Prosecution Insights
Last updated: October 04, 2026
Application No. 16/899,302

CPF1-RELATED METHODS AND COMPOSITIONS FOR GENE EDITING

Non-Final OA §102§103§112
Filed
Jun 11, 2020
Priority
Dec 11, 2017 — provisional 62/597,118 +5 more
Examiner
WESTON, ALYSSA G
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Editas Medicine Inc.
OA Round
6 (Non-Final)
60%
Grant Probability
Moderate
6-7
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 60% of resolved cases
60%
Career Allowance Rate
67 granted / 112 resolved
At TC average
Strong +51% interview lift
Without
With
+50.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
52 currently pending
Career history
176
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
33.9%
-6.1% vs TC avg
§102
30.3%
-9.7% vs TC avg
§112
23.3%
-16.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 112 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 10 April 2026 has been entered. Status of the Claims Applicant’s submission filed 10 April 2026 has been entered. Claims 35, 37-41, 43-51, and 55-58 are pending. Claims 35 and 55 have been amended. Therefore, prosecution on the merits continues for claims 35, 37-38, 41, 43-51, and 55-58 as being drawn to the elected invention and species of cargo, with claims 39-40 withdrawn for reading on the non-elected species. All arguments have been fully considered with the status of each prior ground of rejection set forth below. Priority The instant application is a continuation of International Patent Application No. PCT/US2018/065032, filed 11 December 2018. Acknowledgment is made of Applicant’s claim for benefit under 119(e) to US Provisional Application No. 62/597118, filed 11 December 2017, US Provisional Application No. 62/623501, filed 29 January 2018, US Provisional Application No. 62/664905, filed 30 April 2018, and US Provisional Application No. 62/746494, filed 16 October 2018. However, as aforementioned, with Applicant’s amendment to independents claim 35 and 55 requiring the DNA donor template to comprise two stuffer sequences, the effective filing date of the entire invention as instantly claimed is 11 December 2018. This is due to the fact that the cited provisional applications fail to disclose stuffer sequences or any accompanying sequence identifiers, as the first recitation of such is in International Patent Application No. PCT/US2018/065032. Status of Prior Rejections/Response to Arguments RE: Rejection of claims 35, 37-38, 41, 43-44, 47-51, 56, and 58 under 35 USC 103 over Zhang et al in view of DeKelver et al and Engler et al Applicant’s amendment to independent claim 35 requiring the first stuffer sequence and/or the second stuffer sequence to comprise from 45% to 75% GC content obviates the rejection of record. Therefore, the rejection is withdrawn. RE: Rejection of claims 35, 37-38, 41, 43-51, 56, and 58 under 35 USC 103 over Zhang ’308 in view of DeKelver et al and Engler et al, and further in view of Zhang ‘768 Applicant’s amendment to independent claim 35 requiring the first stuffer sequence and/or the second stuffer sequence to comprise from 45% to 75% GC content obviates the rejection of record. Therefore, the rejection is withdrawn. RE: Rejection of claims 35, 37-38, 41, 43-44, 47-51, and 57-58 under 35 USC 103 over Zhang et al in view of Morsy et al Applicant’s amendment to independent claim 35 requiring the first stuffer sequence and/or the second stuffer sequence to comprise from 45% to 75% GC content obviates the rejection of record. Therefore, the rejection is withdrawn. New Grounds of Rejection Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 57 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 57: The instant claim recites the limitation "the target cell" in Line 3. There is insufficient antecedent basis for this limitation in the claim, as there is no prior recitation of a target cell within the instant claim or parent claim 35. Therefore, the metes and bounds of the claim cannot be determined, thus rendering the scope of the claim indefinite. See MPEP § 2173.05(e). Appropriate correction is required. It is of note that the recitation of “the genome” is accepted, as it is an inherent component of a recited element, which in the instant case is the “target cell”. See MPEP § 2173.05(e). Claims 35, 37-38, 41, 43-44, 47-51, and 56-58 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (WO 2017/189308 A1, of record) in view of Bett et al (US 7132277 B1). Zhang et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2). Bett et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2). Regarding claim 35: Zhang et al disclose non-naturally occurring or engineered DNA or RNA-targeting systems comprising a novel DNA or RNA-targeting CRISPR effector protein and at least one targeting nucleic acid component (Abstract). As such, Zhang et al disclose an engineered CRISPR-Cas complex composition comprising guide RNA (gRNA) and a Cpf1 enzyme (Paragraph [00257]). Zhang et al further disclose that the gRNA and Cpf1 molecules are used in conjunction with a template nucleic acid to alter the structure of a target position (Paragraph [00435]). Zhang et al elaborate that the template nucleic acid comprises the following components: [5' homology arm]-[replacement sequence]-[3' homology arm]. The homology arms provide for recombination into the chromosome, thus replacing the undesired element, e.g., a mutation, with the replacement sequence (Paragraph [00441]). Zhang et al further disclose that the engineered CRISPR-Cas complex composition is applicable in cancer immunotherapy, wherein a TRAC target nucleic acid sequence is utilized, and may be delivered to a subject via viral vectors, including adenoviral or AAV vectors (Paragraphs [00202], [00317], [00454], [001245]). Zhang et al do not disclose template nucleic acid further comprising two stuffer sequences, wherein the template nucleic acid comprises from 5’ to 3’: [5' homology arm]-[first stuffer]- [replacement sequence]-[second stuffer]-[3' homology arm], as required by instant claim 35. Bett et al, however, disclose stuffer sequences that have a GC content of about 50% to about 60% operably linked to a heterologous expression cassette within an adenoviral vector, wherein the stuffer sequences flank the heterologous expression cassette (Abstract; Columns 1-5, 9-10, 16-17; Figures 1, 4). Therefore, it would have been prima facie obvious to have modified the template nucleic acid of Zhang et al to further comprise the stuffer sequences as detailed in Bett et al. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to include these stuffer sequences having a GC content of about 50% to about 60%, as they are non-expressible DNA sequences that are inserted into the adenoviral vector to increase the size of the virus to allow for efficient packaging and an increased yield due to the GC content being close to that of wild-type adenovirus (Bett et al: Columns 4, 9-10), and would have had a reasonable expectation of success since the disclosures of both Zhang et al (Paragraphs [00435], [00615], [001245]) and Bett et al (Columns 3-4, 6, 9-10) are concerned with the packaging of an adenoviral vector with at least a donor expression cassette. See MPEP § 2143(I)(G) and 2131.03. Consequently, Zhang et al as modified by Bett et al render obvious a CRISPR-Cas complex composition, wherein the CRISPR-Cas complex composition comprises a gRNA molecule targeting TRAC, a Cpf1 nuclease, and a DNA donor template having a 5’ homology arm and 3’ homology arm that is homologous to the regions of TRAC upstream and downstream, respectively, of the cargo replacement sequence and further comprises further comprises two stuffer sequences immediately flanking the cargo replacement sequence. As the stuffer sequences have a GC content of about 50% to about 60%, this therefore renders obvious the genome editing system of the instant claim. Regarding claims 37-38: Following the discussion of claim 35, Zhang et al further discloses that the 5’ (claim 37) and 3’ (claim 38) homology arms can each respectively extend at least 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1,000 nucleotides in length (Paragraphs [00433], [00441]). This therefore renders obvious the genome editing system of the instant claims, as the nucleotide lengths lie within the ranges listed by Applicant and a prima facie case of obviousness exists in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art". In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990); In re Geisler, 116 F.3d 1465, 1469-71, 43 USPQ2d 1362, 1365-66 (Fed. Cir. 1997). See MPEP § 2144.05. Regarding claim 41: Following the discussion of claim 35, Zhang et al further disclose that, in some embodiments, the replacement sequence is an exogenous template polynucleotide that is introduced into the target (Paragraphs [00700], [00882]). As the exogenous polynucleotide sequences encode the corresponding exogenous polypeptide (Paragraph [00904]), this therefore reads on the genome editing system of the instant claim. Regarding claims 43-44: Following the discussion of claim 35, Zhang et al further disclose that at least one nuclear localization signal (NLS) is attached to the nucleic acid sequences encoding the Cpf1 effector proteins (Paragraphs [0035], [0063], [00222]). Zhang et al further disclose that non-limiting examples of NLSs include an NLS sequence derived from the NLS of the SV40 virus large T-antigen, having the amino acid sequence PKKKRKV (reference SEQ ID NO: 2, instant SEQ ID NO: 2), or the NLS from nucleoplasmin, having the amino acid sequence KRPAATKKAGQAKKKK (reference SEQ ID NO: 3, instant SEQ ID NO: 1) (claim 44) (Paragraph [00222]). As the referenced NLSs are attached to the nucleic acid sequences encoding the Cpf1 effector proteins, this indicates that NLSs are at or near the N-terminus or C-terminus of the nuclease (claim 43). This therefore reads on the genome editing system of the instant claims. Regarding claim 47: As aforementioned in the discussion of claim 35, Zhang et al disclose that the Cpf1 effector protein system is applicable for gene therapy. As such, reference is made to WO 2015/161276, which involves altering the T-cell expressed gene of TRAC (Paragraph [001245]). The incorporated reference further discloses gRNA sequences targeting TRAC, wherein SEQ ID NO: 476 (GAGUCUCUCAGCUGGUACACGG) comprises instant SEQ ID NO: 225 (GAGUCUCUCAGCUGGUACAC) – see underlined portion of reference SEQ ID NO: 476. This therefore reads on the genome editing system of the instant claim. Regarding claims 48-50: Following the discussion of claim 35, Zhang et al further disclose that, in some embodiments, the cells that are targeted for modification with the Cpf1 effector protein system (claim 48) include T cells, Natural Killer (NK) cells, cytotoxic T lymphocytes (CTL), and regulatory T cells (claims 49-50) (Paragraphs [001389], [001392]). This therefore reads on the cell of the instant claims. Regarding claim 51: As aforementioned in the discussion of claim 35, Zhang et al as modified by Bett et al render obvious a CRISPR-Cas complex composition that comprises a gRNA molecule targeting TRAC, a Cpf1 nuclease, and a DNA donor template comprising from 5’ to 3’: 5’ homology arm that is homologous to the region upstream of the TRAC target sequence, a first stuffer sequence, a cargo replacement sequence, a second stuffer sequence, and a 3’ homology arm that is homologous to the region downstream of TRAC target sequence, wherein the stuffer sequences have a GC content of about 50% to about 60%. Zhang et al further disclose methods of genome editing using the CRISPR-Cas complex composition, and that the composition is functional in eukaryotic cells for in vitro or ex vivo applications. Such eukaryotic cells include immune cells such as T cells (Paragraphs [0014], [0017], [00190], [00224], [001259]). This therefore reads on the method of the instant claim, as the CRISPR-Cas complex composition will modify the sequences associated with or at a target locus of interest – or the TRAC gene. Regarding claim 56: Following the discussion of claim 35, Zhang et al further disclose that the 5’ and 3’ homology arms can each respectively extend at least 50 nucleotides in length (Paragraphs [00433], [00441]). With that, Bett et al further disclose that the stuffer sequences have a length of at least about 1,000 bases – or nucleotides – in length (Columns 9-10). Accordingly, the sum of the 5’ homology arm and first stuffer sequence would be essentially equal to the sum of the 3’ homology arm and second stuffer sequence when considering the lower limit of the disclosed ranges. As the difference is less than 25 nucleotides in length, this therefore renders obvious the genome editing system of the instant claim for the same reasons as discussed in the rejection of instant claim 35. Regarding claim 57: As aforementioned in the discussion of claim 35, Bett et al disclose that the stuffer sequences are non-expressible nucleic acid sequences that do not comprise any genomic repeats (Columns 9-10). Therefore, it would have been prima facie obvious for the stuffer sequences to be less than 10% identical to any nucleic acid sequence of the same length within the genome of the target cell, as the ordinary artisan would have been motivated to ensure the stuffer sequences remain “silent” sequences. See MPEP § 2143(I)(G). Furthermore, the person of ordinary skill in the art before the effective filing date of the invention would have had a reasonable expectation of success since the formation of stuffer sequences is well known in the art. This therefore renders obvious the genome editing system of the instant claim. Regarding claim 58: Following the discussion of claim 35, Zhang et al further disclose that the CRISPR-Cas complex composition comprises a single template nucleic acid sequence, or DNA donor (Paragraphs [00434]-[00443]). This therefore reads on the genome editing system of the instant claim. Claims 35, 37-38, 41, 43-51, and 56-58 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (WO 2017/189308 A1, of record; hereinafter “Zhang ‘308”) in view of Bett et al (US 7132277 B1), and further in view of Zhang et al (WO 2017/184768 A1, of record; hereinafter “Zhang ‘768”). The discussion of Zhang ‘308 as modified by Bett et al regarding claim 35 can be observed above and is relied upon herein, the content of which is incorporated in its entirety. Zhang ‘308 in view of Bett et al render obvious claims 35, 37-38, 41, 43-44, 47-51, and 56-58. Zhang ‘768 is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2). Regarding claims 45-46: Following the discussion of claim 35 above, Zhang ‘308 further discloses that, in certain embodiments, the Cpf1 enzyme is modified by mutation of one or more residues in the RAD50 domain (Paragraph [00246]). Zhang ‘308 also discloses that, in certain embodiments, the modification or mutation comprises a substitution with alanine (Paragraph [00291]). The combination of Zhang ‘308 and Bett et al fail to teach a Cpf1 enzyme comprising a cysteine being substituted with a serine or alanine at positions 65, 205, 334, 379, 608, 674, or 1025, as required by instant claims 45-46. Zhang ‘768, however, discloses a mutated Cpf1 enzyme having a mutated amino acid residue at position 608, particularly C608 (Paragraph [0012]). Zhang ‘768 further discloses that, in certain embodiments, the mutation comprises substitution of a residue in the unmodified enzyme with an alanine residue (Paragraph [00253]). Therefore, it would have been prima facie obvious to have further modified the Cpf1 enzyme comprised within the CRISPR-Cas complex composition taught by Zhang ‘308 and Bett et al to comprise the C608A substitution, as detailed in Zhang ‘768. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to include this substitution, as it allows for the tuning of the Cpf1 enzyme and corresponding interactions with the target locus or gRNA molecule, and would have had a reasonable expectation of success based on the combined disclosures of Zhang ‘308 (Paragraphs [00246], [00291]) and Zhang ‘768 (Paragraph [00253]). See MPEP § 2143(I)(G). Consequently, Zhang ‘308 as modified by Bett et al and Zhang ‘768 render obvious the modification of the C608 position within the Cpf1 enzyme (claim 45), wherein the modification comprises the C608A substitution (claim 46). This therefore renders obvious the Cpf1 RNA-guided nuclease comprised within the genome editing system of the instant claims. Allowable Subject Matter Claim 55 is allowable over the prior art. The following is a statement of reasons for the indication of allowable subject matter: Instant claim 55 requires at least one of the two stuffer sequences within the genome editing system to comprise a sequence having at least 25 nucleotides of a sequence set forth in instant SEQ ID NOs: 23-123. A search of the prior art yielded no stuffer sequence comprising at least 25 nucleotides of a sequence set forth in instant SEQ ID NOs: 23-123, which is why the limitation was previously indicated to contain allowable subject matter in the Office action dated 12 January 2026. Therefore, the instant claim is free of the art. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALYSSA G WESTON/Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Show 6 earlier events
Apr 25, 2025
Request for Continued Examination
Apr 28, 2025
Response after Non-Final Action
Jun 16, 2025
Non-Final Rejection mailed — §102, §103, §112
Oct 16, 2025
Response Filed
Jan 12, 2026
Final Rejection mailed — §102, §103, §112
Apr 10, 2026
Request for Continued Examination
Apr 14, 2026
Response after Non-Final Action
Jul 01, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735677
METHOD FOR PRODUCING ASTROCYTE-LIKE CELLS
3y 6m to grant Granted Sep 15, 2026
Patent 12723062
METHODS OF TREATING MITOCHONDRIAL DISORDERS
2y 3m to grant Granted Sep 01, 2026
Patent 12686849
COMPOSITIONS AND METHODS FOR IMPROVING EMBRYO DEVELOPMENT
2y 5m to grant Granted Jul 21, 2026
Patent 12668781
MATERIALS AND METHODS FOR THE MANUFACTURE OF PLURIPOTENT STEM CELLS
2y 2m to grant Granted Jun 30, 2026
Patent 12624338
METHOD AND DEVICE FOR TARGET CELL SEPARATION
2y 10m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

6-7
Expected OA Rounds
60%
Grant Probability
99%
With Interview (+50.9%)
3y 5m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 112 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month