Prosecution Insights
Last updated: April 19, 2026
Application No. 16/735,146

Multiplex Guide RNAS

Non-Final OA §102§103
Filed
Jan 06, 2020
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The General Hospital Corporation
OA Round
4 (Non-Final)
54%
Grant Probability
Moderate
4-5
OA Rounds
3y 0m
To Grant
92%
With Interview

Examiner Intelligence

Grants 54% of resolved cases
54%
Career Allow Rate
23 granted / 43 resolved
-6.5% vs TC avg
Strong +38% interview lift
Without
With
+38.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
50 currently pending
Career history
93
Total Applications
across all art units

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
34.1%
-5.9% vs TC avg
§102
17.3%
-22.7% vs TC avg
§112
30.1%
-9.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 43 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Withdrawal of Finality The finality of the Office Action mailed August 6, 2025 has been reconsidered and is withdrawn in order to make the new grounds of rejection as set forth below. Priority Applicant’s claim to priority from US Application No.15/107,550 filed 06/23/2016 and PCT/US14/56416 filed 09/18/2014 and Provisional Application Nos. 61/921,007 filed 12/26/2013 and 61/930,782 filed 01/23/2014. Application Status This Application is a DIV of US Application No. 15/107,550 filed 06/23/2016 (patented: US Patent No. 10,526,589). Claim Status: Amendment to claims filed 10/27/2025 are hereby acknowledged. Claims 1-20 are cancelled. Claims 21, 28 and 35 are currently amended. Accordingly, claims 21-40 are under consideration in this office action. Any objection or rejection not reiterated herein has been overcome by Applicant’s amendments and/or arguments and is therefore withdrawn. Nucleotide and/or Amino Acid Sequence Disclosures Amendments to Sequence listings filed 10/27/2025 are hereby acknowledged. The sequence disclosures located in Figure 4 have been amended. Replacement sheet for Figure 4 is hereby acknowledged and is acceptable. Claim Rejections- 35 USC § 102 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 21 is rejected under 35 U.S.C. §102 (a)(1) as anticipated by or, in the alternative, under 35 U.S.C. §103 as being obvious over Doudna (Doudna, J.A. et al. US 2014/0068797 A1, published March 6, 2014, with filing date of March 15, 2013, benefitting of priority from Provisional Applications Nos. 61/652,086 filed May 25, 2012, 61/716,256 filed October 19, 2012, 61/757,640 filed January 28, 2013 and 61/765,576, filed February 15, 2013), as evidenced by, or, in view of Haurwitz (Haurwitz, R.E. et al. WO 2011/143124 A2, published November 17, 2011). Regarding claim 21, Doudna teaches a method of site-specific modification of a target DNA, using a DNA-targeting RNA that comprises a targeting sequence, together with a modifying polypeptide (see title and abstract; § [0021]). Doudna teaches single molecule DNA-targeting RNAs, i.e. guide RNAs which are chimeras of crRNA and tracrRNA (see Figure 9). Therefore, Doudna teaches a method of altering gene expression in a targeted way, using specifically designed and cloned sgRNA and a nucleic acid encoding a dCas9 protein into plasmids and transfect cells with this CRISPRi system capable of targeting multiple genes simultaneously (see § [0444]-[0446], [0765]). Doudna also teaches multiple simultaneous DNA-targeting RNAs, by designing multiple (e.g., 3 or more, 4 or more…, or 50 or more) DNA-targeting RNAs, and simultaneously expressing them in a target cell, from same vector (see § [0444]-[0445]). Regarding claim 21 reciting “ wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene”, Doudna teaches a sgRNA comprising a 20-bp region complementary to the target (see Figure 43 and § [0767]). Regarding claim 21 reciting “each gRNA is flanked by at least one Csy4 cleavage sequence”, Doudna teaches that Csy4 specifically recognizes a minimal 17-bp RNA hairpin (see [0447]). Doudna also teaches expressing multiple DNA-targeting RNAs, using an artificial RNA processing system mediated by the Csy4 endoribonuclease (see § [0444]-[0446]). Doudna teaches that multiple DNA-targeting RNAs can be concatenated into a tandem array on a precursor transcript (e.g., expressed from a U6 promoter), and separated by Csy4-specific RNA sequence. Co-expressed Csy4 protein cleaves the precursor transcript into multiple DNA-targeting RNAs (see § [0446]-[0447]). Doudna teaches that the advantage of using an RNA processing system are two-fold: 1) there is no need to use multiple promoters, 2) since all DNA-targeting RNAs are processed from a precursor transcript, their concentrations are normalized for similar dCas9 binding (see § [0446]). Doudna is silent on the sequence of Csy4 cleavage site and does not teach SEQ ID NO:55 specifically. However, Haurwitz teaches an endoribonuclease composition comprising Csy4 and its use (see title and abstract). Haurwitz teaches SEQ ID NO: 55, i.e. the sequence specific for Csy4 recognition: “GUUCACUGCCGUAUAGGCAG” as SEQ ID NO: 103 (see § [0049]). Haurwitz teaches the use of the sequence in a method of regulating production of a target RNA, modifying said target RNA to include a CSy4 RNA substrate sequence (see Figures 9-10 and § [0049]). Therefore, Doudna, as evidenced by Haurwitz, teaches a method of altering expression of a plurality of target genes in a cell, the method comprising expressing a DNA molecule comprising a plurality of sequences encoding guide RNAs (gRNAs), wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene, and each gRNA is flanked by at least one Csy4 cleavage sequence comprising or consisting of the sequence “GUUCACUGCCGUAUAGGCAG”. In the alternative, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the method of altering gene expression using a construct comprising a transcript containing concatenated gRNAs, as taught by Doudna, with concatenated gRNAs each flanked by the cleavage substrate sequence of Csy4 as taught by Haurwitz. One with ordinary skills in the art, motivated in using a single promoter controlling all the gRNA transcripts with their concentrations normalized for similar dCas9 binding in a CRISPRi system, would have performed this modification with a predictable and reasonable expectation of success and arrived at the claimed invention. Regarding claim 22, Doudna teaches a gRNA comprising SEQ ID NO: 4 (see FIG.31 (v2.2; CTLA1 sgRNA)). Doudna also teaches SEQ ID NO: 5 (see FIG. 29C, FIG.31, sgRNA for CLTA1, and § [0214]-[0215]). Doudna also teaches SEQ ID NO: 6 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 7 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 8 (see claim 143 (6)). Doudna teaches combinations of known sequences tracrRNA and crRNA with spacers, for designing chimeras sgRNAs, and described in FIGs.7 and 14. Regarding claim 23, Doudna teaches that the DNA molecule is operably linked to a promoter sequence (see FIG.31(U6 or HA promoters), see § [0010], [0015]). Regarding claim 24, Doudna teaches the molecule comprising sequences encoding for two, three or more gRNAs sequences (see § [0444]-[0445] and [0765]). Regarding claims 25 and 26, Doudna teaches the use of suitable promoters that can be RNA polymerase Pol II or Pol III (see § [0105], [0476], [0692], [0696]). Regarding claim 27, Doudna teaches CMV promoters (see §[0364],[0368], [0476], [0479]). Doudna teaches using SYN1 promoters (i.e. HUMSYN1B, see §[018], [0479]). Regarding claim 28, Doudna teaches a method of altering gene expression of a targeted gene in a cell, using multiple specifically designed and cloned sgRNA and a nucleic acid encoding a dCas9 protein into plasmids and transfect cells with this CRISPRi system (see § [0444]-[0446]). Doudna teaches using multiple sgRNAs for the same target gene in a cell, targeting multiple parts of a single gene (see §[0768]). Doudna teaches using two sgRNAs both targeting the same gene with a multiplicative effects of silencing (see FIGs.43F and 51). Doudna also teaches multiple simultaneous DNA-targeting RNAs, by designing multiple (e.g., 3 or more, 4 or more…, or 50 or more) DNA-targeting RNAs, and simultaneously expressing them in a target cell, from same vector (see § [0444]-[0445]). Regarding claim 28 reciting “ wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene”, Doudna teaches a sgRNA comprising a 20-bp region complementary to the target (see Figure 43 and § [0767]). Regarding claim 28 reciting “each gRNA is flanked by at least one Csy4 cleavage sequence”, Doudna teaches that Csy4 specifically recognizes a minimal 17-bp RNA hairpin (see [0447]). Doudna also teaches expressing multiple DNA-targeting RNAs, using an artificial RNA processing system mediated by the Csy4 endoribonuclease (see § [0444]-[0446]). Doudna teaches that multiple DNA-targeting RNAs can be concatenated into a tandem array on a precursor transcript (e.g., expressed from a U6 promoter), and separated by Csy4-specific RNA sequence. Co-expressed Csy4 protein cleaves the precursor transcript into multiple DNA-targeting RNAs (see § [0446]-[0447]). Doudna teaches that the advantage of using an RNA processing system are two-fold: 1) there is no need to use multiple promoters, 2) since all DNA-targeting RNAs are processed from a precursor transcript, their concentrations are normalized for similar dCas9 binding (see § [0446]). Doudna is silent on the sequence of Csy4 cleavage site and does not teach SEQ ID NO:55 specifically. However, Haurwitz teaches an endoribonuclease composition comprising Csy4 and its use (see title and abstract). Haurwitz teaches SEQ ID NO: 55, i.e. the sequence specific for Csy4 recognition: “GUUCACUGCCGUAUAGGCAG” as SEQ ID NO: 103 (see § [0049]). Haurwitz teaches the use of the sequence in a method of regulating production of a target RNA, modifying said target RNA to include a CSy4 RNA substrate sequence (see Figures 9-10 and § [0049]). Therefore, Doudna, as evidenced by Haurwitz, teaches a method of altering expression of a single target gene in a cell, the method comprising expressing a DNA molecule comprising a plurality of sequences encoding guide RNAs (gRNAs), wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene, and each gRNA is flanked by at least one Csy4 cleavage sequence comprising or consisting of the sequence “GUUCACUGCCGUAUAGGCAG”. In the alternative, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the method of altering gene expression using a construct comprising a transcript containing multiple concatenated gRNAs targeting the same gene, as taught by Doudna, with multiple concatenated gRNAs each flanked by the cleavage substrate sequence of Csy4 as taught by Haurwitz. One with ordinary skills in the art, motivated in using a single promoter controlling all the gRNA transcripts with their concentrations normalized for similar dCas9 binding in a CRISPRi system targeting a single gene, would have performed this modification with a predictable and reasonable expectation of success and arrived at the claimed invention. Regarding claim 29, Doudna teaches a gRNA comprising SEQ ID NO: 4 (see FIG.31 (v2.2; CTLA1 sgRNA)). Doudna also teaches SEQ ID NO: 5 (see FIG. 29C, FIG.31, sgRNA for CLTA1, and § [0214]-[0215]). Doudna also teaches SEQ ID NO: 6 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 7 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 8 (see claim 143 (6)). Doudna teaches combinations of known sequences tracrRNA and crRNA with spacers, for designing chimeras sgRNAs, and described in FIGs.7 and 14. Regarding claim 30, Doudna teaches that the DNA molecule is operably linked to a promoter sequence (see FIG.31(U6 or HA promoters), see § [0010], [0015]). Regarding claim 31, Doudna teaches the molecule comprising sequences encoding for two, three or more gRNAs sequences (see § [0444]-[0445] and [0765]). Regarding claims 32-33, Doudna teaches the use of suitable promoters that can be RNA polymerase Pol II or Pol III (see § [0105], [0476], [0692], [0696]). Regarding claim 34, Doudna teaches CMV promoters (see §[0364],[0368], [0476], [0479]). Doudna teaches using SYN1 promoters (i.e. HUMSYN1B, see §[018], [0479]). Regarding claim 35, Doudna teaches a method of altering expression of a target gene in a cell by targeting multiple parts of a single gene (see § [0444], [0769]). Doudna teaches different sgRNAs with different targeting loci on the same gene, with sgRNAs chosen at different lengths from the translation start codon (see FIG. 43). Doudna teaches sgRNAs with non-overlapping sequences of the same gene (see page 81, § [0769]). Regarding claim 35 reciting “ wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene”, Doudna teaches a sgRNA comprising a 20-bp region complementary to the target (see Figure 43 and § [0767]). Regarding claim 35 reciting “each gRNA is flanked by at least one Csy4 cleavage sequence”, Doudna teaches that Csy4 specifically recognizes a minimal 17-bp RNA hairpin (see [0447]). Doudna also teaches expressing multiple DNA-targeting RNAs, using an artificial RNA processing system mediated by the Csy4 endoribonuclease (see § [0444]-[0446]). Doudna teaches that multiple DNA-targeting RNAs can be concatenated into a tandem array on a precursor transcript (e.g., expressed from a U6 promoter), and separated by Csy4-specific RNA sequence. Co-expressed Csy4 protein cleaves the precursor transcript into multiple DNA-targeting RNAs (see § [0446]-[0447]). Doudna teaches that the advantage of using an RNA processing system are two-fold: 1) there is no need to use multiple promoters, 2) since all DNA-targeting RNAs are processed from a precursor transcript, their concentrations are normalized for similar dCas9 binding (see § [0446]). Doudna is silent on the sequence of Csy4 cleavage site and does not teach SEQ ID NO:55 specifically. However, Haurwitz teaches an endoribonuclease composition comprising Csy4 and its use (see title and abstract). Haurwitz teaches SEQ ID NO: 55, i.e. the sequence specific for Csy4 recognition: “GUUCACUGCCGUAUAGGCAG” as SEQ ID NO: 103 (see § [0049]). Haurwitz teaches the use of the sequence in a method of regulating production of a target RNA, modifying said target RNA to include a CSy4 RNA substrate sequence (see Figures 9-10 and § [0049]). Therefore, Doudna, as evidenced by Haurwitz, teaches a method of altering expression of multiple target sites in a single gene in a cell, the method comprising expressing a DNA molecule comprising a plurality of sequences encoding non-overlapping guide RNAs (gRNAs), wherein each gRNA comprises a sequence that is complementary to at least 17-20 nts of a target gene, and each gRNA is flanked by at least one Csy4 cleavage sequence comprising or consisting of the sequence “GUUCACUGCCGUAUAGGCAG”. In the alternative, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the method of altering a gene’s expression using a construct comprising a transcript containing non-overlapping multiple concatenated gRNAs targeting the same gene, as taught by Doudna, with multiple concatenated gRNAs each flanked by the cleavage substrate sequence of Csy4 as taught by Haurwitz. One with ordinary skills in the art, motivated in using a single promoter controlling all the gRNA transcripts with their concentrations normalized for similar dCas9 binding in a CRISPRi system targeting multiple sites in a single gene, would have performed this modification with a predictable and reasonable expectation of success and arrived at the claimed invention. Regarding claim 36, Doudna teaches a gRNA comprising SEQ ID NO: 4 (see FIG.31 (v2.2; CTLA1 sgRNA)). Doudna also teaches SEQ ID NO: 5 (see FIG. 29C, FIG.31, sgRNA for CLTA1, and § [0214]-[0215]). Doudna also teaches SEQ ID NO: 6 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 7 (see FIG.31 (v2.2)). Doudna also teaches SEQ ID NO: 8 (see claim 143 (6)). Doudna teaches combinations of known sequences tracrRNA and crRNA with spacers, for designing chimeras sgRNAs, and described in FIGs.7 and 14. Regarding claim 37, Doudna teaches that the DNA molecule is operably linked to a promoter sequence (see FIG.31(U6 or HA promoters), see § [0010], [0015]). Regarding claim 38, Doudna teaches the molecule comprising sequences encoding for two, three or more gRNAs sequences (see § [0444]-[0445] and [0765]). Regarding claim 39, Doudna teaches the use of suitable promoters that can be RNA polymerase Pol II or Pol III (see § [0105], [0476], [0692], [0696]). Regarding claim 40, Doudna teaches CMV promoters (see §[0364],[0368], [0476], [0479]). Doudna teaches using SYN1 promoters (i.e. HUMSYN1B, see §[018], [0479]). Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636 /DANIEL M SULLIVAN/Director, Art Unit 1600
Read full office action

Prosecution Timeline

Jan 06, 2020
Application Filed
Jan 24, 2024
Non-Final Rejection — §102, §103
Jul 01, 2024
Response Filed
Nov 14, 2024
Non-Final Rejection — §102, §103
Apr 17, 2025
Response Filed
Aug 02, 2025
Final Rejection — §102, §103
Oct 07, 2025
Interview Requested
Oct 22, 2025
Examiner Interview Summary
Oct 22, 2025
Applicant Interview (Telephonic)
Oct 27, 2025
Response after Non-Final Action
Nov 17, 2025
Non-Final Rejection — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
2y 5m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
2y 5m to grant Granted Jan 06, 2026
Patent 12509701
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Dec 30, 2025
Patent 12509686
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

4-5
Expected OA Rounds
54%
Grant Probability
92%
With Interview (+38.1%)
3y 0m
Median Time to Grant
High
PTA Risk
Based on 43 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month