invention.”, see Remarks submitted September 18, 2025, page 10, 2nd paragraph (para.).
Applicant follows this postulation with arguments previously submitted, see Remarks submitted September 18, 2025, para. spanning page 10 and 11; and page 11, 1st full para.; and Remarks submitted May 16, 2025.
In summary, Applicant asserts both secondary references by Wong teach away for the pending claims, reading on the facts BRG1 is a tumor suppressor gene and contains mutations, see WO document, at least page 1; and page 6, lines 11-32; and Remarks submitted September 18, 2025, paragraph bridging pages 10 and 11.
Applicant continues to argue their claimed invention reads on a particular shRNA agent, a 21-mer target sequence and the “…[Wong WO document] does not provide the ordinarily skilled artisan with any guidance regarding which of the 839 possible 21-mer sequences of the SEQ ID NO: 58 sequence [within the WO document] may serve as a target for BAF complex protein inhibition, …Absent impermissible hindsight reconstruction and undue experimentation, the ordinarily skilled artisan does not have an a priori reasonable expectation that the selection of the particularly recited target sequence recited in the pending claims would be useful for shRNA-mediated BAF complex protein inhibition.”, see page 12 of the Remarks.
Applicant’s arguments and points of view have been carefully considered, but fail to persuade.
The instant prior art rejection is not based on conjecture, nor opinion. The Examiner’s obviousness conclusion is based on sufficiently articulated reasoning that overcomes any concerns about hindsight bias. See KSR, 550 U.S. at 418. This modification of the primary reference in light of the secondary references is proper because the applied references are so related that the appearance of features shown in one would suggest the application of those features to the other. See In re Rosen, 673 F.2d 388, 213 USPQ 347 (CCPA 1982); In re Carter, 673 F.2d 1378, 213 USPQ 625
(CCPA 1982), and In re Glavas, 230 F.2d 447, 109 USPQ 50 (CCPA 1956). Further, it is noted that case law has held that a designer skilled in the art is charged with knowledge of the related art; therefore, the combination of old elements, herein, would have been well within the level of ordinary skill. See In re Antle, 444 F.2d 1168,170 USPQ 285 (CCPA 1971) and In re Nalbandian, 661 F.2d 1214, 211 USPQ 782 (CCPA 1981).
Like the FLI1 gene taught in Li, it is art known the BRG1 tumor suppressor gene is also associated with the FET-ETS protein, EWS-FLI1. As taught in Li the shRNA was able to knockdown FLI1, thereby promoting apoptosis, cell proliferation inhibition, inhibition of tumor colony formation, as well as in vivo tumorigenicity, see entire Li document, particularly page 41981, Figures 4C and 4D and top of the page, left column. The WO Wong reference teaches there are screen methods available to detect target sequences, see pages 33-40; and Wong, Cancer Research article.
One of ordinary skill in the art has been provided the general guidance and motivation to arrive at a shRNA able to target a specific sequence in light of the prior art references. It is and has been art known to identify, as well as validate target sequences, as well as identify highly potent shRNAs to gain insight for targeted suppression of gene expression and effective RNA interference, see Fellmann et al. (Molecular Cell 41: 736-746, published online February 24, 2011) and Kamatuka et al. (EURASIP Journal on Bioinformatics and Systems Biology 2016(7): 9 pages, published online 19 February 2016).
The Supreme Court has clarified that an "obvious to try" line of reasoning may properly support an obviousness rejection. In In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977), the CCPA held that a particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation, because "obvious to try" is not a valid rationale for an obviousness finding. However, in KSR International Co. v. Teleflex Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421, 82 USPQ2d at 1397 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.”, see MPEP 2144.05, II., B. For the reasons of record and herein the rejection is maintained.
Li teaches treating a nude mouse tumorigenicity model bearing small cell lung cancer (SCLC) with short hairpin RNA (shRNA) (shFLI1 1#), see page 41977, FLI1 knockdown…section; and page 41981, 1st column and Figure 4 (D). “[T]wo retroviral expression vector[s] of short hairpin RNA (shRNA) against FLI1 were constructed and transfected into HEK-293 cells to produce virus that can transfer shRNA. The shFLI1 1# sequence was
5′-CGTCATGTTCTGGTTTGAGAT-3′…”, the target sequence set forth in Applicants’ claims 1 and 15, see page 41984, 1st column, Construction…segment, 3rd paragraph. The “…shRNA promoted apoptosis and led to inhibition of cell proliferation, tumor colony formation an in vivo tumorigenicity.”, see abstract on page 41975; page 41977, FLI1 knockdown…section; page 41981, 1st column; and Figures 4(B), 4(C) and 4(D).
Henceforth, the taught shRNA agent binds the nucleic acid encoding the FET-ETS fusion protein to reduce FET-ETS fusion protein at the said target sequence thereby inhibiting binding of the FET-ETS fusion protein to a BAF complex, as well as able to facilitate the functions set forth in claims 2 and 16.
Li does not teach the methods, wherein the target sequence is SEQ ID NO: 69 and immunotherapy was further administered to the subjects with the taught shRNA agent.
However, the WO document teaches the genomic DNA BRG1 sequence, sequence #58 on page 34 of the Drawings; page 4, lines 29-31; and page 37, last row. Within the taught sequence is target sequence, 5’-GGCATAGGCCTTAGCAGTAAC-3’, see sequence alignment. BRG1 is mutated in human cancers and art known to be a subunit of the BAF complex and a component of the SWI-SNF complex, see page 4, Summary…paragraph (para.); claim 2, part (6); and Wong document.
Ring teaches treating cancers including leukemias, Ewing’s sarcoma and primitive neuroectodermal tumor (PNET) with combination therapy, see sections 0013, 0063, 0064, 0067, 0070, 0072 and 0073. The combinatorial therapy includes “[a]dministration…of high affinity PD-1 mimic polypeptide to a patient prevents interaction between PD-1 and PD-L1” and additional immune checkpoint inhibitors, chemotherapeutic agents, radiation, surgery and angiogenesis inhibitors, see page 2, section 0013; sections 0082-0085 spanning pages 9 and 10; and page 36, section 0313. Delivery of the therapeutic agents can be administered by several means. Administration of the therapeutic agents can be concomitant, see section 0083 on page 9. “Concomitant administration” of a cancer therapeutic drug, therapeutic drug to treat an infection, or tumor-directed antibody, with a pharmaceutical composition of the present disclosure means administration with the high affinity PD-1 mimic polypeptide at such time that both the drug/antibody and the composition of the present disclosure will have a therapeutic effect. Such concomitant administration may involve concurrent (i.e. at the same time), prior, or subsequent administration of the drug/antibody with respect to the administration of a compound of the disclosure.”, see page 9, section 0083.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to target the BRG1 sequence, 5′-CGTCATGTTCTGGTTTGAGAT-3’ with a targeted shRNA as executed in Li. A targeted shBRG1 could be manufactured as set forth in Li to determine whether it could knockdown BRG1 sequences and gain information on the effect(s). And subsequently, treat the cancers with a combinatorial approach, administering the shRNA targeted agent with an immunotherapy regimen.
One of ordinary skill in the art would have been motivated to do so with a reasonable expectation of success by the teachings in Li, the WO document and Wong, see all in their entireties. The WO document teaches mimetics can be screened for targeting properties, see page 6, lines 5-8; page 29, lines 24-26; and pages 33 and 34. BRG1 would serve as an attractive target for therapeutic intervention for multiple cancers given it is believed to play an important role in growth control, modulated transcriptional activity of oncogenes and regulation of cellular proliferation, see Wong reference, page 6171, Title, Abstract and Introduction.
And in addition, Ring teaches immune checkpoint inhibition in combination with another cancer therapy provides enhanced anti-tumor activity, see Summary spanning pages 1-4; sections 0084-0089, 0093 and 0094 spanning pages 9 and 10; and page 36, Discussion.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to treat the cancers with a combinatorial approach administering the shRNA agent with an immunotherapy regimen. One of ordinary skill in the art would have been motivated to do so with a reasonable expectation of success by the teachings in Ring “…combination therapy can be synergistic in enhancing elimination of cancer cells as compared to the administration of either agent as a single entity”, see page 2, section 0013 of Ring, as well all references in their entirety.
RESULT 10 from 69.rag database.
AAC58902
ID AAC58902 standard; DNA; 859 BP.
XX
DT 25-JAN-2001 (first entry)
XX
DE Human tumour suppressor BRG1 gene exon 58.
XX
KW Human; BRG1; tumour suppressor gene; cancer; chromosome 19p13.1;
KW retinoblastoma tumour suppressor gene; RB; drug screening; gene therapy;
KW drug design; peptide therapy; animal model; ss.
XX
OS Homo sapiens.
XX
CC PN WO200056931-A1.
XX
CC PD 28-SEP-2000.
XX
CC PF 23-MAR-2000; 2000WO-US007678.
XX
PR 23-MAR-1999; 99US-0125806P.
XX
CC PA (MYRI-) MYRIAD GENETICS INC.
XX
CC PI Wong AKC, Tavtigian SV, Teng DH;
XX
CC PT Diagnosing a polymorphism associated with predisposition for cancer in
CC PT humans by determining whether there is a germline alteration of a BRG1
CC PT gene or its expression products.
XX
CC PS Claim 18; Page 111; 215pp; English.
XX
CC The present invention is concerned with the use of the human tumour
CC suppressor gene BRG1 in cancer diagnosis and therapy. This gene is
CC comprised of several exons, shown in AAC58874-C58903, and has several
CC splice variants, given in AAC58906-C58912. The protein sequences for
CC these are shown in AAB27552-B27558. BRG1 is a homologue of the Drosophila
CC protein brahma, and has been shown to be bound to retinoblastoma tumour
CC suppressor protein RB. The BRG1 coding sequence and protein can be used
CC in the diagnosis and treatment of cancer (for example by gene therapy),
CC particularly prostate cancer, to identify drugs useful in the treatment
CC of cancer and in the production of animal models for cancer
XX
SQ Sequence 859 BP; 190 A; 230 C; 228 G; 211 T; 0 U; 0 Other;
Query Match 100.0%; Score 21; Length 859;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGCATAGGCCTTAGCAGTAAC 21
|||||||||||||||||||||
Db 385 GGCATAGGCCTTAGCAGTAAC 405
Conclusion
15. Any inquiry concerning this communication or earlier communications from the Examiner should be directed to ALANA HARRIS DENT whose telephone number is (571)272-0831. The Examiner works a flexible schedule, however she can generally be reached on 8AM-8PM, Monday through Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner’s supervisor, Julie Wu can be reached on 571-272-5205. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
ALANA HARRIS DENT
Primary Examiner
Art Unit 1643
26 November 2025
/Alana Harris Dent/Primary Examiner, Art Unit 1643