CTFR 16/927,641 CTFR 82354 DETAILED ACTION Notice of Pre-AIA or AIA Status 07-03-fti AIA The present application is being examined under the pre-AIA first to invent provisions. Claim Status and Formal Matters This action is in response to papers filed 10/13/2025. Claims 23, 29-32, have been amended. 08-25-01 AIA Applicant’s election without traverse of Species I: a heterologous sulfatase defined in Claim 31 (e.g., the heterologous sulfatase motif is L(FGly)TPSR (SEQ ID NO: 62)); Species II: the heterologous sulfatase motif is positioned at a C-terminus of the polypeptide, as recited in Claim 26; Species III: the heterologous sulfatase motif is less than 12 amino acid residues, as recited in Claim 50; and Species IV: a type of polypeptide is an antibody, as recited in Claim 39 in the reply filed on 12/20/2023 is acknowledged. 08-06 AIA Claim 32-33, 35-38, 42-43, 45-49 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species , there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/20/2023 . Claims 23, 26-31, 34, 39-41, 44, and 50-56 are being examined. The previous priority objection has been withdrawn in view of the amendment. The previous new matter rejection has been withdrawn in view of the amendment . Priority The instant application was filed 07/13/2020 is a continuation of 16169292 , filed 10/24/2018, which is a continuation of 15238158 , filed 08/16/2016 , which is a continuation of 14464528 , filed 08/20/2014 , which is a continuation of 13708528 , filed 12/07/2012, which is a continuation of 13163574 , filed 06/17/2011, which is a divisional of 11857385 , filed 09/18/2007, which claims priority from provisional application 60846644 , filed 09/21/2006. Information Disclosure Statement The information disclosure statement (IDS) submitted on 10/16/2020 is being considered by the examiner. 06-49-06 AIA The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Objections 07-29-01 AIA Claim s 23, 25-31, 34, 39-41, 44, and 50-56 are objected to because of the following informalities: Claim 23 is objected to as it recites “R” but does not recite the full terminology for the acronym (or abbreviation). Claims are more concise when the first time an acronym (or abbreviation) is presented the full terminology is also presented. Finally an acronym (or abbreviation) may have alternative meanings to an artisan. Claim 28 is objected to as it recites “S, T, A, V, G, or C” but does not recite the full terminology for the acronym (or abbreviation). Claims are more concise when the first time an acronym (or abbreviation) is presented the full terminology is also presented. Finally an acronym (or abbreviation) may have alternative meanings to an artisan. Claim 29 is objected to as it recites “L, M, V, S or T” and “S, T, A, V, G or C.” but does not recite the full terminology for the acronym (or abbreviation). Claims are more concise when the first time an acronym (or abbreviation) is presented the full terminology is also presented. Finally an acronym (or abbreviation) may have alternative meanings to an artisan. Claim 30 is objected to as it recites “L, M, V, S or T.” but does not recite the full terminology for the acronym (or abbreviation). Claims are more concise when the first time an acronym (or abbreviation) is presented the full terminology is also presented. Finally an acronym (or abbreviation) may have alternative meanings to an artisan. Claim 31 is objected to as it recites “ LZ1TPSR .” but does not recite the full terminology for the acronym (or abbreviation). Claims are more concise when the first time an acronym (or abbreviation) is presented the full terminology is also presented. Finally an acronym (or abbreviation) may have alternative meanings to an artisan . Appropriate correction is required. Response to Arguments This is a new ground of objection. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Claim 31 recites, “ LZ1TPSR.” This provides an amino acid sequences that has 4 or more specific amino acids and should be identified by SEQ ID NO. Claim Rejections - 35 USC § 112 07-30-01 AIA The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 07-31-01 Claims 23, 25-31, 34, 39-41, 44, and 50-56 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claim 23 has been amended drawn to, “ X 1 Z 1 X 2 Z 2 X 3 R ; Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues; .” Thus the claims encompass any X 1 Z 1 X 2 Z 2 X 3 R of at least 6 amino acids and less than 13 amino acids encoded in any nucleic acid in any species. The claim further requires, “Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues.” This is claiming a functional outcome based on recognition of any formylglycine generating enzyme from any species. It is noted the claim does not actually require the formylglycine generating enzyme is part of the composition. Further the claim requires the 6 to 12 amino acid motifs encompassed is at a higher rate than any 13 amino acid sulfatase motif. The claims are not limited to any specific 13 amino acid sulfatase motif or any specific formylglycine converting enzyme. Thus the claims encompass enormous genus of sulfatase motif from 6 to 12 amino acids, however the claims provide only a 6 amino acid formula. The claims encompass conversion of any cysteine or serine to a formylglycine by any formylglycine generating enzyme from any species. The response asserts support for the amendment can be found in paragraphs 00009, 0018, 0022, 0025, and 0196-0200. Paragraphs 00009, 0018, 0022, 0025 generally support 6 amino acid sulfatase motif. The teachings of 0196-0200 are limited to LCTPSRGSLFTGR-Stt0 (ald ₁₃ -Stf0), a 13 amino acid sulfatase motif. The specification further teaches,, “[00194] In order to ensure efficient formation of FGly, tagged proteins were co- expressed with a prokaryotic FGE from Mycobacterium tuberculosis (Mtb) (described in the Examples below).” Thus the amendment has introduced new matter as the teachings of the specification are limited to a specific 13 amino acid sulfatase motif co-expressed in the presence of a single prokaryotic FGE from Mycobacterium tuberculosis (Mtb). Thus the amendment has introduced new matter and lacks adequate written description as the amendment encompasses any sulfatase motif of at least 13 amino acids, the presence of any formylglycine generating enzyme and a higher rate of formylglycine formation for 6-12 amino acid sulfatase motif, which the teachings of the specification are limited to a 6 amino acid sulfatase motif using a specific FGE and providing a higher rate of formylglycine production than a single 13 amino acid sulfatase motif. Response to Arguments This is a new group of rejection necessitated by amendment. 07-30-02 AIA The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 07-34-01 Claim 23, 25-31, 34, 39-41, 44, and 50-56 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 23 has been amended to recite , “:“ X 1 Z 1 X 2 Z 2 X 3 R ; Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues ;.” The recitation is confusing and unclear a claim is to a nucleic acid, which encodes a sulfatase motif. It is unclear how, “ converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues” limits the structure of the nucleic acid or the amino acid sequence encoded by the nucleic acid. Further it is unclear what is required or encompassed by “ sulfatase motif comprising at least 13 amino acid residues” as the teachings of the specification appear to provide sulfatase motifs of longer than 13 amino acids and appears to provide a single 13 amino acid sulfatase motif. Response to Arguments The previous rejections have been withdrawn. However the amendment raised new issues. Claim Rejections - 35 USC § 102 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-07-fti The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – 07-09-fti 07-09 (b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States. 07-15-fti Claim(s) 23, 25-31, 34, , and 50-56 is/are rejected under pre-AIA 35 U.S.C. 102 (b) as being anticipated by Deikers (The EMBO Journal Vol.18 No.8 pp.2084–2091, 1999) . While claim 23 has been amended to recite, “Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues” This does not specifically alter the structure of X 1 Z 1 X 2 Z 2 X 3 R or the nucleic acid encoding the required sulfatase motif. The broadest reasonable interpretation is the wherein clause provides a possible intended outcome of transcribing and translating the nucleic acid sequence in the presence of a formylglycine generating enzyme. However, the intended outcome does not limit the structure of the sulfatase motif or the nucleic acid encoding it. With regards to claim 23, Dierks teaches, “ To fuse residues 1–53 of preprolactin-V33D, encoded by pTD 1 (Dierks et al., 1997), to residues 58–200 of ASA, an oligonucleotide (AGACACAGGCACGTAGAAGTCTGTCATCCG) comprising a BsaAI site and coding for ASA-F59M residues 58–63 was added 3 of codon 53 of preprolactin. The PCR product was cloned as a HindIII–BsaAI fragment into pTD17, thereby yielding pTD48. To fuse residues 163– 229 of preprolactin to residues 58–80 of ASA, an oligonucleotide, (CTCCTGACCGGCCGG) comprising an EagI site and coding for ASA residues 76–80 was added 5 of codon 163 of pTD1. The PCR product was cloned as an EagI–EcoRI fragment into pTD48, thereby yielding pTD49. For replacing in this pTD49-encoded construct residues 58–64 of ASA by the dipeptide RM, which provides a tryptic cleavage site (R) and a residue analogous to Met64 (see above), the QuikChange method (Stratagene) was applied according to the instructions of the manufacturer; the coding sequence of the complementary primers was CCTGTTTGACCGGGCATCTAGAATGCCTGTGTCTCTGTGC. The ASA part (residues 65–80) of the resulting hybrid, encoded by pTD57, was trimmed C-terminally by adding 3 to ASA codons 73, 74 or 76 an oligonucleotide that encoded preprolactin residues 133–137 and comprised an MscI site, which allowed fusion of the respective ASA codon to preprolactin codon 133.” (2089-2090) Dierks teaches, “preprolactin hybrids from residue 80 down to residue 73 led to concomitant reduction of modification efficiency(Figure 2, hybrids 1–4). A low but significant modification was observed even when only residues 65–73 of ASA were transferred to the preprolactin context, which agrees with the earlier observation of a low-level modification of an ASA fragment terminating at position 73 (Dierks et al., 1997). Thus, the short 65–73 sequence obviously fulfills all basic requirements needed for interaction with the modifying system.” (page 2086, 1 st column , 1 st full paragraph). Thus Dierks teaches a nucleic acid encoding a sulftase motif of 8 amino acids that cloned in frame prior to preprolactin to allow transcription for the promoter of pTD1. Thus Dierks teaches a recombinant nucleic active with an aldehyde tag encoding sequence, restrictions sites and a promoter operably linked. With regards to claim 25-31 34,50-56, Dierks teaches, “To fuse residues 1–53 of preprolactin-V33D, encoded by pTD 1 (Dierks et al., 1997), to residues 58–200 of ASA, an oligonucleotide (AGACACAGGCACGTAGAAGTCTGTCATCCG) comprising a BsaAI site and coding for ASA-F59M residues 58–63 was added 3 of codon 53 of preprolactin. The PCR product was cloned as a HindIII–BsaAI fragment into pTD17, thereby yielding pTD48. To fuse residues 163– 229 of preprolactin to residues 58–80 of ASA, an oligonucleotide, (CTCCTGACCGGCCGG) comprising an EagI site and coding for ASA residues 76–80 was added 5 of codon 163 of pTD1. The PCR product was cloned as an EagI–EcoRI fragment into pTD48, thereby yielding pTD49. For replacing in this pTD49-encoded construct residues 58–64 of ASA by the dipeptide RM, which provides a tryptic cleavage site (R) and a residue analogous to Met64 (see above), the QuikChange method (Stratagene) was applied according to the instructions of the manufacturer; the coding sequence of the complementary primers was CCTGTTTGACCGGGCATCTAGAATGCCTGTGTCTCTGTGC. The ASA part (residues 65–80) of the resulting hybrid, encoded by pTD57, was trimmed C-terminally by adding 3 to ASA codons 73, 74 or 76 an oligonucleotide that encoded preprolactin residues 133–137 and comprised an MscI site, which allowed fusion of the respective ASA codon to preprolactin codon 133.” (2089-2090) Dierks teaches, “preprolactin hybrids from residue 80 down to residue 73 led to concomitant reduction of modification efficiency (Figure 2, hybrids 1–4). A low but significant modification was observed even when only residues 65–73 of ASA were transferred to the preprolactin context, which agrees with the earlier observation of a low-level modification of an ASA fragment terminating at position 73 (Dierks et al., 1997). Thus, the short 65–73 sequence obviously fulfills all basic requirements needed for interaction with the modifying system.” (page 2086, 1 st column , 1 st full paragraph). The FGly residue is part of the highly conserved hexapeptide L/V-FGly-X-P-S-R,.” PNG media_image1.png 320 731 media_image1.png Greyscale Response to Arguments The response traverses the rejection by asserting the amendment has overcome the rejection. This argument has been thoroughly reviewed but is not considered persuasive as claim 23 has been amended to recite, “Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues” This does not specifically alter the structure of X 1 Z 1 X 2 Z 2 X 3 R or the nucleic acid encoding the required sulfatase motif. The broadest reasonable interpretation is the wherein clause provides a possible intended outcome of transcribing and translating the nucleic acid sequence in the presence of a formylglycine generating enzyme. However, the intended outcome does not limit the structure of the sulfatase motif or the nucleic acid encoding it. The response continues by asserting Dierks teaches , “"Taken together, these results demonstrate that residues 65-80 are both necessary and sufficient to direct modification with the maximum efficiency attainable under the given in vitro conditions." (Dierks 1999, p. 2086, col. 1, first paragraph (emphasis added).)” This argument has been thoroughly reviewed but applicant is arguing the intended use of the nucleic acid, not a structural limitation of the claim. Further Dierks continues by asserting, “Progressive C-terminal truncations of the ASA part of the preprolactin hybrids from residue 80 down to residue 73 led to concomitant reduction of modification efficiency (Figure 2, hybrids 1-4). A low but significant modification was observed even when only residues 65-73 of ASA were transferred to the preprolactin context, which agrees with the earlier observation of a low-level modification of an ASA fragment terminating at position 73 (Dierks et al., 1997). Thus, the short 65-73 sequence obviously fulfills all basic requirements needed for interaction with the modifying system. This interaction, however, is markedly improved by ASA residues 74-80, but not by unrelated sequences such as that of preprolactin. On the contrary, N-terminal extension of the ASA sequence by seven residues did not improve the modification. Not only the modification efficiencies of ASA 65-73 (Figure 2, hybrid 4) and ASA 58-73 (hybrid 6), but also those of ASA 65-80 (hybrid 1) and ASA 58-80 (hybrid 5), were comparable. This is noteworthy because the modified and unmodified forms of peptide 3 derived from constructs 5 and 6 are identical in sequence to P2* and P2 of native ASA and could, therefore, be identified by their co-elution with the respective unlabeled ASA peptides during HPLC. This lends further support to the identification of the labeled peptides as P3* and P3 (see Figure 1), which otherwise is based on radiosequencing and DNP- hydrazone formation (see above).” (2086, 1 st column, 1 st full paragraph). Further Dierks teaches, “A low but significant modification was observed even when only residues 65-73 of ASA were transferred to the preprolactin context, which agrees with the earlier observation of a low-level modification of an ASA fragment terminating at position 73 (Dierks ef al, 1997). Thus, the short 65-73 sequence obviously fulfills all basic requirements needed for interaction with the modifying system. This interaction, however, is markedly improved by ASA residues 74-86, but not by unrelated sequences such as that of preprolactin. On the contrary, N-terminal extension of the ASA sequence by seven residues did not improve the modification. Not only the modification efficiencies of ASA 65-73 (figure 2, hybrid 4) and ASA 58-73 (hybrid 6}, but also those of ASA 65-80 (hybrid 1) and ASA 38-80 hybrid 5}, were comparable. This is noteworthy because the modified and unmodified forms of peptide 3 derived from constructs 5 and 6 are identical in sequence to P2* and P2 of native ASA and could, therefore, be identified by their co-chition with the respective wolabeled ASA peptides durmg HPLC. This fends farther support to the identification of the labeled peptides as P3* and P3 (sce Figure 1), which otherwise is based on radicsequencing and DNP- hydrazone formation (sce above}.” Further Dierks teaches, “A novel amino acid derivative, Ca-formylglycine (FGly; 2-amino-3-oxopropionic acid), has been found in eukaryotic sulfatases at a position, where their cDNAs predict a cysteine. By mass spectro metry this was shown for two human sulfatases and for one from the green algaVolvox carteri(1, 2). The FGly residue is part of the highly conserved hexapeptide L/V-FGly-X-P-S-R,.” (11963, 1 st paragraph) Thus Dierks appears to suggest 8 amino acids. The response continues arguing the art of Dierks in combination with other references does not render the claims obvious. This argument has been thoroughly reviewed but is not considered persuasive as the response is arguing possible functional outcome, which does not specifically alter the sequence of the nucleic acid claimed. Claim Rejections - 35 USC § 103 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-20-fti The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made. 07-21-fti Claim 23, 25-31, 34, 39-41, 44, and 50-56 is/are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over by Deikers (The EMBO Journal Vol.18 No.8 pp.2084–2091, 1999) and Feng (Wo2005082023) . While claim 23 has been amended to recite, “Z1 is a serine or cysteine residue that is converted to a 2-formylglycine residue based on the recognition by the formylglycine generating enzyme at a higher rate than a sulfatase motif comprising at least 13 amino acid residues” This does not specifically alter the structure of X 1 Z 1 X 2 Z 2 X 3 R or the nucleic acid encoding the required sulfatase motif. The broadest reasonable interpretation is the wherein clause provides a possible intended outcome of transcribing and translating the nucleic acid sequence in the presence of a formylglycine generating enzyme. However, the intended outcome does not limit the structure of the sulfatase motif or the nucleic acid encoding it. With regards to claim 23, Dierks teaches, “ To fuse residues 1–53 of preprolactin-V33D, encoded by pTD 1 (Dierks et al., 1997), to residues 58–200 of ASA, an oligonucleotide (AGACACAGGCACGTAGAAGTCTGTCATCCG) comprising a BsaAI site and coding for ASA-F59M residues 58–63 was added 3 of codon 53 of preprolactin. The PCR product was cloned as a HindIII–BsaAI fragment into pTD17, thereby yielding pTD48. To fuse residues 163– 229 of preprolactin to residues 58–80 of ASA, an oligonucleotide, (CTCCTGACCGGCCGG) comprising an EagI site and coding for ASA residues 76–80 was added 5 of codon 163 of pTD1. The PCR product was cloned as an EagI–EcoRI fragment into pTD48, thereby yielding pTD49. For replacing in this pTD49-encoded construct residues 58–64 of ASA by the dipeptide RM, which provides a tryptic cleavage site (R) and a residue analogous to Met64 (see above), the QuikChange method (Stratagene) was applied according to the instructions of the manufacturer; the coding sequence of the complementary primers was CCTGTTTGACCGGGCATCTAGAATGCCTGTGTCTCTGTGC. The ASA part (residues 65–80) of the resulting hybrid, encoded by pTD57, was trimmed C-terminally by adding 3 to ASA codons 73, 74 or 76 an oligonucleotide that encoded preprolactin residues 133–137 and comprised an MscI site, which allowed fusion of the respective ASA codon to preprolactin codon 133.” (2089-2090) Dierks teaches, “preprolactin hybrids from residue 80 down to residue 73 led to concomitant reduction of modification efficiency (Figure 2, hybrids 1–4). A low but significant modification was observed even when only residues 65–73 of ASA were transferred to the preprolactin context, which agrees with the earlier observation of a low-level modification of an ASA fragment terminating at position 73 (Dierks et al., 1997). Thus, the short 65–73 sequence obviously fulfills all basic requirements needed for interaction with the modifying system.” (page 2086, 1 st column , 1 st full paragraph). Thus Dierks teaches a nucleic acid encoding a sulftase motif of 8 amino acids that cloned in frame prior to preprolactin to allow transcription for the promoter of pTD1. Thus Dierks teaches a recombinant nucleic active with an aldehyde tag encoding sequence, restrictions sites and a promoter operably linked. With regards to claim 25-31 34,50-56, Dierks teaches, “To fuse residues 1–53 of preprolactin-V33D, encoded by pTD 1 (Dierks et al., 1997), to residues 58–200 of ASA, an oligonucleotide (AGACACAGGCACGTAGAAGTCTGTCATCCG) comprising a BsaAI site and coding for ASA-F59M residues 58–63 was added 3 of codon 53 of preprolactin. The PCR product was cloned as a HindIII–BsaAI fragment into pTD17, thereby yielding pTD48. To fuse residues 163– 229 of preprolactin to residues 58–80 of ASA, an oligonucleotide, (CTCCTGACCGGCCGG) comprising an EagI site and coding for ASA residues 76–80 was added 5 of codon 163 of pTD1. The PCR product was cloned as an EagI–EcoRI fragment into pTD48, thereby yielding pTD49. For replacing in this pTD49-encoded construct residues 58–64 of ASA by the dipeptide RM, which provides a tryptic cleavage site (R) and a residue analogous to Met64 (see above), the QuikChange method (Stratagene) was applied according to the instructions of the manufacturer; the coding sequence of the complementary primers was CCTGTTTGACCGGGCATCTAGAATGCCTGTGTCTCTGTGC. The ASA part (residues 65–80) of the resulting hybrid, encoded by pTD57, was trimmed C-terminally by adding 3 to ASA codons 73, 74 or 76 an oligonucleotide that encoded preprolactin residues 133–137 and comprised an MscI site, which allowed fusion of the respective ASA codon to preprolactin codon 133.” (2089-2090) Dierks teaches, “preprolactin hybrids from residue 80 down to residue 73 led to concomitant reduction of modification efficiency. PNG media_image1.png 320 731 media_image1.png Greyscale Thus Dierks teaches a recombinant nucleic active with an aldehyde tag encoding sequence, restrictions sites and a promoter operably linked. Dierks does not specifically teach the polypeptide is an antibody, and IgG antibody, a humanized antibody or a single chain. However, Feng teaches, “The term "antibody," as used herein, also refers to a full-length immunoglobulin molecule or an immunologically active portion of a full-length immunoglobulin molecule, i.e., a molecule that contains an antigen binding site that immunospecifically binds an antigen of a target of interest or part thereof, such targets including but not limited to, cancer cell or cells that produce autoimmune antibodies associated with an autoimmune disease. The immunoglobulin disclosed herein can be of any type (e.g., IgG, IgE, IgM, IgD, and IgA), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. The immunoglobulins can be derived from any species. In one aspect, however, the immunoglobulin is of human, murine, or rabbit origin.” Feng teaches, “The term "antibody" herein is used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity. Antibodies may be murine, human, humanized, chimeric, or derived from other species.” Thus it would have been prima facie obvious to one of ordinary skill in the art at the time the invention was made to use the teachings of Dierks with an antibody sequences including IgG, humanized and single stranded. The artisan would be motivated to examine how formylglycine attached to the antibody alters structure or function. The artisan would have a reasonable expectation of success as the artisan is merely substituting one protein for another is a recombinant construct. With regards to claim 25-31 34,50-56, Dierks teaches, “A novel amino acid derivative, Ca-formylglycine (FGly; 2-amino-3-oxopropionic acid), has been found in eukaryotic sulfatases at a position, where their cDNAs predict a cysteine. By mass spectrometry this was shown for two human sulfatases and for one from the green algaVolvox carteri(1, 2). The FGly residue is part of the highly conserved hexapeptide L/V-FGly-X-P-S-R,.” (11963, 1 st paragraph) Response to Arguments The response traverses the rejection for the reasons of record with respect to the independent claims. This argument is not persuasive for the reasons of record. Summary No claims are allowed. Conclusion 07-96 AIA The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Kertesz (FEMSMicrobiologyReviews24(1999)135-17) Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL . See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEVEN C POHNERT PhD whose telephone number is (571)272-3803. The examiner can normally be reached Monday- Friday about 6:00 AM-5:00 PM, every second Friday off. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Steven Pohnert/Primary Examiner, Art Unit 1683 Application/Control Number: 16/927,641 Page 2 Art Unit: 1683 Application/Control Number: 16/927,641 Page 3 Art Unit: 1683 Application/Control Number: 16/927,641 Page 4 Art Unit: 1683 Application/Control Number: 16/927,641 Page 5 Art Unit: 1683 Application/Control Number: 16/927,641 Page 6 Art Unit: 1683 Application/Control Number: 16/927,641 Page 7 Art Unit: 1683 Application/Control Number: 16/927,641 Page 8 Art Unit: 1683 Application/Control Number: 16/927,641 Page 9 Art Unit: 1683 Application/Control Number: 16/927,641 Page 11 Art Unit: 1683 Application/Control Number: 16/927,641 Page 12 Art Unit: 1683 Application/Control Number: 16/927,641 Page 13 Art Unit: 1683 Application/Control Number: 16/927,641 Page 14 Art Unit: 1683 Application/Control Number: 16/927,641 Page 15 Art Unit: 1683 Application/Control Number: 16/927,641 Page 16 Art Unit: 1683 Application/Control Number: 16/927,641 Page 17 Art Unit: 1683 Application/Control Number: 16/927,641 Page 18 Art Unit: 1683 Application/Control Number: 16/927,641 Page 19 Art Unit: 1683 Application/Control Number: 16/927,641 Page 20 Art Unit: 1683
Prosecution Insights