Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This Application claims the benefit of U.S. Provisional Application 62/814,591 filed on March 6, 2019.
Request for Continued Examination
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on September 5, 2025 has been entered.
Claim Status
Claims 1-3, 5-7, and 9-27 are currently pending. Claims 9-12 and 16-27 are withdrawn pursuant to a restriction/ election requirement. Claims 1-3, 5-7, 13-15 and 19 are currently active and subject to examination.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
“(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.”
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
“The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.”
Claims 1-3, 5-7, 13-15, and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 is directed towards a method of eradicating or eliminating a retrovirus in a subject, comprising administering to the patient a composition comprising an effective amount of an antiretroviral agent consisting of nanoformulated myristoylated dolutegravir, myristoylated lamivudine, myristoylated abacavir and myristoylated rilpivirine.
Myristoylated rilpivirine (RPV) was not described in the specification in such a way as to reasonably convey to one skill in the art that the inventor(s) at the time the application was filed, had possession of the claimed invention.
The specification describes administering a cocktail comprising “myristoylated dolutegravir (MDTG) 16.7 ng/ml, rilpivirine (RPV) 3.3 ng/ml, myristoylated lamivudine (M3TC) 32.9 pg/ml and myristoylated abacavir (MABC) 14.4 pg/ml” (Specification, p. 6, paragraph 0054). The specification describes that “Myristoylated modifications for DTG, 3TC, and ABC were made (referred to as MDTG, M3TC, and MABC) to enhance the incorporation into poloxamer 407 (P407) nanoparticles, while RPV was encased solely by poloxamer 338 (P338) in unmodified form using high pressure homogenization to form crystalline nanoformulated drugs.” (Specification, p. 11, paragraph 0222). The specification does not describe the myristoylated modification for RPV.
Myristoylated dolutegravir (MDTG), myristoylated avacavir (MABC) and myristoylated lamivudine (M3TC) are well known in the art, and are formed by myristoylation of a reactive hydroxyl group on these compounds:
PNG
media_image1.png
165
752
media_image1.png
Greyscale
Figure 1. Synthesis and characterization of MABC. (Singh et al. (Nanomedicine (Lond.) (2016) 11(15), p. 1913–1927));
PNG
media_image2.png
263
574
media_image2.png
Greyscale
FIGURE 1. Scheme for the generation of myristoylated 3TC. (Guo et al. (J Acquir Immune Defic Syndr, Volume 74, Number 3, March 1, 2017, p. e75-e83));
PNG
media_image3.png
212
504
media_image3.png
Greyscale
Fig. 1 Synthesis and characterization of MDTG. (Sillman et al. (NATURE COMMUNICATIONS (2018) 9:443, Feb. 6, 2018, p. 1-14).
The specification also describes that myristoylation occurs by esterification:
LASER ART facilitates sustained inhibition of viral replication by long-acting hydrophobic lipophilic anti-retroviral nanoparticles. To accomplish this goal, fatty-acid-modified prodrugs were synthesized as prodrugs for dolutegravir (DTG), lamivudine (3TC) and abacavir (ABC) by esterification with myristic acid.
Instant specification, p. 11, paragraph 0221.
Unlike abacavir, lamivudine and dolutegravir, rilpivirine (RPV) lacks a hydroxyl group to be readily myristoylated:
PNG
media_image4.png
116
294
media_image4.png
Greyscale
(Sanford (Drugs, 2012; 72 (4): 525-541)). RPV could not be myristoylated by an esterification reaction like the other three compounds. It is known to encapsulate RPV in poloxamer 338 as in the instant invention:
Long-acting parenteral formulations of antiretrovirals could facilitate maintenance and prophylactic treatment in HIV. Using the poorly water- and oil-soluble non-nucleoside reverse transcriptase inhibitor (NNRTI) TMC278 (rilpivirine) as base or hydrochloride (HCl), nanosuspensions were prepared by wet milling (Elan NanoCrystal technology) in an aqueous carrier… In mice, the pharmacokinetic profiles after a single 20 mg/kg dose (200 nm) were similar with two different surfactants used (poloxamer 338, or D-alpha-tocopheryl polyethylene glycol 1000 succinate). In conclusion, this study provides proof-of-concept that 200-nm sized TMC278 nanosuspensions may act as long-acting injectable.
Baert et al. (European Journal of Pharmaceutics and Biopharmaceutics, 72 (2009) 502–508).
However, the prior art does not describe a lipid modified RPV. One of ordinary skill in the art would not be able to predict with a reasonable degree of confidence the structure of myristoylated RPV based on the applicant’s disclosure and the prior art.
Claims 2-3, 5-7, 13-15 and 19 depend from claim 1 and are therefore also rejected for lack of written description support.
Claim Rejections - 35 USC § 103- New Grounds of Rejection Necessitated by Amendment
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
“A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.”
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-3, 5-7, 13-15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Bella (Universita Degli Studi di Milano, Scuola Dottorato in Medicine Molecolare E Traslazionale, Anno Accademico 2017, pages 1-154, Published January 31, 2018) in view of Edagwa (EXPERT OPINION ON DRUG DELIVERY, 2017, VOL. 14, NO. 11, 1281–1291).
Claim 1 was amended to recite:
A method of eradicating or eliminating a retrovirus in a subject, comprising administering to a patient a composition comprising a therapeutically effective amount of an antiretroviral agent consisting of nanoformulated myristolyated dolutegravir, myristolyated lamivudine, myristolyated abacavir and myristolyated rilpivirine and a composition comprising a therapeutically effective amount of at least one gene editing agent, wherein the at least one gene editing agent comprises:
i) an isolated nucleic acid sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated endonuclease/Cas (CRISPR/Cas),
ii) a first guide RNA (gRNA), the full length of the first gRNA being complementary to a first target sequence comprising a nucleic acid sequence GCAGAACTACACACCAGGGCCAGGAT (SEQ ID NO: 48) or reverse complement thereof within a long terminal repeat (LTR) of a retrovirus sequence; and
iii) a second gRNA, the full length of the second gRNA being complementary to a second target sequence within a GagD region of the retrovirus sequence comprising SEQ ID NO: 98,
thereby eradicating or eliminating the retrovirus in a subject.”
Bella teaches a method of eradicating or eliminating HIV in a subject, comprising administering to a patient a composition comprising a therapeutically effective amount of a cocktail of antiretroviral drugs such as rilpivirine, myristolyated dolutegravir, lamivudine and abacavir, followed by AAV9-CRISPR-Cas9 comprising gRNAs to LTR1 and GagD:
“Nod/Cg-Prkdcscid II2rgtm1wjI/SzJ (NSG) mice were used for study the ability of AAV9SaCas9LTR1GagD to induce gene editing in humanized animal model. The experiments on humanized mice were performed by collaborators from the University of Nebraska Medical Center. Briefly 104 human peripheral blood lymphocytes (PBLs) were injected by intrahepatic injection for each newborn mouse, previously irradiated with C9cobalt60. 18 weeks old mice were infected with HIV-1NL4-3 (105 tissue culture infective dose 50/ml); of the following mice, 5 received no antiretroviral treatment and one injection of AAV9 construct, and 13 were treated with a long acting slow effective release ART therapy (LASER ART) using 40-45 mg of a cocktail of antiretroviral drugs such as rilpivirine, myristolyated dolutegravir, lamivudine and abacavir. After 6 weeks of ART therapy the animals under retroviral drugs were successively divided in non Cas9 treatment (4 mice) and Cas9 treated (9 mice). Five control mock animals were used as negative control. Tissues were harvested after 5 weeks from CRISPR treatment in absence of antiretroviral treatment.”
Bella, Appendix F, page 150.
The claimed target sequence is SEQ ID 48 (GCAGAACTACACACCAGGGCCAGGGAT). Bella teaches the claimed target sequence (in green and red) as part of AAV9SaCas9LTR1GagD on page 91 (Figure 43):
“Nod/Cg-Prkdcscid II2rgtm1wjI/SzJ (NSG) mice were used to test the ability of the AAV9SaCas9LTR1GagD construct to induce gene editing in a humanized animal model. After the injection of human peripheral blood lymphocytes (PBLs) into the mice, they were infected with HIV-1NL4-3 and then were divided in three groups, 5 mice received no antiretroviral treatment and one injection of AAV9 construct and 13 were treated with LASER ART therapy. The 13 mice were then divided into a non-treatment group (4 mice) and a Cas9-treated group (9 mice). Tissues were harvested after 5 weeks of CRISPR treatment. Specific PCRs were performed to amplify 5’ LTR GagD, GagD 3’LTR and 5’LTR-3’LTR regions of HIV-1 genome (figure 40) on spleen, GALT, kidney, lung, liver and brain tissue to investigate the ability of CRISPR/Cas9 to induce double stranded breaks in the viral DNA as illustrated in figure 40. Excision between 5’LTR and GagD results in the editing of 798 bp fragment and the generation of a truncated/end joined fragment of 193 bp. Excision between GagD and 3’LTR results in the editing of 8.097 bp fragment and the generation of a truncated/end joined fragment of 523 bp. Excision between 5’LTR and 3’LTR consists in the editing of 9.074 bp fragment and the generation of a truncated/end joined fragment of 396 bp... PCR performed on tissues of lung, liver and brain of mice AAV9-CRISPR/Cas9 treated and LASER ART/AAV9 CRISPR/Cas9 treated detected the presence of amplicons of 193 and 523 bps resulting from excision between the 5’LTR and GagD and GagD and the 3’LTR. (Figure 42).
The specificity of each truncated/end-joined fragment revealed in these PCRs was gel purified, cloned in TA vector and analyzed using Sanger sequencing that revealed the presence of indel mutations, deletions and insertion, which was CRISPR Cas9 related. In figure 43 sequences obtained from the analysis of the truncated/end joined viral DNA resulting from the excision between 5’LTR/GagD and GagD/3’LTR of spleen, GALT and kidney tissues showed the presence of indel mutations, deletions and insertion CRISPR/Cas9 related.”
Bella, pages 88, 90-91 (emphasis added);
PNG
media_image5.png
40
348
media_image5.png
Greyscale
Bella, page 91, Figure 43;
“Pam Sequences are in red, gRNA sequences are in green”
Bella, page 92, Figure 43 legend.
Bella teaches the gRNA sequence as in seq ID 98: ggatagatgt aaaagacacc aaggaag, which is gRNA Gag D:
PNG
media_image6.png
419
954
media_image6.png
Greyscale
Bella, p. 149.
Bella teaches a LASER ART cocktail of antiretroviral drugs such as rilpivirine, myristoylated dolutegravir, lamivudine and abacavir, while the instant claim recites a cocktail consisting of nanoformulated myristolyated dolutegravir, myristolyated lamivudine, myristolyated abacavir and myristolyated rilpivirine. The claim is interpreted to mean nanoformulated rilpivirine because the inventor does not describe administering a cocktail comprising myristolyated rilpivirine as explained in the 35 U.S.C. 112(a) rejection above.
While it is unclear if Bella intends to indicate that lamivudine and abacavir are also myristoylated like dolutegravir, one of ordinary skill in the art would have a reasonable expectation of success to administer a cocktail constating of nanoformulated myristolyated dolutegravir, myristolyated lamivudine (M3TC), myristolyated abacavir (MABC) and nanoformulated rilpivirine because such LASER ART antivirals are commonly known in the art.
For example, Edwaga teaches nanoformulated M3TC, MABC and RPV for LASER ART:
Introduction: Advances in long-acting antiretroviral therapy (ART) can revolutionize current HIV/AIDStreatments. We coined the term ‘long-acting slow effective release ART’ (LASER ART) to highlight the required formulation properties of slow drug dissolution, poor water-solubility, bioavailability, little-to-no off-target toxicities and improved regimen adherence. Drug carrier technologies characterized by high antiretroviral drug (ARV) payloads in a single carrier improve the pharmacokinetic and pharmacodynamic profiles. The surface modifications of ARV carriers target monocyte-macrophages and facilitate drug transport across physiological barriers and to virus-susceptible CD4 + T cells
Areas covered: The review highlights developments of reservoir-targeted LASER ART for improved therapeutic outcomes. Such nanoART delivery platforms include decorated multifunctional nano- and micro- particles, prodrugs and polymer conjugates. Therapeutic strategies such as gene-editing technologies boost ART effectiveness.
Edagwa, Abstract.
To overcome limitations of short-acting NRTIs, our laboratory recently developed slow-release products of 3TC (NM3TC) and abacavir (ABC; NMABC) extending their half-lives from hours to weeks [29,57]. Myristoylated prodrugs of 3TC (M3TC) and ABC (MABC) were produced then encapsulated into poloxamer 407 excipients. Both nontargeted and FA-modified poloxamer nano-formulations of MABC and M3TC were manufactured by high-pressure homogenization to generate particles that were characterized by stable physical properties. The prodrug nanosuspensions were then tested to assess uptake and retention of MABC and M3TC particles in macrophages. An up to 2.5-fold increase was observed in ABC uptake of FA decorated nanoformulated MABC (FA-NMABC) when compared to replicate undecorated formulation. Blocking the FA receptor decreased FA-NMABC uptake. Increased MABC retention in macrophages over 15 days was seen for FA-NMABC. Similarly, uptake of FA-NM3TC increased over 24 h. This mirrored improved antiretroviral efficacy of the nanoformulated drugs. FA-NMABC and NM3TC suppressed RT activity for up to 15 days. To determine whether improved hydrophobicity and encapsulation of MABC and M3TC into nanoformulations would translate into sustained plasma drug levels in vivo, mice were treated IM with native drugs or nanoformulated prodrugs (equivalent to 50 mg/kgactive drug). Mice were maintained on folate-deficient dietprior to drug administration to reduce circulating folate levels. Blood levels of ABC were detectable over 14 days following treatment with nanoformulated MABC. Similarly, 3TC levels were detectable over 10 days following treatment with nanoformulated M3TC. At day 14, the plasma 3TC level for FA-NM3TCwas 22.7 ± 12.5 ng/mL and that of NM3TC was at the limit of quantitation. Similarly, 3TC levels in the liver, spleen and lymph nodes were greater than twofold higher for the FA-NM3TC-trea-ted group compared to the NM3TC group. These exciting results demonstrate that short-acting drugs can be converted into slow-release products and packaged into macrophages to improve bioavailability and PK of the parent drugs. Such delivery systems bring the drugs to sites of active viral replication and therefore hold great potential for clinical application.
Edagwa, col. 1-2, p. 1285 (emphasis added).
Others assessed the PK, safety, and tolerability profiles of TMC278 LA following single IM doses of 300–1200 mg in HIV seronegative volunteers [42]. Rilpivirine concentrations in plasma, cervicovaginal fluid, rectal fluid and tissues from female genital tract and male rectum were measured over84 days after drug treatment. Results from this study demonstrated that higher doses of nanoformulated rilpivirine provide sustained release and enhanced fluid and tissue biodistribution of the drug for up to 84 days. Higher rilpivirine concentrations corresponded to enhanced ex vivo inhibition of the virus replication in infected cervicogenital tissues from participants. These encouraging clinical findings suggest that long-acting ARVs could improve efficacy and adherence to PrEP treatments.
Edagwa, col. 2, p. 1284 (emphasis added).
Therefore, claim 1 was prima facie obvious at the time of filing.
Claim 2 recites: “The method of claim 1, wherein the antiretroviral agent is formulated as a long- acting slow effective release (LASER) antiretroviral agent.” As shown above, Bella teaches that the HIV infected mice were treated with LASER ART (Bella, Appendix F, page 150).
Therefore, claim 2 was prima facie obvious at the time of filing.
Claim 3 recites: “The method of claim 2, wherein the at least one antiretroviral agent is nanoformulated.”
The specification states: “the nanoformulated antiretroviral agent comprises: myristolyated dolutegravir, lamivudine, abacavir, rilpivirine or combinations thereof.” As shown above, Bella teaches a nanoformulated antiretroviral agent comprising rilpivirine, myristolyated dolutegravir, lamivudine and abacavir (Bella, Appendix F, page 150).
Therefore, claim 3 was prima facie obvious at the time of filing.
Claim 5 is directed towards: “The method of claim 1, wherein the at least one antiretroviral agent is administered to the subject prior to administering the at least one gene editing agent.”
Bella teaches administering LASER ART prior to the AAV9-CRISPR-Cas9:
PNG
media_image7.png
244
531
media_image7.png
Greyscale
Bella, Figure 54, page 150.
Therefore, claim 5 is anticipated.
Claim 6 is directed towards: “The method of claim 1, wherein the at least one antiretroviral agent and at least one gene-editing agent are co-administered.”
As shown above, Bella teaches the administration of at least one antiretroviral agent and at least one gene-editing agent. While Bella teaches the sequential administration of these agents, optimizing the timing of the administration of two synergistic therapeutic agents would be an obvious routine optimization to an ordinary artisan. It would be obvious to try a simultaneous rather than sequential administration of these agents.
Therefore, claim 6 was prima facie obvious at the time of filing.
Claim 7 is directed towards: “The method of claim 1, wherein the at least one antiretroviral agent and at least one gene-editing agent are administered sequentially.” As shown above in Figure 54, Bella teaches administering LASER ART before the AAV9-CRISPR-Cas9.
Therefore, claim 7 was prima facie obvious at the time of filing.
Claim 13 recites: “The method of claim 1, wherein the retrovirus is a human immunodeficiency virus (HIV).” As shown above, Bella teaches the treatment of HIV-1 with LASER ART and AAV9-CRISPR-Cas9 (Bella, Appendix F, page 150).
Therefore, claim 13 was prima facie obvious at the time of filing.
Claim 14 is directed towards:
“The method of claim 13, wherein the target sequences comprise one or more nucleic acid sequences in HIV comprising: long terminal repeat (LTR) nucleic acid sequences, nucleic acid sequences encoding structural proteins, non-structural proteins or combinations thereof.”
Bella teaches an AAV9-CRISPR-Cas9 encoding LTR1 and GagD:
“Following in vitro studies, a construct was created to allow the delivery of the Cas9 system in vivo using an innovative AAV9 delivery system. AAV9 requires the use of a smaller Cas9, saCas9, which is 1kb shorter than spCas9. The gRNAs LTR1 and GagD were introduced in the same construct of SaCas9 under the control of two separate U6 promoters.”
Bella, Section 4.15, page 83.
Therefore, claim 14 was prima facie obvious at the time of filing..
Claim 15 recites:
“The method of claim 14, wherein the sequences encoding structural proteins comprise nucleic acid sequences encoding: Gag, Gag-Pol precursor, Pro (protease), Reverse Transcriptase (RT), integrase (In), Env or combinations thereof.”
Claim 15.
As shown above, Bella teaches that the sequences encoding structural proteins comprise nucleic acid sequences encoding Gag.
Therefore, claim 15 was prima facie obvious at the time of filing.
Claim 19 is directed towards: “The method of claim 1, wherein the gRNA comprises at least one nucleic acid sequence comprising SEQ ID NOs: 48-137, 145-150 or combinations of gRNAs.” As shown above, Bella teaches a gRNA comprising e.g. SEQ ID NO 48 as a part of the AAV-CRISPR-Cas9. In combination with a gRNA with a sequence as in SEQ ID NO 48, Bella also teaches e.g. SEQ ID 98
PNG
media_image8.png
35
85
media_image8.png
Greyscale
(Instant Application, SEQ ID 98) as a part of the AAV-CRISPR-Cas9:
PNG
media_image9.png
48
348
media_image9.png
Greyscale
Bella, Figure 43, page 91;
PNG
media_image6.png
419
954
media_image6.png
Greyscale
Bella, p. 149.
Therefore, claim 19 was prima facie obvious at the time of filing.
In light of the above teachings, the invention as a whole was prima facie obvious at the time of filing.
Double Patenting- Previously Presented
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
The rejection of claims 1-3, 5-7, 13-15 and 19 on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 3-7 of copending Application No. 16/605,922 is maintained.
The rejection of claim 4 is withdrawn as moot because claim 4 was cancelled.
Claims 1-7, 13-15 and 19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 3-7 of copending Application No. 16/605,922. While the claims at issue are not identical, they are not patentably distinct from each other because both applications are directed towards a method of treating a retrovirus in a subject with a LASER antiretroviral agent and a gene-editing agent comprising a CRISPR/Cas9 guide RNA directed towards LTR and Gag, comprising a target sequence of GCAGAACTACACACCAGGGCCAGGGAT (instant SEQ ID NO 48, Application No. 16/605,922 SEQ ID 303).
Both applications claim an antiretroviral agent that is :
nanoformulated (instant claim 3, copending claim 2);
LASER (instant claims 1 and 2; copending claim 1);
comprises myristolyated dolutegravir, lamivudine, abacavir, rilpivirine or combinations thereof (instant claim 1; copending claim 4);
administered to the subject prior to administering the at least one gene editing agent (instant claim 5; copending claim 5)
coadministered with the gene-editing agent (instant claim 6; copending claim 6)
administered sequentially with the gene editing agent (instant claim 7; copending claim 7).
Claim 13 is directed towards treating a retrovirus that is HIV. In copending claim 1, the gRNAs target HIV, and thus claim 13 is obvious over claim 1. Claim 14 is directed towards target sequences in HIV comprising LTR nucleic acid sequences, nucleic acid sequences encoding structural proteins, non-structural proteins or combinations thereof. In copending claim 1, the gRNAs target nucleic acid sequences within an LTR of HIV and the nucleic acid within the Gag region of the HIV virus (encoding a structural protein), and thus claim 14 is obvious over copending claim 1. Claim 15 is directed towards the method of claim 14, wherein the sequences encoding the structural proteins include Gag, which is taught by copending claim 1.
Therefore, claims 1-7 and 13-15 of the instant are obvious over claims 1 and 3-7 of the copending application.
This is a provisional nonstatutory double patenting rejection.
Claim 19 is rejected on the on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 16/605,922.
Claim 19 is directed towards: “The method of claim 1, wherein the gRNA comprises at least one nucleic acid sequence comprising SEQ ID NOs: 48-137, 145-150 or combinations of gRNAs.” Copending claim 1 teaches gRNAs comprising SEQ ID NO: 304, which is identical to instantly claimed SEQ ID 98:
PNG
media_image8.png
35
85
media_image8.png
Greyscale
Instant Application
PNG
media_image10.png
45
217
media_image10.png
Greyscale
Application No. 16/605,922
Therefore, instant claim 19 is obvious over copending claim 1.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claim is found to be allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to HEATHER DAHLIN whose telephone number is (571)270-0436. The examiner can normally be reached 9-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jeffrey Lundgren can be reached on (571) 272-5541. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 86-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/HEATHER DAHLIN/Examiner, Art Unit 1629
/JEFFREY S LUNDGREN/Supervisory Patent Examiner, Art Unit 1629