DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 6/3/26 has been entered.
Election/Restrictions
Applicant’s election without traverse of invention I and the required species in the reply filed on 8/18/2023 and 4/18/2024 is acknowledged.
Claims 13-19 and 21 are drawn to non-elected species and therefore are withdrawn.
Claims 1, 3-8, 11-12, 20 and 22-25 are examined on the merits. Claims 24-25 are newly presented.
Claim Objections
(Prior Objection withdrawn) Claim 6 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-8, 11-12, 20 and 22-25 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The following quotation from section 2163 of the Manual of Patent Examination Procedure is a brief discussion of what is required in a specification to satisfy the 35 U.S.C. 112 written description requirements for a generic claim covering several distinct inventions:
The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice .... reduction to drawings .... or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus... See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.
Thus, when a claim covers a genus of inventions, the specification must provide written description support for the entire scope of the genus. Support for a genus is generally found where the applicant has provided a number of examples sufficient so that one in the art would recognize from the specification the scope of what is being claimed.
Claims 1, 3-8, 11-12, 20 and 22-25 are rejected as lacking adequate descriptive support for a method of detecting one or more copies of a target nucleic acid by contacting a sample with a probe that is labeled with a detectable fluorescent dye and is adapted to hybridize with the target nucleic acid.
Applicants have disclosed one probe sequence in working example 1 that is SEQ ID NO: 1.
In support of the claimed genus (a method of detecting a target nucleic acid with a generic probe that is adapted to hybridize with the target nucleic acid), the application discloses one example in which SEQ ID NO: 1 is testing for hybridizing with a coronavirus sequence. No derivatives or variants or mutants thereof are disclosed of a probe that can achieve this hybridization of a target nucleic acid sequence. Thus, the application fails to provide examples of a representative number of species within the claimed genus.
Further, while the claims provide both a structure and a function, the application fails to draw any correlation between the two. I.e., a generic probe would be capable of hybridizing with a generic target nucleic acid sequence in order to detect the target nucleic acid sequence Moreover, no correlation has been made to which nucleotide sequence the probe must possess in order to achieve the claimed hybridizing with a target nucleic acid sequence.
The teachings of the art also fail to indicate that, without such evidence, those in the art would have expected the full scope of the claimed method of detecting a target nucleic acid would be achieved with a probe adapted to hybrize with the target nucleic acid.
For example, a search of the art indicates specified probe sequences are important for detecting target nucleic acid sequences (see Rosencrantz et al. (PLOS One, 20204). Rosencrantz et al. teach that probes (molecular beacons) are more specific than conventional linear probes and can distinguish between perfectly complementary targets and those with a single-nucleotide mismatch. [see page 1, 2nd paragraph] Rosencrantz et al. further teach the molecular beacon “used in the experiments, comprises a 23-nt probe flanked by 6-bp tails (bold) to form a duplex stem 5 0 CGCGAT TAGAGTTCCTGATCTTCTGGTCT ATCGCG-3’,labeled at the 5’ end with rhodamine 6G and at the 3’ end with the quencher BMN-Q620. Two complementary target strands were prepared, one of which was a perfect match (PM) for the probe 5 0 AGATCAGGAACTCTA ATCGCG-3 0-CGCGAT AGACCAGA whereas the other contained a mismatching (MM), central nucleotide (bold underlined), 5’-CGCGAT AGACCAGAAAATCAGGAACTCTA ATCGCG-3’” [see first paragraph of Materials and methods].
In view of this uncertainty and the lack of any examples of the claimed genus, the claims are rejected for lack of adequate written description support.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(Prior Rejection Withdrawn in response to claim amendments)
Claims 3, 4 and 22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 3, 4, and 22 depend from cancelled claim 2, therefore, it is unclear which claims the limitations of 3, 4 and 22 are attempting to further limit.
(new rejection) Claims 1, 3-8, 11-12, 20 and 22-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 6 and 24 recite, “wherein the probe is labeled…and adapted to hybridize with the target nucleic acid”, however, the claims not the specification indicated what the metes and bounds are of “adapted to hybrize to the target nucleic acid”. Is the hybrization to a single nucleotide, two consecutive nucleotides or a more specific motif. Furthermore, the probe is not defined by a specific structure, such as a nucleic acid sequence and the specification only provides one nucleic acid sequence representative of a probe (SEQ ID NO: 1). Claims 3-5, 7, 8, 11-12, 20 and 22-24 are also rejected because they depend from claims 1 or 24, but do not remedy this deficiency.
(new rejection necessitated by amendments) Claims 24-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 24 recites the limitation "capsid" in line 20. There is insufficient antecedent basis for this limitation in the claim. Claim 25 is also rejected because it depends from claim 24, but does not remedy this deficiency.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
(Prior Rejection withdrawn in view of Amendments) Claims 3, 4 and 22 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claims 3, 4, and 22 depend from claim 2, but claim 2 has been cancelled by applicant. Therefore, claims 3, 4 and 22 do not further limit claim 2. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(Prior Rejection Withdrawn) Claim(s) 1, 5, 7, 8, 11, 12, 20 and 23 are rejected under 35 U.S.C. 102a1 as being anticipated by Mir (US PGPub 2005/0244863).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
New rejection Claim(s) 1, 3-5, 7, 8, 11, 12, 20 and 22-24 are rejected under 35 U.S.C. 103 as being unpatentable over Mir (US PGPub 2005/0244863) in view of Kleine-Bruggeney et al. (US PGPub 2020/0282397).
Mir teach the development of a nucleic acid detection method that utilizes probes for detecting individual (single) nucleic sequences present in a sample, which would be able to detect less than 10 target nucleic acids. [see paragraphs 87-93, 316-319, 322, 325, and 425] The detection method does not rely on amplification. The probes can be a molecular beacon and the solid support can be a polymer, such as a gel. [see paragraph 74] The detection can take place with the probe immobilized on a solid support and the probe hybridizes with complementary nucleic acid sequences present in the sample. The amount of probe or oligonucleotide to be used can be at a concentration of 5-10 pmol. [see paragraph 782] Laser beams can be used to excite a fluorescent dye on the probe and the detection would involve a light source, detector and computer/microprocessor that is configured to receive information from the detector to determine if the amount of light is indicative of a hybridization event. [see paragraphs 225, 328, 330, and 1021] Mir also teach that a beam splitting apparatus can be employed [see paragraph 1039] and light detected through a fiber optic can be employed. [see paragraphs 75, 93, 203 and 276] The method would employ an element capable of focusing light towards the solid support (carrier element) and a beam for collecting light from a carrier element and the use of glass slides or coverslips in facilitating fluorescence signal transmission. [see paragraphs 337, 347-351, 353, 1020-1023 and 1042]
However, Mir et al. do not specifically teach the use of a liquid swelling polymer, such as a hydrogel or that the carrier element contains at least 20 nmol/l or at least 2.05umol/l of the probe.
Kleine-Bruggeney et al. teach immobilizing probes in hydrogel matrices. [see paragraph 262] Kleine-Bruggeney et al. also teach hydrogel matrices, in particular having a spherical shape. Said hydrogel matrices may contain single or multiple cells that may be of the type described previously but are not so limited. In particular, said hydrogel matrices may contain paired single cells of the same or of different type. In another embodiment, hydrogel matrices may contain biological compounds, in particular proteins, in particular antibodies, antibody-DNA conjugates, extracellular matrix proteins, growth factors, nucleic acids, in particular DNA, RNA, PNA, LNA, lipids, cytokines, chemokines, aptamers as well as metabolic compounds, chemical compounds, in particular small molecules, in particular drugs, molecules linked via photocleavable spacer/linker, nanostructures, in particular gold nanoparticles, growth promoting substance, inorganic substances, isotopes, chemical elements. [see paragraph 804]
It would have been obvious to one of ordinary skill in the art to modify the methods taught by Mir et al. in order to employ an immobilizing agent for a probe, such as the liquid swelling polymer of hydrogel. One would have been motivated to do so, given the suggestion by Mir et al. that gels or a polymer can be employed for their probe/molecular beacon immobilization. There would have been a reasonable expectation of success, given the knowledge that probes can also be immobilized on hydrogel supports, as taught by Kleine-Bruggeney et al. Furthermore, MPEP § 2144.05 (II) (A) states, “…Optimization Within Prior Art Conditions or Through Routine Experimentation…“[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to dis-cover the optimum or workable ranges by routine experimentation…”, therefore, one of ordinary skill in the art would employ at least one probe in the amount of at least 20nmol/l or at least 2.5 umol/l of the probe. Thus the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art at the time the invention was made.
Response to arguments:
Applicant’s arguments have been fully considered, but they are not persuasive for the following reasons:
Presently the claimed invention rejected requires the use of a liquid swelling polymer for immobilizing a probe that is used to detect nucleic acid sequences. Mir et al. teach that a gel can be use used as a solid support and that probes can be immobilized on solid supports. [see paragraphs 74 and 425] The newly cited teachings by Kleine-Bruggeney et al. further support the use of hydrogels as a solid support for probe immobilization. While applicants state that their polymer would have a benefit as being able to fit more probe on the 3 dimensional surface, the claims do not require that the polymer is 3 dimensional (such as a particle). In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., spacer molecule) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Lastly, any unexpected benefits or properties of using the claimed polymer are not commensurate in scope since the claims do not require the use of a spacer.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to BENJAMIN P BLUMEL whose telephone number is (571)272-4960. The examiner can normally be reached M-F 8-5 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached on (571) 270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BENJAMIN P BLUMEL/Primary Examiner, Art Unit 1671
