Prosecution Insights
Last updated: October 04, 2026
Application No. 16/648,768

NON-INTEGRATING DNA VECTORS FOR THE GENETIC MODIFICATION OF CELLS

Non-Final OA §103§DP
Filed
Mar 19, 2020
Priority
Sep 19, 2017 — EU 17191829.5 +1 more
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Deutsches Krebsforschungszentrum
OA Round
5 (Non-Final)
71%
Grant Probability
Favorable
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
48 granted / 68 resolved
+10.6% vs TC avg
Strong +42% interview lift
Without
With
+42.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
43 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
7.5%
-32.5% vs TC avg
§103
36.2%
-3.8% vs TC avg
§102
11.0%
-29.0% vs TC avg
§112
31.0%
-9.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 68 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 20th March 2026 has been entered. Priority The priority date for this application is the date of the provisional application: 09/19/2017. Election/Restrictions Claims 15-16 and 19 were previously withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected groups, there being no allowable generic or linking claim. Election was made with traverse in the reply filed on 11/30/2023. Status of the Claims This action is in response to papers filed 20th March 2026 in which new claims 26-29 were added. Claims 1, 3-5, 7-11, and 20-29 are under prosecution. Amendments & Response to Arguments Applicant has not amended previously presented claims. Applicant’s arguments, see Pgs. 6-9, filed 20th March 2026, with respect to: rejections of claims 1, 3-5, 7-11, and 20-25 under 35 USC § 103 have been fully considered but are not persuasive for the reasons discussed in this office action. The 35 USC § 103 rejections are maintained. NSDP rejections have been fully considered but are not persuasive for the reasons discussed in this office action. The NSDP rejections are maintained. Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed. Claim Interpretation The abbreviation S/MAR used in claims 1, 3, and 4 are being interpreted as per Pg. 2 of the instant specification; i.e., S/MAR can be Scaffold/matrix attachment regions, which are also known as scaffold-attachment regions (SARs) or matrix-associated regions (MARs). Further, Bode teaches that SAR and MAR share a characteristic structural property (abstract, Bode et al., J. Mol. Biol., 358 (2006), pp. 597-613). Thus, the claim has been given the broadest reasonable interpretation consistent with the teachings of the specification (In re Hyatt, 211 F.3d1367, 1372, 54 USPQ2d 1664, 1667 (Fed. Cir. 2000) (see MPEP 2111). New Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 3, 7, 10-11 and 25-29 are rejected under 35 U.S.C. 103 as being unpatentable over Delcuve (US005888774A) in view of Shaul (Shaul,O. International Journal of Biochemistry and Cell Biology, Vol. 91 (2017), pp:145-155) and claim 1 is evidenced by Mercer (Genome Research, 2015, 25:290–303). Regarding claim 1, Delcuve teaches a polynucleotide comprising at least one promoter and at least one S/MAR element (abstract: A recombinant DNA molecule adapted for transfection of a host cell comprising a nucleic acid molecule encoding mammalian erythropoietin (EPO), an expression control sequence operatively linked thereto and at least one SAR element). Suitable expression control sequences include: include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, splice signals, polyadenylation signals, including a translation initiation signal (col. 9, 2nd para), wherein said S/MAR element is located upstream/downstream of said promoter and a transgene (col 8, lines 40-44). Delcuve teaches in col 9, lines 59-60, the SAR elements: PNG media_image1.png 200 400 media_image1.png Greyscale Delcuve teaches the SAR elements are found in non-coding regions: in flanking regions or introns (col. 2, lines 58-60). Delcuve teaches a S/MAR which is a well-described 665 bp region from the 3' human apoB region or the same region with a 60bp deletion, represented in their invention as SEQ ID NO: 36. The rejection below shows ATTA sequence motifs bolded; incidence of ATTA in the sequence is 32/665, which is at least 4/100. Thus, Delcuve’s SEQ ID NO: 36 comprises at least 3 sequence motifs ATTA (SEQ ID NO:1) per 100 nucleotides over a stretch of at most 200 nucleotides. Delcuve teach their expression vector is capable of expressing recombinant EPO in vitro at levels of at least 1,500 u/106 cells in 24 hours (abstract). Thus, Delcuve’s recombinant DNA molecule is an expression vector comprising at least one SAR element located downstream of a promoter and transgene and comprised within a non-coding region, reads on instant polynucleotide comprising at least one promoter and at least one S/MAR element and Delcuve’s transgene i.e., nucleic acid encoding mammalian erythropoietin reads on instant polynucleotide further comprising a cargo sequence. Delcuve does not teach wherein said S/MAR element is flanked by a splice donor and a splice acceptor. Shaul teaches, several advantages of including introns in expression constructs: Introns can increase the efficiency of mRNA translation by increasing mRNA content by affecting transcription, export, and stability, in mammals, plants, yeast, and Xenopus (pg. 149, §7). Shaul teaches, if introns are located more than 50–55 nt downstream of termination codons (TCs) they can lower mRNA stability through the nonsense-mediated mRNA decay (NMD) pathway (pg. 149, §6). Shaul teaches this phenomenon is well-known and termed ‘intron-mediated enhancement’ (abstract). Shaul teaches, introns, which are spliced in the nucleus, affect translation of the mRNP complex that reaches the cytosol (pg. 149, §7). Mercer evidences Introns are removed from the nascent RNA and the remaining exonic sequence joined together into a mature RNA transcript (1st sentence), wherein the splicing occurs after recognition of at least three genetic elements within each intron: the 5’splice site, the 3’ splice site and the branchpoint (excise the intron lariat, Fig. 1, 1st and 2nd para). Thus, the recitation of wherein a transcript is transcribed from said promoter, from which transcript the sequence of the S/MAR element is spliced out, is evidenced by Mercer. Regarding claim 3, Delcuve teaches the expression vector encodes erythropoietin as a cargo (title). Regarding claim 7, Delcuve teaches the expression vector comprises bacterial ori of replication (E.coli ori in Fig. 7). Delcuve teaches the use of flanking SAR elements in the nucleic acid molecules may allow the SAR elements to form an independent loop or chromatin domain, which is insulated from the effects of neighboring chromatin. As seen in Fig. 7, the ori is outside the region of the SAR element. The SAR element was introduced into the HpaI site (col 18, 2nd para). Regarding claims 10 and 25, Delcuve contemplate using the expression vector in gene therapy (The recombinant DNA molecule of the invention may be used in gene therapy, (col 13, last para). This implies that the expression vector being discussed is a pharmaceutical composition. Regarding claim 11, Delcuve teaches cells transfected with the polynucleotide (abstract). Regarding claims 26-29, shown below is Delcuve’s SEQ ID NO: 36 represented by Db, Aligned with SEQ ID NO: 7 represented by Qy: SEQ ID NO 36 LENGTH: 665 TYPE: DNA ORGANISM: Homo sapiens Query Match 73.0%; Score 602.2; Length 665; Best Local Similarity 98.7%; Matches 607; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 140 TACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGATCAAT 199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 665 TACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGATCAAT 606 Qy 200 AACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGAATTATA 259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 605 AACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGAATTATA 546 Qy 260 AAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTAATTATA 319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 545 AAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTAATTATA 486 Qy 320 AAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGTAATTATAAACA 379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 485 AAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGTAATTATAAACA 426 Qy 380 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 425 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 366 Qy 440 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 365 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 306 Qy 500 TTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATA 559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 305 TTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATA 246 Qy 560 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 245 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 186 Qy 620 TTTTAATTATAAAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATA 679 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 185 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 126 Qy 680 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAAT 739 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 125 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 66 Qy 740 ATTTAATTATAAAAA 754 |||||||||||| | Db 65 TTTTAATTATAAATA 51 Aligned with SEQ ID NO: 8: SEQ ID NO 36 LENGTH: 665 TYPE: DNA ORGANISM: Homo sapiens Query Match 70.5%; Score 602.2; Length 665; Best Local Similarity 98.7%; Matches 607; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 154 TACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGATCAAT 213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 665 TACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGATCAAT 606 Qy 214 AACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGAATTATA 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 605 AACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGAATTATA 546 Qy 274 AAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTAATTATA 333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 545 AAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTAATTATA 486 Qy 334 AAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGTAATTATAAACA 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 485 AAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGTAATTATAAACA 426 Qy 394 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 425 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 366 Qy 454 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 365 TTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA 306 Qy 514 TTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATA 573 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 305 TTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATA 246 Qy 574 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 633 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 245 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 186 Qy 634 TTTTAATTATAAAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATA 693 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 185 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 126 Qy 694 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAAT 753 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 125 TTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATA 66 Qy 754 ATTTAATTATAAAAA 768 |||||||||||| | Db 65 TTTTAATTATAAATA 51 It would have been prima facie obvious to one of ordinary skill in the art before the time the invention was made to have made an embodiment of an expression vector comprising in the following order: promoter-transgene-5’splice site-S/MAR-3’splice site by introducing splice sites flanking the S/MAR sequence. One of skill in the art would be motivated to make this the order because of Delcuve’s teachings of the order of promoter-transgene-S/MAR resulted in high transgene expression, and Delcuve recommends including the S/MAR within a non-coding region, and Shaul’s teaching of the presence of introns enhances transgene expression but not if they are more than 50–55 nt downstream of termination codons (TCs). As evidenced by Mercer, splicing out of the S/MAR sequence would occur once transcription has run through the latter sequence because it is within an intron and intronic elements are spliced out. For one of ordinary skill in the art, it would have merely amounted to a simple combination of known prior art elements according to known methods to yield predictable results. See MPEP 2144 II and 2143 A. Thus, Delcuve in view of Shaul make obvious instant claims 1, 3, 7, 10-11 and 25-29. Claims 4-5 and 21-22 are rejected under 35 U.S.C. 103 as being unpatentable over Delcuve (US 005888774A, IDS of 3/19/2020 cites the CIP) in view of Shaul (Shaul,O. International Journal of Biochemistry and Cell Biology, Vol. 91 (2017), pp:145-155) where claim 1 is evidenced by Mercer (Genome Research, 2015, 25:290–303) as applied to claims 1, 3, 7, 10-11 and 25-29 above, and further in view of Martinez (US 2017 /0022519 A1). The expression vector of Delcuve and Shaul is discussed above for claim 1. Neither Delcuve nor Shaul teach wherein the expression vector further comprises a selectable marker wherein the promoter and marker together constitute a gene. However, before the effective filing date, Martinez also teaches expression vectors bearing S/MAR elements. Regarding claims 4-5 and 21, Martinez specifically teaches integrase mutant lentiviral vectors wherein the polynucleotide comprises a coding sequence wherein said coding sequence encoding a polypeptide (eGFP) intervenes said promoter and said S/MAR element (abstract; Fig. 2). Martinez study the kinetics of expression of eGFP resulting from vectors that differ with respect to the presence of different elements in each of the vectors (Fig. 4 for e.g.). Martinez teaches a further coding sequence encoding neomycin as the selectable marker for e.g. (“neo” in Fig. 2; [0124-0125]) and together they constitute a selectable marker gene (Martinez claims 1 and 15-19; the transcriptional unit contains the CMV/p5 promoter (eC/p5) and the reporter cassettes). Regarding claim 22, Martinez teaches puromycin may be used as the selectable marker gene [0125]. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included the selectable marker (neo) intervening the promoter and the S/MAR element such that selectable marker and promoter together constitute a selectable marker gene, and wherein said selectable marker is a selectable marker of a eukaryotic cell in addition to the encoded polypeptide of Delcuve. One would have been motivated to include a selectable marker gene within Delcuve and Shaul’s expression vector because such a vector would become suitable for gene expression studies such as following the kinetics of gene expression as one would need to do before using a vector in gene therapy. One would have had a reasonable expectation of success in making a single polynucleotide of the elements described by Delcuve, Shaul, and Martinez because all references are in the field of gene expression. Thus, Delcuve and Shaul in view of Martinez make obvious instant claims 4-5 and 21-22. Claims 8-9, 20, and 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Delcuve (US 005888774A, IDS of 3/19/2020 cites the CIP) in view of Shaul (Shaul,O. International Journal of Biochemistry and Cell Biology, Vol. 91 (2017), pp:145-155) where claim 1 is evidenced by Mercer (Genome Research, 2015, 25:290–303) as applied to claims 1, 3, 7, 10-11 and 25-29 above, and further in view of Martinez (US 2017 /0022519 A1) and Giannakopoulos (Giannakopoulos et al., JMB, 387(5), 1239–1249. (2009), of record) and claims 9 and 23 are evidenced by Haase (Haase et al. BMC Biotechnology 2010, 10:20). The expression vector of Delcuve and Shaul is discussed above for claim 1. Neither Delcuve nor Shaul teach wherein the expression vector further comprises a non-viral ori of replication (claim 8) or replicates episomally and stably (claim 9 and 23). However, before the effective filing date, Martinez and Giannakopoulos also teach expression vectors bearing S/MAR elements. Martinez’s teachings were discussed above and apply. Regarding claim 8, Martinez further teaches the expression vector bearing S/MAR elements also has a eukaryotic origin of replication [0032] besides having a prokaryotic origin of replication and a selection [0150]. Thus, the origin of replication is not one of the viral origins of replication prohibited by the instant claim. Regarding claims 9 and 23, Martinez further teaches wherein said expression vector replicates stably episomally in eukaryotic cells (title, abstract). The stable, episomal state is a result of the non-integrating lentiviral used. ([0164] (ii) maintaining the cell under conditions adequate for assembly of the lentivirus.). Regarding claim 24, Delcuve had taught CHO-K1 cells (col 19, lines 4-5) and Martinez teach in [0190] in a particular embodiment, the stable cell is a mammalian cell. Neither Delcuve nor Shaul nor Martinez teaches the stable maintenance of the expression vector in the absence of a lentivral system (claims 9 and 23). However, before the effective filing date, Giannakopoulos teach that the failure of polynucleotides (constructs) to establish cell lines; i.e., stable episomal replication, is possibly due to inhibitory effects deriving from the coexistence of the two elements, S/MAR and a viral Ori, within the same polynucleotide (plasmid) (Giannakopoulos Pg. 1245, middle of 1st paragraph of section titled, “Replacement of EBV OriP by IR restores the capacity for stable transfection”; long-term expression seen in Fig. 2(a) row E and Fig. 2 (b) bar E show that such replication is stable episomal replication. Also as evidenced by Haase, it is not the primary sequence of DNA that is of significance in the establishment of the episomal state, rather epigenetic features such as chromatin structure and nuclear localization conferred by the presence of a MAR element is required for the episomal state (pg. 2, 1st para on right). Regarding claim 20, Giannakopoulos further teaches transfecting CD34+ cells (Pg. 1240, last paragraph, left column). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have substituted the SV40 origin of replication of Delcuve for the initiation of replication region of eukaryotic origin of Martinez, in the polynucleotide of Delcuve and Shaul because Giannakopoulos teaches that this is necessary for episomal maintenance (in the absence of a lentiviral system). One of ordinary skill would be motivated to 1) perform a simple combination of known vector components for the advantage of studying transient expression kinetics from polynucleotides and 2) perform a simple substitution of one ori of replication for the SV40 ori of replication for the advantage of obtaining a stable episomally replicating plasmid (i.e., does not integrate into the host genome and is not lost with replicative cycles), if choosing to simplify the system by not using a lentiviral system as used by Martinez. One of ordinary skill would have a reasonable expectation of success since all of Delcuve, Shaul, Martinez, and Giannakopoulos teach polynucleotides bearing S/MARs for the advantage of expressing genes. See MPEP 2144 II and 2143 B. Thus, Delcuve and Shaul in view of Martinez and Giannakopoulos make obvious instant claims 8-9, 20, and 23-24. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Maintained Claim Rejections - 35 USC § 103 Claims 1, 3, 9, and 23-24 remain rejected under 35 U.S.C. 103 as being unpatentable over Sgourou (Sgourou A. et al., Journal of Biotechnology, Volume 143, Issue 2, 2009,Pages 85-94) in view of Alberts (Fig. 6-29, Molecular Biology of the Cell, 4th Edition, Alberts B, Johnson A, Lewis J, et al., Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. From DNA to RNA. Retrieved from the internet on 3-26-2025 from < https://www.ncbi.nlm.nih.gov/books/NBK26887/>, 1pg.). Sgourou teaches a polynucleotide comprising at least one promoter and an S/MAR element (Title: S/MAR element-based replicating episomal vectors), wherein said S/MAR element is located downstream of said promoter (Fig. 1 (A); Section 2.1 Plasmid vector construction). Sgourou’s vector is a modification of the prototypical S/MAR containing vector pEPI-1 vector. The S/MAR element of the pEPI-1 vector, previously described, has a nucleic acid sequence (of said S/MAR sequence) that comprises at least 3 sequence motifs ATTA (SEQ ID NO:1) per 100 nucleotides over a stretch of at most 200 nucleotides. E.G. Shown below is a PORTION OF the published SAR b-interferon (b-ifn) sequence contained in the pEPI-1 vector past the 5’-most end wherein ATTA sequence motifs are in upper case; incidence of ATTA in the boxed fragment is 3/70: ACACACAAAAAAATTCCAGTGAATTATAAGTCTAAATGGAGAAGGCAAAACTTTAAATCTTTTAGAAAAT AATATAGAAGCATGCCATCATGACTTCAGTGTAGAGAAAAATTTCTTATGACTCAAAGTCCTAACCACAA AGAAAAGATTGTTAATTAGATTGCATGAATATTAAGACTTATTTTTAAAATTAAAAAACCATTAAGAAAA GTCAGGCCATAGAATGACAGAAAATATTTGCAACACCCCAGTAAAGAGAATTGTAATATGCAGATTATAA AAAGAAGTCTTACAAATCAGTAAAAAATAAAACTAGACAAAAATTTGAACAGATGAAAGAGAAACTCTAA ATAATCATTACACATGAGAAACTCAATCTCAGAAATCAGAGAACTATCATTGCATATACACTAAATTAGA Sgourou further teaches the polynucleotide further comprises a cargo sequence, the cargo sequence encodes a polypeptide (HBB) and teaches the location of the S/MAR and the structure of the inserted HBB locus that precedes the S/MAR sequence is such that transcription that begins at the HBB promoter includes the HBB coding sequence and runs through the S/MAR sequence (pg. 93, left column, middle para). See recitation below: PNG media_image2.png 200 400 media_image2.png Greyscale Further, Sgourou teaches that the S/MAR sequence is post-transcriptionally processed such that the mature mRNA for the coding sequence (HBB) does not retain the S/MAR (see nuclear run-on assay in Fig.4; pg. 87, right column, 1st para of Results). Sgourou teaches that the S/MAR sequence not being part of the mature HBB mRNA has several advantages: avoids any risk of interference the S/MAR sequences may have on pre-mRNA processing (splicing, polyadenylation, nuclear-cytoplasmic transport) functions, mRNA stability and translation efficiency of HBB mRNA (pg. 93, left column, middle para, last sentence). Sgourou teaches that pre-mRNA 3’ end processing and RNA Pol II transcription termination are coupled events and attribute the excision of the S/MAR sequence from the final transcript to the previously described presence of a transcription termination site within the S/MAR sequence (pg. 93, left column 3rd para and right column 2nd para). Sgourou does not teach wherein the S/MAR element in the polynucleotide is flanked by a splice donor and a splice acceptor. However, Alberts teaches splice sites, such as splice donor and a splice acceptor, flanking an intervening sequence results in the splicing out and excision of the intervening sequence (Fig. 6-29). One of ordinary skill in the art is familiar with Alberts because of its use as a textbook for molecular biology. See MPEP 2141 II.C. Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.” MPEP 2141. FACTORS TO CONSIDER IN DETERMINING LEVEL OF ORDINARY SKILL The person of ordinary skill in the art is a hypothetical person who is presumed to have known the relevant art at the relevant time. Factors that may be considered in determining the level of ordinary skill in the art may include: (1) "type of problems encountered in the art;" (2) "prior art solutions to those problems;" (3) "rapidity with which innovations are made;" (4) "sophistication of the technology; and" (5) "educational level of active workers in the field." In re GPAC, 57 F.3d 1573, 1579, 35 USPQ2d 1116, 1121 (Fed. Cir. 1995). "In a given case, every factor may not be present, and one or more factors may predominate." Id. See also Custom Accessories, Inc. v. Jeffrey-Allan Indust., Inc., 807 F.2d 955, 962, 1 USPQ2d 1196, 1201 (Fed. Cir. 1986); Environmental Designs, Ltd. v. Union Oil Co., 713 F.2d 693, 696, 218 USPQ 865, 868 (Fed. Cir. 1983). It would have been prima facie obvious to one of ordinary skill in the art before the time the invention was made to have introduced splice sites flanking the S/MAR sequence because Sgourou’s teachings of: the messenger RNA primary transcript and the mature RNA transcript are different with respect to the absence of S/MAR sequence from the mature transcript, transcription through the S/MAR sequence is required for expression of the gene that precedes it, and the Ifn-b MAR has within it a termination sequence to allow for pre-mRNA processing and production of mRNA, put together would make one of ordinary skill in the art to at once envision splicing out of the S/MAR sequence once transcription has run through the latter sequence. For one of ordinary skill in the art, it would have merely amounted to a simple combination of known prior art elements according to known methods to yield predictable results. One would have been motivated to flank the S/MAR element in the polynucleotide with a splice donor and a splice acceptor for the advantage of using any S/MAR sequence (not necessarily the Ifn-b derived S/MAR sequence) in conjunction with any expression cassette (not necessarily the HBB-locus) to obtain an episomal vector suitable for gene expression such as one useful in gene therapy. One would have had a reasonable expectation of success in making a single polynucleotide of the elements described by Sgourou and Alberts because both references are in the field of gene expression as it relates to pre-mRNA transcription and 3’ processing. See MPEP 2144 II and 2143 A. As evidenced by Alberts, the limitation “from which transcript the sequence of the S/MAR element is spliced out” as recited in claim 1, is met when flanking splice sites are introduced into a gene encoding a transcript. Regarding claim 3, the polynucleotide of claim 1 is discussed above. As discussed above is Sgourou’s teachings wherein said cargo sequence comprises a coding sequence encoding a polypeptide (HBB). Further, Sgourou shows expression of the mRNA for the polypeptide encoded by HBB locus (Fig. 5). Regarding claims 9 and 23-24, the limitation ‘wherein said polynucleotide replicates episomally in a host cell (the episomal replication is a stale episomal replication)’ in claim 9(23) is directed to an intended use (of functional limitation of the polynucleotide in a cell) of the claimed polynucleotide in a cell. The limitation ‘wherein the host cell is a mammalian cell’ in claim 23 is also directed to an intended use of the polynucleotide. Claims 9 and 23-24 are product claims directed to a polynucleotide and not a method of using the polynucleotide in a cell. Claims 9 and 23-24 do not add any additional structures to the polynucleotide. Thus, a statement of intended use in claims 9 and 23-24 fails to distinguish the claimed polynucleotide made obvious by Sgourou taken with Alberts. Thus, Sgourou in view of Alberts make obvious instant claims 1, 3, 9, and 23-24. Claims 4, 8, 11, 20-21 remain rejected under 35 U.S.C. 103 as being unpatentable over Sgourou (Sgourou A. et al., Journal of Biotechnology, Volume 143, Issue 2, 2009,Pages 85-94) in view of Alberts (Fig. 6-29, Molecular Biology of the Cell, 4th Edition, Alberts B, Johnson A, Lewis J, et al., Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. From DNA to RNA. Retrieved from the internet on 3-26-2025 from <https://www.ncbi.nlm.nih.gov/books/NBK26887/>, 1pg.) as applied to claims 1, 3, 9, and 23-24 above, and further in view of Giannakopoulos (Giannakopoulos et al., JMB, 387(5), 1239–1249. (2009)). The polynucleotide of Sgourou and Alberts is discussed above for claim 1. Specifically Sgourou teaches wherein the polynucleotide comprises a cargo sequence wherein said cargo sequence encodes a polypeptide (encoding the polypeptide HBB). Further, Sgourou teaches wherein the promoter and cargo sequence encoding polypeptide together constitute a gene (cassette comprising HBB promoter and HBB encoding sequence in place of the CMV-eGFP cassette of the original pEPI-1 vector), (section 2.1, plasmid vector construction). Neither Sgourou nor Alberts teaches wherein said polynucleotide further comprises a selectable marker wherein the promoter and marker together constitute a gene. However, before the effective filing date, Giannakopoulos teaches polynucleotides (vectors) bearing S/MAR elements (title, Fig. 1(b)-(e)). The S/MAR element is from the human β-interferon gene locus (third sentence of abstract). Regarding claims 4 and 21, Giannakopoulos specifically teaches wherein the polynucleotide further comprises a coding sequence encoding a polypeptide (eGFP) wherein said coding sequence encoding a polypeptide intervenes said promoter and said S/MAR element and together they constitute a selectable marker gene. See Fig. 1(b)-(e). Giannakopoulos study the kinetics of expression of eGFP resulting from vectors that differ with respect to the presence of different elements in each of the vectors (Fig. 1 and 2). Regarding claim 8, Giannakopoulos further teaches the polynucleotide (vector) bearing S/MAR elements also has an alternative initiation of replication element (IR) (middle of abstract) from the human β-globin gene locus, instead of an origin of replication of viral origin (Pg. 1241, 2nd to last introductory paragraph, (pESdER-IR/eGFP), Fig. 1(e)). Thus, the origin of replication is not one of the viral origins of replication prohibited by the instant claim. Giannakopoulos provide evidentiary motivation by disclosing that the failure of polynucleotides (constructs) to establish cell lines; i.e., stable episomal replication, is possibly due to inhibitory effects deriving from the coexistence of the two elements, S/MAR and a viral Ori, within the same polynucleotide (plasmid) (Giannakopoulos Pg. 1245, middle of 1st paragraph of section titled, “Replacement of EBV OriP by IR restores the capacity for stable transfection”; long-term expression seen in Fig. 2(a) row E and Fig. 2 (b) bar E show that such replication is stable episomal replication. Regarding claims 9, 11, 20, and 23, Giannakopoulos further teaches wherein said polynucleotide replicates episomally in Jurkat cells (Pg. 1246, last line of 2nd paragraph and 1st sentence of 3rd paragraph; pg. 1242, bridging left and right columns: To the contrary, cells transfected with plasmid B (pEBS/eGFP) or C (pESdER/eGFP) showed a rapid decay of cell viability and GFP fluorescence. The episomal state of plasmids A, B, and C in the respective transfected Jurkat cells was investigated by Southern blot, using DNA from cell culture of day 8 (Fig. 3a)). Thus, the art of Giannakopoulos teaches a host cell (claim 11) and stable episomal replication in it (claims 9 and 23). Regarding 20, Giannakopoulos further teaches transfecting CD34+ cells (Pg. 1240, last paragraph, left column). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have 1) substituted the selectable marker (GFP/eGFP) intervening the promoter and the S/MAR element such that selectable marker and promoter together constitute a selectable marker gene, and wherein said selectable marker is a selectable marker of a eukaryotic cell in place of the polypeptide of Sgourou, and 2) to have substituted the SV40 origin of replication of Sgourou for the initiation of replication region from the human β-globin gene locus of Giannakopoulos, in the polynucleotide of Sgourou and Alberts. One of ordinary skill would be motivated to 1) perform a simple substitution of one known polypeptide for another for the advantage of studying transient expression kinetics from polynucleotides and 2) perform a simple substitution of one ori of replication for the SV40 ori of replication for the advantage of obtaining a stable episomally replicating plasmid (i.e., does not integrate into the host genome and is not lost with replicative cycles). One of ordinary skill would have a reasonable expectation of success since both Sgourou and Giannakopoulos teach polynucleotides bearing S/MARs and Alberts teaches general molecular biology. See MPEP 2144 II and 2143 B. Thus, Sgourou and Alberts in view of Giannakopoulos make obvious instant claims 4, 8, 11, 20-21. Claims 5, 7, 10, 22, and 25 are rejected under 35 U.S.C. 103 as being unpatentable over Sgourou (Sgourou A. et al., Journal of Biotechnology, Volume 143, Issue 2, 2009,Pages 85-94) and Alberts (Fig. 6-29, Molecular Biology of the Cell, 4th Edition, Alberts B, Johnson A, Lewis J, et al., Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. From DNA to RNA. Also available from: https://www.ncbi.nlm.nih.gov/books/NBK26887/) in view of Giannakopoulos (Giannakopoulos et al., JMB, 387(5), 1239–1249. (2009), of record) as applied to claims 1, 3, 4, 8-9, 11, 20-21, and 23-24 above and further in view of Ivanova (US 20050064467, IDS cites the patent). Regarding claim 7, Sgourou further teaches recapitulating the function of genetic components as they behave in their natural location is valuable in establishing vectors for gene therapy applications (genetic components involved in the regulation of nuclear function in higher eukaryotes…been shown in some cases to be a necessary part of novel and effective gene delivery and expression systems that mimic faithfully their function at their natural chromosomal locus, (last line, pg. 85). The alternative limitations of claim 7 have not been considered because they are recited as optional; i.e., not required. Giannakopoulos further teaches the polynucleotide comprises a bacterial origin of replication (pg. 1247: All constructs were used for transformation of competent E. coli DH5a cells to produce bacterial clones.). Neither Sgourou, Alberts, nor Giannakopoulos teach wherein said bacterial origin of replication is insulated from the residual sequences comprised in the polynucleotide by the presence of at least one insulation element. However, before the filing date of the instant application, Ivanova resolve the deficiency of Sgourou, Alberts, and Giannakopoulos wherein Ivanova teaches a polynucleotide comprising an S/MAR element (Ivanova paragraphs [0029] - [0030]; Fig. 1 A and B). The limitation, “insulator element” in claim 7 is being interpreted as anti-repressive element and/or an S/MAR element as per first paragraph, pg. 13 of instant specification. Ivanova further teaches wherein said polynucleotide also comprises a bacterial origin of replication (Col E1, Ivanova paragraph [0030] and Fig. 1B). Ivanova teaches wherein said bacterial origin of replication is insulated from the residual sequences comprised in the polynucleotide by the presence of at least one insulation element (S/MAR). See Fig. 1B of Ivanova with Examiner’s annotation. It would have been obvious to one of ordinary skill in the art to have integrated a bacterial origin of replication which is insulated from the residual sequences comprised in the polynucleotide into the polynucleotide of Sgourou, Alberts, and Giannakopoulos. One of ordinary skill would be motivated to make the modification for the advantage of replicating the polynucleotide to produce bacterial clones; i.e., no interference from the rest of the elements of the polynucleotide. One of ordinary skill would have a reasonable expectation of success since Sgourou and Giannakopoulos teach functional S/MAR expression constructs and Alberts teaches general molecular biology. See MPEP 2144 II and 2143 A. Regarding claim 5 and 22, Ivanova teaches puromycin resistance gene as the selectable marker gene in the use of their polynucleotide (puro, as depicted in Ivanova, Fig. 1B shown above). As per description of figures, puro is a polypeptide encoded by puromycin resistance gene (paragraph 0030). Regarding claims 10 and 25, Ivanova teaches wherein the polynucleotide is comprised in a pharmaceutical composition (Pg. 3, [0027]). It would have been obvious to a person of ordinary skill in the art to make a composition comprising the polynucleotide for storage for future usage or for delivering the polynucleotide to a cell. Regarding claim 24, Ivanova teaches wherein the polynucleotide replicates episomally in a mammalian host cell (Pg. 1, [0007]). It would have been prima facie obvious to one of ordinary skill in the art to integrate the puromycin resistance gene as a selectable marker in the polynucleotide of Sgourou, Alberts, and Giannakopoulos, and place it under the control of the promoter such that together the promoter and the puromycin resistance gene constitute a selectable marker gene, and further comprise the polynucleotide in a composition for expression and episomal replication in a mammalian host cell. This would amount to a simple combination of prior art elements. One of ordinary skill in the art knows that irrespective of the placement of a resistance marker, an antibiotic resistance marker will still function as intended; i.e., allow for selection of clones expressing a transfected polynucleotide. The skilled artisan would be motivated to place a puromycin resistance gene as taught by Ivanova into the polynucleotide Sgourou, Alberts, and Giannakopoulos for the advantage of selecting clones expressing a transfected polynucleotide in human cells for the advantage of utilizing the polynucleotide in gene therapy. One of ordinary skill in the art would have a reasonable expectation of success because all of Sgourou, Giannakopoulos, and Ivanova teach polynucleotides bearing S/MARs and use of antibiotic resistance genes as suitable selection markers with the ultimate goal of using such polynucleotides in gene therapy and Alberts teaches general molecular biology. See MPEP 2144 II and 2143(I) A. Thus, Sgourou and Alberts in view of Giannakopoulos and further in view of Ivanova make obvious instant claims 5, 7, 10, 22, and 25. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Response to Applicant’s Remarks: 1. On Pgs. 6-7 of Applicant's arguments filed 20th March 2026, Applicant summarizes the 103 rejections and states the requirements of the statute to establish a prima facie case of Obviousness and lays out three criteria to be met as per case law re Dembiczak. 3. On Pgs. 7-8, of the Remarks, Applicant provides arguments saying they disagree with Examiner’s obviousness rejection of claims because: the applied reference of Sgourou and Alberts is inadequate as a reference in established an obviousness rationale as summarized below: Applicants argue, last para pg. 7, that i) Sgourou does not teach that removal of the S/MAR element from a pre- mRNA has an effect at all, since there is no control construct corresponding to hβ-S/MAR(A), but lacking the HBB cleavage/polyadenylation site, therefore Sgourou’s teachings are merely theoretical. Therefore, the skilled person would not be motivated by Sgourou’s teachings; ii) the skilled person had no reason to assume that the musings in Sgourou about effects of S/MAR removal would be more than pure speculation; iii) any benefit to removing the S/MAR elements from the polynucleotide is gleaned from Applicant's specification, only, and relies on impermissible hindsight bias. As there is no teaching or suggestion of removing the S/MAR elements in Sgourou, it is only through hindsight bias the Office could make this conclusion. On First para pg. 8, Applicants argue, iv) the inventions according to Sgourou and instant are not equivalent: Sgourou: the S/MAR element is removed already in 3' end processing, while according to the instant invention: S/MAR element is only removed during splicing; v) the skilled person would not have considered using splice sites, since doing so could not prevent a possible interference with RNA splicing, as promoted by Sgourou; and vi) if the skilled person would have assumed the theoretical effects described by Sgourou to indeed occur, the skilled person would have assumed the solution according to the claims to be inferior. Applicant's arguments have been fully considered but they are not persuasive. Regarding i) and ii), Sgourou does not teach a control construct because Sgourou discloses a reference (Dye, M.J., Proudfoot, N.J., in Cell, 2001), which reference presents a very elegant study on transcription termination within the HBB locus. It is not customary within the art to redo a study, rather build on previously validated, peer-reviewed studies. Therefore Sgourou’s teachings are not merely theoretical. Therefore, the skilled person would be motivated by Sgourou’s teachings. Regarding iii) in response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In the instant case, Sgourou taught the order: promoter-transgene-polyA-S/MAR; i.e., no termination signal between the transgene and S/MAR. Sgourou’s working example taught where the S/MAR sequence was not part of the mature HBB mRNA (transgene). Alberts teaches splice sites, such as splice donor and a splice acceptor, flanking an intervening sequence results in the splicing out and excision of the intervening sequence, and thus its absence from the mature transcript. Thus, one of skill can make the connection between transcriptional run-through but absence of an element from the mature transcript and splicing out, based off knowledge gleaned from standard textbooks in the art such as the cited art of Alberts. Therefore, the rejection does not use knowledge only cleaned from applicant’s disclosure. Regarding iv and v) Sgourou clearly teach that S/MAR is not part of the mature transcript. See recitation on pg. 93, left column, 3rd para: PNG media_image3.png 200 400 media_image3.png Greyscale So the reference is not advocating preventing a possible interference with RNA splicing, rather advocating for S/MAR to not be part of the mature RNA, which is what instant invention requires. One of skill in the art knows the various ways by which sequences may be removed from the pre-mRNA (the secondary reference of Alberts) and would apply any of these options as they would see fit. There are many references in the art that say that splicing and post-transcriptional processing are coupled events. See for e.g.: Davidson and West, Nucleic Acids Research, 2013, Vol. 41, No. 14 7101–7114. Regarding vi), even if the prior art renders instant invention “inferior”, it does not make instant invention patentable. See MPEP 2145 X D.1. The Nature of the Teaching Is Highly Relevant: A prior art reference that "teaches away" from the claimed invention is a significant factor to be considered in determining obviousness. However, "the nature of the teaching is highly relevant and must be weighed in substance. A known or obvious composition does not become patentable simply because it has been described as somewhat inferior to some other product for the same use." In re Gurley, 27 F.3d 551, 553, 31 USPQ2d 1130, 1132 (Fed. Cir. 1994) (Claims were directed to an epoxy resin based printed circuit material. A prior art reference disclosed a polyester-imide resin based printed circuit material, and taught that although epoxy resin based materials have acceptable stability and some degree of flexibility, they are inferior to polyester-imide resin based materials. The court held the claims would have been obvious over the prior art because the reference taught epoxy resin based material was useful for the inventor’s purpose, applicant did not distinguish the claimed epoxy from the prior art epoxy, and applicant asserted no discovery beyond what was known to the art.). Therefore, the §103 rejection is maintained. Regarding new claims, these have been addressed in the new 103 rejection. Maintained Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3-5, 7-10, and 21-25 remain provisionally rejected and claims 26-29 are newly rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4-6 and 8 of copending Application No.17/439,921. Although the claims at issue are not identical, they are not patentably distinct from each other because: Copending claim 1 recites “wherein said S/MAR element is located downstream of said promoter and of said expressible construct, wherein said S/MAR element is flanked by a splice donor and a splice acceptor” and recites the same SEQ ID Nos as instant claims 26-29. See alignment below for just SEQ ID NO: 7 from both applications: RESULT 1 US-16-648-768-7 Query Match 100.0%; Score 825; DB 1; Length 825; Best Local Similarity 100.0%; Matches 825; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCAGGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGC 60 Qy 61 CTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGTGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGTGT 120 Qy 121 TCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAA 180 Qy 181 TACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATT 240 Qy 241 TATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAAT 300 Qy 301 TATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAATATGTAATTATA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAATATGTAATTATA 360 Qy 361 AAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATA 420 Qy 421 AAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATA 480 Qy 481 AAATATGTAATTATAAACATTTTAATTATAAAATATTTAATTATAAACATTTTAATTATA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AAATATGTAATTATAAACATTTTAATTATAAAATATTTAATTATAAACATTTTAATTATA 540 Qy 541 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA 600 Qy 601 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATACTTTAATTATA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATACTTTAATTATA 660 Qy 661 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA 720 Qy 721 AATATTTTAATTATAAAATATTTAATTATAAAAACACAATTACCTCATCTTTTTAAATAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AATATTTTAATTATAAAATATTTAATTATAAAAACACAATTACCTCATCTTTTTAAATAT 780 Qy 781 TTTTGCAAAATATTTCCCTCCATAATTTCTCCGTTTCCATTTTTA 825 ||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTTTGCAAAATATTTCCCTCCATAATTTCTCCGTTTCCATTTTTA 825 Copending claim 6 recites “wherein a transcript is transcribed from said promoter, from which transcript the sequence of the S/MAR element is spliced out.” Thus, the polynucleotide recited in the instant claims is made obvious by the copending claims of ‘921. Any additional limitations of the ‘921 claims are encompassed by the open claim language “comprises” found in the instant claims. Response to Applicant’s Remarks: Applicant's arguments filed 03/20/2026 have been fully considered but they are not persuasive because applicant did not address the merits of the provisional rejection. It is noted the response states that they will address the rejection at such time as the claims are otherwise considered allowable. Conclusion No claims are allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/ Examiner, Art Unit 1635 /CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Show 5 earlier events
Feb 17, 2025
Request for Continued Examination
Feb 18, 2025
Response after Non-Final Action
Apr 02, 2025
Non-Final Rejection mailed — §103, §DP
Sep 02, 2025
Response Filed
Sep 23, 2025
Final Rejection mailed — §103, §DP
Mar 20, 2026
Request for Continued Examination
Mar 23, 2026
Response after Non-Final Action
Jun 25, 2026
Non-Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702721
GENE THERAPY FOR MACULAR DEGENERATION
5y 6m to grant Granted Aug 11, 2026
Patent 12686868
METHODS AND COMPOSITIONS FOR REJUVENATING CNS GLIAL POPULATIONS BY SUPPRESION OF TRANSCRIPTION FACTORS
3y 9m to grant Granted Jul 21, 2026
Patent 12680103
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jul 14, 2026
Patent 12644124
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jun 02, 2026
Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
71%
Grant Probability
99%
With Interview (+42.3%)
3y 0m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 68 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month