Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on January 30, 2026 has been entered.
Detailed Action
This action is in response to the papers filed January 30, 2026.
Amendments
Applicant's response and amendments, filed January 30, 2026, to the prior Office Action are acknowledged. Applicant has cancelled Claims 2, 4-5, 8, 11, 17-41, and 43-63, amended Claims 1, 3, 6, 9-10, and 12-16, and withdrawn Claims 6-7, 9-10, and 12-15.
Claims 1, 3, 6-7, 9-10, 12-16, and 42 are pending.
Election/Restrictions
Applicant has elected the following species, wherein:
i) the alternative binding moiety species is a monoclonal antibody, or a binding fragment thereof, as recited in Claim 42;
ii) the alternative passenger strand structural species is a phosphorodiamidate morpholino oligomer-modified non-natural nucleotide, as recited in Claims 2, 19 and 24; and
iii) the alternative guide strand structural species, as recited in Claim 3, is a 5’ vinlyphosphonate modified non-natural nucleotide, to wit,
PNG
media_image1.png
164
253
media_image1.png
Greyscale
as recited in Claim 16.
Claims 1, 3, 6-7, 9-10, 12-16, and 42 are pending.
Claims 6-7, 9-10, and 12-15 are pending but withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a non-elected invention, there being no allowable generic or linking claim.
Claims 1, 3, 16, and 42 are under consideration.
Priority
This application is a 371 of PCT/US2019/12223 filed on January 3, 2019. Applicant’s claim for the benefit of a prior-filed application provisional application 62/613,742 filed on January 4, 2018 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
The disclosure of the prior-filed application, PCT/US2019/12223 filed on January 3, 2019 and 62/613,742 filed on January 4, 2018 fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Clear support for the new limitation(s) cannot be found in the instant application or priority documents.
The disclosures of PCT/US2019/12223 and 62/613,742 are silent to “the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides”.
The disclosures of PCT/US2019/12223 and 62/613,742 are silent to “phosphonodiamidate”.
Accordingly, the effective priority date of the instant claims is granted as July 7, 2020, the filing date of the instant application.
If applicant believes the earlier applications provide support for this disclosure, applicant should point out such support with particularity by page and line number in the reply to this Action.
Claim Objections
1. Claim 1 is objected to because of the following informalities:
Where a claim sets forth a plurality of elements or steps, each element or step of the claim should be separated by a line indentation, 37 CFR 1.75(i). See MPEP §608.01(m).
The multiple ‘wherein’ clauses should be separated by line indentation.
The multiple guide strand modifications should each be separated by line indentation.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
New matter
2. Claims 1, 3, 6-7, 9-10, 12-16, and 42 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Clear support for the new limitation(s) cannot be found in the instant application or priority documents. Accordingly, the amendment(s) to Claim(s) 1 is considered to constitute new matter.
MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).” MPEP 2163.02 teaches that “Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application”. MPEP 2163.06 further notes “When an amendment is filed in reply to an objection or rejection based on 35 U.S.C. 112, first paragraph, a study of the entire application is often necessary to determine whether or not “new matter” is involved. Applicant should therefore specifically point out the support for any amendments made to the disclosure” (emphasis added).
Applicant fails to point out with particularity by page and line number where support for “the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides” is found.
While the specification does disclose contemplation of a phosphonothioate internucleotide linkage (e.g. [0063]), such is in the context of a boiler-plate paragraph disclosing an enormous genus of various possible internucleotide linkages, not morpholino (PMO) modified non-natural nucleotides.
The specification is silent to “the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides”.
The specification is silent to “phosphonodiamidate”.
Rather, the specification only discloses morpholino (PMO) modified non-natural nucleotides in the context of phosphorodiamidate (e.g. [0117]; Example 2, [0342]).
Alternatively, if Applicant believes that support for “the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides” is present and clearly envisaged in the instant application or earlier filed priority documents, applicant must, in responding to this Office Action, point out with particularity, where such support may be found.
Declarations and new references cannot demonstrate possession of a concept after the fact.
Applicant does not indicate where these limitations are supported by the original specification, or how, as is Applicant's burden. See MPEP §714.02, last sentence of the third paragraph from the end and MPEP §2163.06 (I) last sentence.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
3. Claims 1, 3, and 42 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Cuellar et al (available online December 30, 2014; of record) in view of Haraszti et al (available online June 7, 2017; of record in IDS), Khvorova et al (U.S. Patent 9,809,817; co-authors to Haraszti et al; of record), Dmochowski et al (U.S. Patent 9,371,348; of record), Summerton et al (2007; of record), Morcos et al (2001; of record), and Gebski et al (2003; of record), and Kraynack et al (2006; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, Cuellar et al is considered relevant prior art for having taught a molecule comprising:
a) an antibody that recognizes a cell surface protein (e.g. pg 2, col. 2, Materials and Methods, “Trastuzumab”); and
b) a double-stranded siRNA heteroduplex comprising a guide strand and a passenger strand conjugated via a bond or linker to the antibody (e.g. pg 2, col. 1; Figure 1),
wherein the guide strand (syn. antisense strand) is chemically stabilized to comprise at least one 2’-modified non-natural nucleotide; and
wherein the passenger strand (syn. sense strand) is chemically stabilized to comprise at least one 2’-modified non-natural nucleotide (e.g. pg 2, col. 2, Materials and Methods, siRNAs, chemically stabilized siSTABLE sequences).
Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs), as shown below:
ACAGCAAAUUCCAUCGUGUnnnnnn
uuugucguuuaagguagcaca
Cuellar et al do not teach wherein the guide strand (syn. antisense strand) is chemically stabilized to comprise:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 1, Haraszti et al is considered relevant prior art for having taught a molecule comprising:
a) a binding moiety that recognizes a cell surface protein (e.g. cholesterol, Figure 1a); and
b) a double-stranded siRNA heteroduplex comprising a guide strand and a passenger strand conjugated via a bond or linker to the binding moiety (e.g. Figure 1a),
wherein the guide strand (syn. antisense strand) is chemically stabilized to comprise:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, and less than ten, phosphorothioate-modified non-natural nucleotide; and
iii) at least one 5’-vinylphosphonate (5’-VP)-modified nucleotide, whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to-3’ exonucleases (e.g. Abstract; Figure 1a); and
wherein the passenger strand (syn. sense strand) is chemically stabilized to comprise at least one 2’-modified non-natural nucleotide (e.g. Figure 1a).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Neither Cuellar et al nor Haraszti et al teach the passenger strand is chemically stabilized to consist of phosphorodiamidate morpholino modified non-natural nucleotides.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 1, Khvorova et al (co-authors to Haraszti et al) is considered relevant prior art for having disclosed a molecule comprising:
a) a binding moiety that recognizes a cell surface protein (e.g. cholesterol, Figures 1a and 35a); and
b) a double-stranded siRNA heteroduplex comprising a guide strand and a passenger strand conjugated via a bond or linker to the binding moiety (e.g. Figures 1a and 35a),
wherein the guide strand (syn. antisense strand) is chemically stabilized to comprise:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, and less than ten, phosphorothioate-modified non-natural nucleotide; and
iii) at least one 5’-vinylphosphonate-modified nucleotide (e.g. Figures 1a and 35a); and
wherein the passenger strand (syn. sense strand) is chemically stabilized to comprise at least one 2’-modified non-natural nucleotide (e.g. Figures 1a and 35a).
Khvorova et al disclosed wherein the targeting ligand may be cholesterol or an antibody (e.g. col. 54, lines 58-67), e.g. a monoclonal antibody (e.g. col. 108, lines 2-3, “targeted to infected cells with monoclonal antibodies”).
Khvorova et al disclosed wherein the siRNA comprises a 5’-vinylphosphonate as a terminal phosphate analog (e.g. Example 8; Figure 91D), as it enables sustained delivery to distant tissues (e.g. col. 14, lines 21-22).
Khvorova et al disclosed wherein the dsRNA molecule may further comprise a morpholino-modified nucleotide (e.g. col. 3, line 22; col. 5, line 30; claim 15).
Dmochowski et al is considered relevant prior art for having disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, lines 5 and 44-47; claims 10 and 12, sense oligonucleotide comprises PMO; col. 17, lines 59-60, “is a phosphorodiamidate morpholino oligonucleotide (PMO)”), which reasonably infers the passenger strand consists of phosphorodiamidate morpholino modified non-natural nucleotides.
Summerton et al is considered relevant prior art for having taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2).
Morcos et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides (syn. PMO) (e.g. Figure 2; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Gebski et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1). Gebski et al also taught wherein the heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand is conjugated to a binding moiety, e.g. cholesterol (Figure 1).
Gebski et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides (syn. PMO) (e.g. Figure 1; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Morcos et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides, e.g. all 25 nucleotides of the passenger strand are PMO (e.g. Figure 2).
Gebski et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides, e.g. all 25 nucleotides of the morpholino are PMO (e.g. Figure 1).
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, chemistry, gene-silencing technologies, and the synthesis of therapeutic, chemically-modified oligonucleotides. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the antibody-siRNA heteroduplex conjugate of Cuellar et al to comprise:
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides, with a reasonable expectation of success, the ordinary artisan being motivated to do so because those of ordinary skill in the art previously recognized the scientific and technical concepts that:
i) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including:
(a)(i) at least one 2’-modified non-natural nucleotide;
(a)(ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
(a)(iii) at least one 5’-vinylphosphonate modified non-natural nucleotide (Cuellar et al; Harszti et al; Khvorova et al);
ii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides (Khvorova et al; co-authors to Haraszti et al);
iii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides, more specifically a phosphorodiamidate morpholino oligonucleotide in the passenger (syn. sense) strand (Dmochowski et al);
iv) phosphordiamidate morpholino oligomers had long-been recognized (at least a decade prior to the effective filing date of the instant application) to be advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al);
v) PMOs composed of 12, 15, and 25 phosphorthioate-modified non-natural nucleotides had been successfully reduced to practice in heteroduplex nucleic acid molecules (e.g. Dmochowski et al, Morcos et al, Gebski et al) to a carrier (syn. passenger) nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, whereby the carrier (syn. passenger) nucleic acid strand complementary to at least a portion of the PMO oligonucleotide is chemically modified, and those of ordinary skill in the art long-recognized that phosphordiamidate morpholino oligomers have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al); and
vi) siRNA passenger strands consisting of fully chemically modified ribonucleotides was previously successfully reduced to practice (e.g. Kraynack et al) were previously known and/or successfully reduced to practice.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). See discussions supra.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 3, Haraszti et al taught a siRNA heteroduplex molecule comprising a guide strand and a passenger strand, wherein the guide strand is modified to comprise at least one modified internucleotide linkage (e.g. Figure 1a).
Khvorova et al disclosed a siRNA heteroduplex molecule comprising a guide strand and a passenger strand, wherein the guide strand is modified to comprise at least one modified internucleotide linkage (e.g. Figure 35A).
With respect to Claim 42, Cuellar et al taught wherein the antibody is a monoclonal antibody (e.g. pg 2, col. 1, “monoclonal antibodies have been tested as targeting agents”; pg 2, col. 2, Materials and Methods, “Trastuzumab”).
Khvorova et al disclosed wherein the targeting ligand may be cholesterol or an antibody (e.g. col. 54, lines 58-67), e.g. a monoclonal antibody (e.g. col. 108, lines 2-3, “targeted to infected cells with monoclonal antibodies”).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that neither Cuellar et al nor Haraszti et al teach/disclose the PMO/RNA hetero-duplex siRNA of the independent claim.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Applicant argues that Khvorova et al only mention “morpholino nucleotide” three times, and thus fail to make up for the deficiencies of Cuellar et al nor Haraszti et al.
Applicant’s argument(s) has been fully considered, but is not persuasive.
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Dmochowski et al disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, lines 5 and 44-47; claims 10 and 12, sense oligonucleotide comprises PMO; col. 17, lines 59-60, “is a phosphorodiamidate morpholino oligonucleotide (PMO)”), which reasonably infers the passenger strand consists of phosphorodiamidate morpholino modified non-natural nucleotides.
Summerton et al taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2). Morcos et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides (syn. PMO) (e.g. Figure 2; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Gebski et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Kraynack et al taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1). Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
Applicant argues that that the technical field of the instantly claimed invention is complex, and that mere expectation that a nucleotide can be modified with a morpholino is not sufficient to establish a prima facie case of obviousness of the claimed PMO/RNA hetero-duplex siRNA without any working example or associated data that the siRNA could successfully downregulate the target mRNA of an expressed target gene.
Applicant’s argument(s) has been fully considered, but is not persuasive.
Applicant's arguments fail to comply with 37 CFR 1.111(b) because they amount to a general allegation that the claims define a patentable invention without specifically pointing out how the language of the claims patentably distinguishes them from the references.
The fact that experimentation may be complex does not necessarily make it undue, if the art typically engages in such experimentation. In re Certain Limited-Charge Cell Culture Microcarriers, 221 USPQ 1165, 1174 (Int’l Trade Comm'n 1983), aff’d. sub nom.,Massachusetts Institute of Technologyv.A.B. Fortia, 774 F.2d 1104, 227 USPQ 428 (Fed. Cir. 1985). See also In re Wands, 858 F.2d at 737, 8 USPQ2d at 1404. The test of enablement is not whether any experimentation is necessary, but whether, if experimentation is necessary, it is undue. In reAngstadt, 537 F.2d 498, 504, 190 USPQ 214, 219 (CCPA 1976).
A reference contains an "enabling disclosure" if the public was in possession of the claimed invention before the date of invention. "Such possession is effected if one of ordinary skill in the art could have combined the publication's description of the invention with his [or her] own knowledge to make the claimed invention." In re Donohue, 766 F.2d 531, 226 USPQ 619 (Fed. Cir. 1985).
The quantity of experimentation needed to be performed by one skilled in the art is only one factor involved in determining whether “undue experimentation” is required to make and use the invention. “[A]n extended period of experimentation may not be undue if the skilled artisan is given sufficient direction or guidance.” In re Colianni, 561 F.2d 220, 224, 195 USPQ 150, 153 (CCPA 1977). " ‘The test is not merely quantitative, since a considerable amount of experimentation is permissible, if it is merely routine, or if the specification in question provides a reasonable amount of guidance with respect to the direction in which the experimentation should proceed.’" In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988) (citing In re Angstadt, 537 F.2d 489, 502-04, 190 USPQ 214, 217-19 (CCPA 1976)). Time and expense are merely factors in this consideration and are not the controlling factors. United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988), cert. denied, 490 U.S. 1046 (1989). Time and difficulty of experiments are not determinative if they are merely routine. See MPEP §2164.06
Applicant fails to articulate clearly and precisely exactly what element of chemically-modified synthesis of the PMO/RNA hetero-duplex is outside the realm of the state of the art as of the effective filing date, and thus undue experimentation.
Each of the cited references clearly evidence that it was well within the ordinary artisans’ abilities to synthesize chemically-modified nucleic acid oligonucleotides, including the guide and passenger strands of a hetero-duplex, including a passenger strand/guide strand siRNA hetero-duplex.
Dmochowski et al disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, lines 5 and 44-47; claims 10 and 12, sense oligonucleotide comprises PMO; col. 17, lines 59-60, “is a phosphorodiamidate morpholino oligonucleotide (PMO)”), which reasonably infers the passenger strand consists of phosphorodiamidate morpholino modified non-natural nucleotides.
Summerton et al taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2). Morcos et al taught wherein the morpholino oligonucleotide is composed of 25 phosphorodiamidate morpholino non-natural nucleotides (syn. PMO) (e.g. Figure 2; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Gebski et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand (syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides) hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1; syn. consists of phosphorodiamidate morpholino modified non-natural nucleotides).
Kraynack et al taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1). Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Thus, it is considered that there is no undue experimentation to synthesis the instantly claimed PMO/RNA hetero-duplex siRNA molecule.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
Applicant argues that neither Dmochowski et al, Summerton et al, Gebski et al, Morcos et al, nor Kraynack et al teach/disclose or suggest the PMO/RNA hetero-duplex siRNA of the independent claim.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the antibody-siRNA heteroduplex conjugate of Cuellar et al to comprise:
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides, with a reasonable expectation of success, the ordinary artisan being motivated to do so because those of ordinary skill in the art previously recognized the scientific and technical concepts that:
i) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including:
(a)(i) at least one 2’-modified non-natural nucleotide;
(a)(ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
(a)(iii) at least one 5’-vinylphosphonate modified non-natural nucleotide (Cuellar et al; Harszti et al; Khvorova et al);
ii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides (Khvorova et al; co-authors to Haraszti et al);
iii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides, more specifically a phosphorodiamidate morpholino oligonucleotide in the passenger (syn. sense) strand (Dmochowski et al);
iv) phosphordiamidate morpholino oligomers had long-been recognized (at least a decade prior to the effective filing date of the instant application) to be advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al);
v) PMOs composed of 12, 15, and 25 phosphorthioate-modified non-natural nucleotides had been successfully reduced to practice in heteroduplex nucleic acid molecules (e.g. Dmochowski et al, Morcos et al, Gebski et al) to a carrier (syn. passenger) nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, whereby the carrier (syn. passenger) nucleic acid strand complementary to at least a portion of the PMO oligonucleotide is chemically modified, and those of ordinary skill in the art long-recognized that phosphordiamidate morpholino oligomers have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al); and
vi) siRNA passenger strands consisting of fully chemically modified ribonucleotides was previously successfully reduced to practice (e.g. Kraynack et al) were previously known and/or successfully reduced to practice.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
4. Claims 1, 3 and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 19-22, 24 and 26-27 of U.S. Patent No. 10,913,800 in view of Cuellar et al, Haraszti et al, Khvorova et al, Dmochowski et al, Summerton et al, Morcos et al, Gebski et al, Watts et al, and Kraynack et al (2006; of record).
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, ‘800 claims (claim 19) an antibody conjugate comprising heteroduplex comprising a guide strand and a passenger strand, wherein the guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide (claim 20), and wherein the passenger strand comprises at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide (claim 22).
‘800 claims (claim 22) wherein the passenger strand comprises at least 6-20 PMOs.
‘800 claims (claims 24, 26) wherein the heteroduplex polynucleotide mediates siRNA.
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose (as well as to use such a composition for that purpose - i.e., to induce gene silencing of the artisan’s target mRNA of interest). The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960).
‘800 does not claim wherein the guide strand comprises at least one phosphorothioate-modified non-natural nucleotide.
However, Haraszti et al is considered relevant prior art for having taught a binding moiety, to wit, cholesterol, conjugated by at least one linker moiety to a siRNA heteroduplex molecule comprising a guide strand and a passenger strand,
wherein the guide strand comprises at least one, and less than ten, phosphorothioate-modified nucleotides and at least one 5’-vinylphosphonate-modified nucleotide (e.g. Abstract; Figure 1a),
whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to3’ exonucleases (Abstract).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the guide strand of the ‘800 binding moiety-siRNA heteroduplex conjugate to further comprise at least one phosphorothioate-modified non-natural nucleotide with a reasonable expectation of success, the ordinary artisan being motivated to do so because Haraszti et al successfully demonstrated the ability to synthesize a binding moiety-siRNA heteroduplex conjugate whose guide strand comprises a 5’-vinylphosphonate to further comprise at least one phosphorothioate-modified non-natural nucleotide (e.g. Figure 1a).
With respect to Claim 42, ‘800 claims (claims 18-19) wherein the binding moiety is a monoclonal antibody, or binding fragment thereof., e.g. HC and LC SEQ ID NO’s. The Examiner notes that ‘binding fragment thereof’ is a product-by-process limitation. The claim is recited at a high level of generality. The claims fail to recite, and the specification fails to disclose, an antibody binding fragment not derived from a monoclonal antibody that is objectively distinguished from an antibody binding fragment necessarily derived from a monoclonal antibody.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
With respect to the limitations:
wherein the guide strand comprises an overhang of at least 3 nucleotides, and
wherein the passenger strand comprises an overhang of at least 2 nucleotides, ‘800 does not claim the presently recited overhangs. However, Figure 2 clearly illustrates a 2 nucleotide overhang.
Nevertheless, Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs).
Haraszti et al taught wherein the guide strand comprises an overhang of 5 nucleotides (Figure 1a).
Khorova et al disclosed wherein the guide strand comprises an overhang of 5 nucleotides (Figure 35a).
Dmochowski et al disclosed wherein the guide strand comprises an overhang of 6 nucleotides (e.g. Figures 14-15 and 18a).
Morcos et al taught wherein the guide strand comprises an overhang ranging from 8 to 9 nucleotides in length and the passenger strand comprises an overhang of 10 nucleotides in length, for example, working examples of:
passenger strand 10nt overhang: guide strand 8 nt; and
passenger strand 10nt overhang: guide strand 9 nt (Figure 2).
Gebski et al taught wherein the guide strand comprises an overhang ranging from 1 to 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1 to 10 nucleotides in length, for example, working examples of:
passenger strand 1nt overhang: guide strand 5 nt;
passenger strand 5nt overhang: guide strand 3 nt;
passenger strand 6nt overhang: guide strand 1 nt; and
passenger strand 5nt overhang: guide strand 5 nt (Figure 1b).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 2 overhang nucleotides in the passenger strand and at least 3 overhang nucleotides in the guide strand, as opposed to the guide strand comprises an overhang of 1, 3, 4, 5, 6, or 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1, 2, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
With respect to Claim 2, while ‘800 claims wherein the guide strand comprise at least one inverted abasic moiety (c20), ‘800 does not claim wherein the passenger strand comprises the at least one inverted abasic moiety.
Watts et al is considered relevant prior art for having taught chemical modification to the ends of siRNA duplexes, especially the termini of the sense (syn. passenger) strand. These groups can include an inverted abasic end cap, which provides increased stability against exonucleases (e.g. pg 846, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the passenger strand of a binding moiety-siRNA heteroduplex conjugate to further comprise at least one terminal inverted abasic moiety with a reasonable expectation of success, the ordinary artisan being motivated to do so because those of ordinary skill in the art had long-recognized (at least a decade prior to the effective filing date of the instant application) that chemical modification to the ends of siRNA duplexes, especially the termini of the sense (syn. passenger) strand, comprising an inverted abasic end cap, provides increased stability against exonucleases (Watts et al).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification to comprise an inverted abasic moiety, and could have pursued the known potential options with a reasonable expectation of success.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, the instant claims are considered to be an obvious variant of the ‘800 patented claims.
5. Claims 1, 3 and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 7-10, and 12-20 of U.S. Patent No. 11,028,179 in view of Cuellar et al, Haraszti et al, Khvorova et al, Dmochowski et al, Summerton et al, Morcos et al, Gebski et al, Watts et al, and Kraynack et al (2006; of record).
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, ‘179 claims (claims 1, 9, and 12) an antibody conjugate comprising heteroduplex comprising a guide strand and a passenger strand, wherein the guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide (claim 13), and wherein the passenger strand comprises at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide (claim 15).
‘179 claims (claim 15) wherein the passenger strand comprises at least 6-20 PMOs.
‘179 claims (claims 17, 19) wherein the heteroduplex polynucleotide mediates siRNA.
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
It is well known that it is prima facie obvious to combine two or more ingredients each of which is taught by the prior art to be useful for the same purpose in order to form a third composition which is useful for the same purpose (as well as to use such a composition for that purpose - i.e., to induce gene silencing of the artisan’s target mRNA of interest). The idea for combining them flows logically from their having been used individually in the prior art, and from them being recognized in the prior art as useful for the same purpose. This rejection is based on the well established proposition of patent law that no invention resides in combining old ingredients of known properties where the results obtained thereby are no more than the additive effect of the ingredients. In re Kerkhoven, 626 F.2d 846, 850, 205 U.S.P.Q. 1069 (CCpA 1980), In re Sussman, 1943 C.D. 518; In re Pinten, 459 F.2d 1053, 173 USPQ 801 (CCPA 1972); In re Susi, 58 CCPA 1074, 1079-80; 440 F.2d 442, 445; 169 USPQ 423,426 (1971); In re Crockett, 47 CCPA 1018, 1020-21; 279 F.2d 274, 276-277; 126 USPQ 186, 188 (1960).
‘800 does not claim wherein the guide strand comprises at least one phosphorothioate-modified non-natural nucleotide.
However, Haraszti et al is considered relevant prior art for having taught a binding moiety, to wit, cholesterol, conjugated by at least one linker moiety to a siRNA heteroduplex molecule comprising a guide strand and a passenger strand,
wherein the guide strand comprises at least one, and less than ten, phosphorothioate-modified nucleotides and at least one 5’-vinylphosphonate-modified nucleotide (e.g. Abstract; Figure 1a),
whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to3’ exonucleases (Abstract).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the guide strand of the ‘800 binding moiety-siRNA heteroduplex conjugate to further comprise at least one phosphorothioate-modified non-natural nucleotide with a reasonable expectation of success, the ordinary artisan being motivated to do so because Haraszti et al successfully demonstrated the ability to synthesize a binding moiety-siRNA heteroduplex conjugate whose guide strand comprises a 5’-vinylphosphonate to further comprise at least one phosphorothioate-modified non-natural nucleotide (e.g. Figure 1a).
With respect to the limitations:
wherein the guide strand comprises an overhang of at least 3 nucleotides, and
wherein the passenger strand comprises an overhang of at least 2 nucleotides, ‘179 does not claim the presently recited overhangs. However, Figure 2 clearly illustrates a 2 nucleotide overhang.
Nevertheless, Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs).
Haraszti et al taught wherein the guide strand comprises an overhang of 5 nucleotides (Figure 1a).
Khorova et al disclosed wherein the guide strand comprises an overhang of 5 nucleotides (Figure 35a).
Dmochowski et al disclosed wherein the guide strand comprises an overhang of 6 nucleotides (e.g. Figures 14-15 and 18a).
Morcos et al taught wherein the guide strand comprises an overhang ranging from 8 to 9 nucleotides in length and the passenger strand comprises an overhang of 10 nucleotides in length, for example, working examples of:
passenger strand 10nt overhang: guide strand 8 nt; and
passenger strand 10nt overhang: guide strand 9 nt (Figure 2).
Gebski et al taught wherein the guide strand comprises an overhang ranging from 1 to 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1 to 10 nucleotides in length, for example, working examples of:
passenger strand 1nt overhang: guide strand 5 nt;
passenger strand 5nt overhang: guide strand 3 nt;
passenger strand 6nt overhang: guide strand 1 nt; and
passenger strand 5nt overhang: guide strand 5 nt (Figure 1b).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 2 overhang nucleotides in the passenger strand and at least 3 overhang nucleotides in the guide strand, as opposed to the guide strand comprises an overhang of 1, 3, 4, 5, 6, or 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1, 2, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
With respect to Claim 42, ‘179 claims (claims 1-8) wherein the binding moiety is a monoclonal antibody, or binding fragment thereof, e.g. HC and LC SEQ ID NO’s. The Examiner notes that ‘binding fragment thereof’ is a product-by-process limitation. The claim is recited at a high level of generality. The claims fail to recite, and the specification fails to disclose, an antibody binding fragment not derived from a monoclonal antibody that is objectively distinguished from an antibody binding fragment necessarily derived from a monoclonal antibody.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, the instant claims are considered to be an obvious variant of the ‘179 patented claims.
6. Claims 1, 3, 16, and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7, 9-12, and 16 of U.S. Patent No. 11,110,180 in view of Cuellar et al, Haraszti et al, Khvorova et al, Dmochowski et al, Summerton et al, Morcos et al, Gebski et al, Watts et al, and Kraynack et al (2006; of record).
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, ‘180 claims (claims 1, 9, 11-12, and 16) an antibody conjugate comprising heteroduplex comprising a guide strand and a passenger strand, wherein the guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide (claims 1-2, 4) and at least one phosphorothioate-modified non-natural nucleotide (claim 6).
‘180 does not claim wherein the heteroduplex RNA is an siRNA molecule.
However, Haraszti et al is considered relevant prior art for having taught a binding moiety, to wit, cholesterol, conjugated by at least one linker moiety to a siRNA heteroduplex molecule comprising a guide strand and a passenger strand,
wherein the guide strand comprises at least one, and less than ten, phosphorothioate-modified nucleotides and at least one 5’-vinylphosphonate-modified nucleotide (e.g. Abstract; Figure 1a),
whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to3’ exonucleases (Abstract).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute the RNA heteroduplex of ‘180 with an siRNA heteroduplex, as taught by Haraszti et al with a reasonable expectation of success, the ordinary artisan being motivated to do so because Haraszti et al successfully demonstrated the ability to synthesize a binding moiety-siRNA heteroduplex conjugate whose guide strand comprises a 5’-vinylphosphonate and at least one phosphorothioate-modified non-natural nucleotide (e.g. Figure 1a).
While ‘180 claims the passenger strand is chemically modified (claim 10), ‘180 does not claim wherein the passenger strand consists of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 1, Khvorova et al (co-authors to Haraszti et al) is considered relevant prior art for having disclosed siRNA heteroduplex conjugated to a binding moiety (e.g. Figure 1A), wherein the siRNA comprises a vinylphosphonate as a terminal phosphate analog (e.g. Example 8; Figure 91D), as it enables sustained delivery to distant tissues (e.g. col. 14, lines 21-22), and wherein the dsRNA molecule may further comprise a morpholino-modified nucleotide (e.g. col. 3, line 22; col. 5, line 30; claim 15).
Similarly, Dmochowski et al is considered relevant prior art for having disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, line 5; claims 10 and 12, sense oligonucleotide comprises PMO).
Summerton et al is considered relevant prior art for having taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2).
Similarly, Gebski et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1). Gebski et al also taught wherein the heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand is conjugated to a binding moiety, e.g. cholesterol (Figure 1).
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a binding moiety-siRNA heteroduplex conjugate comprising a passenger strand consists of phosphordiamidate morpholino non-natural nucleotide to further comprise at least 6 or more phosphordiamidate morpholino non-natural nucleotides in the passenger strand with a reasonable expectation of success, the ordinary artisan being motivated to do so because both Morcos et al and Gebski et al successfully demonstrated the ability to synthesize a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, whereby the carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide is chemically modified (Gebski et al), and those of ordinary skill in the art long-recognized that phosphordiamidate morpholino oligomers have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al).
Khvorova et al and Dmochowski et al disclosed wherein the siRNA heteroduplex oligonucleotide(s), including the passenger strand oligonucleotide, comprises at least one a phosphorodiamidate morpholino non-natural nucleotide.
Morcos et al and Gebski et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorodiamidate morpholino non-natural nucleotides in the passenger strand.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to substitute the chemically modified passenger strand of ‘180 with a passenger strand comprising at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute the chemically modified passenger strand of ‘180 with a passenger strand consists of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide because those of ordinary skill in the art previously recognized the scientific and technical concepts that:
i) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides (Khvorova et al; co-authors to Haraszti et al);
ii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides, more specifically a phosphorodiamidate morpholino oligonucleotide in the passenger (syn. sense) strand (Dmochowski et al); and
iii) phosphordiamidate morpholino oligomers had long-been recognized (at least a decade prior to the filing date of the instant application) to be advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al); and
iv) siRNA passenger strands consisting of fully chemically modified ribonucleotides was previously successfully reduced to practice (e.g. Kraynack et al).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
With respect to the limitations:
wherein the guide strand comprises an overhang of at least 3 nucleotides, and
wherein the passenger strand comprises an overhang of at least 2 nucleotides, ‘180 does not claim the presently recited overhangs. However, Figure 1 clearly illustrates a 2 nucleotide overhang in both the guide and passenger strands.
Nevertheless, Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs).
Haraszti et al taught wherein the guide strand comprises an overhang of 5 nucleotides (Figure 1a).
Khorova et al disclosed wherein the guide strand comprises an overhang of 5 nucleotides (Figure 35a).
Dmochowski et al disclosed wherein the guide strand comprises an overhang of 6 nucleotides (e.g. Figures 14-15 and 18a).
Morcos et al taught wherein the guide strand comprises an overhang ranging from 8 to 9 nucleotides in length and the passenger strand comprises an overhang of 10 nucleotides in length, for example, working examples of:
passenger strand 10nt overhang: guide strand 8 nt; and
passenger strand 10nt overhang: guide strand 9 nt (Figure 2).
Gebski et al taught wherein the guide strand comprises an overhang ranging from 1 to 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1 to 10 nucleotides in length, for example, working examples of:
passenger strand 1nt overhang: guide strand 5 nt;
passenger strand 5nt overhang: guide strand 3 nt;
passenger strand 6nt overhang: guide strand 1 nt; and
passenger strand 5nt overhang: guide strand 5 nt (Figure 1b).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 2 overhang nucleotides in the passenger strand and at least 3 overhang nucleotides in the guide strand, as opposed to the guide strand comprises an overhang of 1, 3, 4, 5, 6, or 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1, 2, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
With respect to Claim 16, ‘180 claims (claim 1) wherein the 5’VP has the structure of instant Claim 16.
With respect to Claim 42, ‘180 claims (claims 1-8) wherein the binding moiety is a monoclonal antibody, or binding fragment thereof.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, the instant claims are considered to be an obvious variant of the ‘180 patented claims.
7. Claims 1, 3 and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5-7, 9-12, and 16 of U.S. Patent No. 11,364,302 in view of Cuellar et al, Haraszti et al, Khvorova et al, Dmochowski et al, Summerton et al, Morcos et al, Gebski et al, and Watts et al, and Kraynack et al (2006; of record).
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, ‘302 claims (claims 1, 9-12, and 16) an antibody conjugate comprising heteroduplex comprising a guide strand and a passenger strand, wherein the guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide (claims 1-3, 4) and at least one phosphorothioate-modified non-natural nucleotide (claim 6).
‘302 does not claim wherein the heteroduplex RNA is an siRNA molecule.
However, Haraszti et al is considered relevant prior art for having taught a binding moiety, to wit, cholesterol, conjugated by at least one linker moiety to a siRNA heteroduplex molecule comprising a guide strand and a passenger strand,
wherein the guide strand comprises at least one, and less than ten, phosphorothioate-modified nucleotides and at least one 5’-vinylphosphonate-modified nucleotide (e.g. Abstract; Figure 1a),
whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to3’ exonucleases (Abstract).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute the RNA heteroduplex of ‘180 with an siRNA heteroduplex, as taught by Haraszti et al with a reasonable expectation of success, the ordinary artisan being motivated to do so because Haraszti et al successfully demonstrated the ability to synthesize a binding moiety-siRNA heteroduplex conjugate whose guide strand comprises a 5’-vinylphosphonate and at least one phosphorothioate-modified non-natural nucleotide (e.g. Figure 1a).
While ‘302 claims the passenger strand is chemically modified (claim 10), ‘302 does not claim wherein the passenger strand consists of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 1, Khvorova et al (co-authors to Haraszti et al) is considered relevant prior art for having disclosed siRNA heteroduplex conjugated to a binding moiety (e.g. Figure 1A), wherein the siRNA comprises a vinylphosphonate as a terminal phosphate analog (e.g. Example 8; Figure 91D), as it enables sustained delivery to distant tissues (e.g. col. 14, lines 21-22), and wherein the dsRNA molecule may further comprise a morpholino-modified nucleotide (e.g. col. 3, line 22; col. 5, line 30; claim 15).
Similarly, Dmochowski et al is considered relevant prior art for having disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, line 5; claims 10 and 12, sense oligonucleotide comprises PMO).
Summerton et al is considered relevant prior art for having taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2).
Similarly, Gebski et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1). Gebski et al also taught wherein the heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand is conjugated to a binding moiety, e.g. cholesterol (Figure 1).
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a binding moiety-siRNA heteroduplex conjugate comprising a passenger strand comprising at least one phosphordiamidate morpholino non-natural nucleotide to consist of phosphordiamidate morpholino non-natural nucleotides in the passenger strand with a reasonable expectation of success, the ordinary artisan being motivated to do so because both Morcos et al and Gebski et al successfully demonstrated the ability to synthesize a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, whereby the carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide is chemically modified (Gebski et al), and those of ordinary skill in the art long-recognized that phosphordiamidate morpholino oligomers have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al).
Khvorova et al and Dmochowski et al disclosed wherein the siRNA heteroduplex oligonucleotide(s), including the passenger strand oligonucleotide, comprises at least one a phosphorodiamidate morpholino non-natural nucleotide.
Morcos et al and Gebski et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorodiamidate morpholino non-natural nucleotides in the passenger strand.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to substitute the chemically modified passenger strand of ‘302 with a passenger strand consist of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute the chemically modified passenger strand of ‘302 with a passenger strand comprising at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide because those of ordinary skill in the art previously recognized the scientific and technical concepts that:
i) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides (Khvorova et al; co-authors to Haraszti et al);
ii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides, more specifically a phosphorodiamidate morpholino oligonucleotide in the passenger (syn. sense) strand (Dmochowski et al); and
iii) phosphordiamidate morpholino oligomers had long-been recognized (at least a decade prior to the filing date of the instant application) to be advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al); and
iv) siRNA passenger strands consisting of fully chemically modified ribonucleotides was previously successfully reduced to practice (e.g. Kraynack et al).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
With respect to the limitations:
wherein the guide strand comprises an overhang of at least 3 nucleotides, and
wherein the passenger strand comprises an overhang of at least 2 nucleotides, ‘374 does not claim the presently recited overhangs. However, Figure 1a clearly illustrates a 2 nucleotide overhang in both the guide and passenger strands.
Nevertheless, Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs).
Haraszti et al taught wherein the guide strand comprises an overhang of 5 nucleotides (Figure 1a).
Khorova et al disclosed wherein the guide strand comprises an overhang of 5 nucleotides (Figure 35a).
Dmochowski et al disclosed wherein the guide strand comprises an overhang of 6 nucleotides (e.g. Figures 14-15 and 18a).
Morcos et al taught wherein the guide strand comprises an overhang ranging from 8 to 9 nucleotides in length and the passenger strand comprises an overhang of 10 nucleotides in length, for example, working examples of:
passenger strand 10nt overhang: guide strand 8 nt; and
passenger strand 10nt overhang: guide strand 9 nt (Figure 2).
Gebski et al taught wherein the guide strand comprises an overhang ranging from 1 to 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1 to 10 nucleotides in length, for example, working examples of:
passenger strand 1nt overhang: guide strand 5 nt;
passenger strand 5nt overhang: guide strand 3 nt;
passenger strand 6nt overhang: guide strand 1 nt; and
passenger strand 5nt overhang: guide strand 5 nt (Figure 1b).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 2 overhang nucleotides in the passenger strand and at least 3 overhang nucleotides in the guide strand, as opposed to the guide strand comprises an overhang of 1, 3, 4, 5, 6, or 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1, 2, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
With respect to Claim 42, ‘302 claims (claim 16) wherein the binding moiety is a monoclonal antibody, or binding fragment thereof.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, the instant claims are considered to be an obvious variant of the ‘302 patented claims.
8. Claims 1, 3 and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 6-8, and 11 of U.S. Patent No. 11,583,591 in view of Cuellar et al, Haraszti et al, Khvorova et al, Dmochowski et al, Summerton et al, Morcos et al, Gebski et al, and Watts et al, and Kraynack et al (2006; of record).
Claim 1 has been amended to be directed to a molecule comprising:
a) an antibody, or antigen-binding fragment thereof, that recognizes a cell surface protein; and
b) at least one, but not more than twelve, double-stranded siRNA heteroduplex(es), each siRNA heteroduplex consisting of a guide strand (syn. antisense strand; binds to target mRNA) and a passenger strand (syn. sense strand),
wherein the guide strand is comprises:
i) at least one 2’-modified non-natural nucleotide;
ii) at least one, but no more than 10, phosphorothioate-modified non-natural nucleotides; and
iii) at least one 5’-vinylphosphonate modified non-natural nucleotide; and
wherein the passenger strand consists of phosphonodiamidate morpholino (PMO) modified non-natural nucleotides.
Because “phosphonodiamidate morpholino” is not supported by the application and priority documents, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above, the Examiner interprets the limitation to have suffered a typographical error, whereby the passenger strand is to instead consist of phosphorodiamidate morpholino (PMO) modified non-natural nucleotides.
With respect to Claim 1, ‘591 claims (claim 1) an antibody conjugate comprising an siRNA comprising a guide strand, wherein the guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide (claims 11) and at least one phosphorothioate-modified non-natural nucleotide (claim 8).
While ‘591 does not claim wherein the siRNA molecule is a siRNA heteroduplex molecule, the specification discloses that siRNA molecules are siRNA heteroduplex molecules (e.g. Figure 19, 21A (siRNA passenger strand); Example 1, siRNA conjugate, guide/antisense strand), as is normally understood in the art.
Furthermore, Haraszti et al is considered relevant prior art for having taught a binding moiety, to wit, cholesterol, conjugated by at least one linker moiety to a siRNA heteroduplex molecule comprising a guide strand and a passenger strand,
wherein the guide strand comprises at least one, and less than ten, phosphorothioate-modified nucleotides and at least one 5’-vinylphosphonate-modified nucleotide (e.g. Abstract; Figure 1a),
whereby the 5’-vinylphosphonate modification stabilizes the 5’ end of the guide strand by protecting it from phosphatases and 5’-to3’ exonucleases (Abstract).
Haraszti et al taught that the guide strand of an siRNA duplex must bear a 5’ phosphate to bind the effector protein of the RNA-induced silencing complex Argonaute 2, whereby phosphonates can be used as metabolically stable phosphate analogs, and whereby the 5’-vinylphosphonate appears to be the most effective analog in siRNAs (e.g. pg 7581, col. 2, Introduction).
Haraszti et al taught that the metabolic stabilization of the 5’-vinylphosphonate results in an overall increased guide strand tissue accumulation, which could explain improved in vivo activity of 5’-vinylphosphonate modified siRNAs (e.g. pg 7585, col. 2).
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute the siRNA-antibody conjugate of ‘591 with an siRNA heteroduplex, as taught by Haraszti et al with a reasonable expectation of success, the ordinary artisan being motivated to do so because siRNA molecules are commonly understood in the art to be RNA heteroduplexes comprising a guide strand and a passenger strand, and Haraszti et al successfully demonstrated the ability to synthesize a binding moiety-siRNA heteroduplex conjugate whose guide strand comprises a 5’-vinylphosphonate and at least one phosphorothioate-modified non-natural nucleotide (e.g. Figure 1a).
‘591 does not claim wherein the passenger strand consists of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 1, Khvorova et al (co-authors to Haraszti et al) is considered relevant prior art for having disclosed siRNA heteroduplex conjugated to a binding moiety (e.g. Figure 1A), wherein the siRNA comprises a vinylphosphonate as a terminal phosphate analog (e.g. Example 8; Figure 91D), as it enables sustained delivery to distant tissues (e.g. col. 14, lines 21-22), and wherein the dsRNA molecule may further comprise a morpholino-modified nucleotide (e.g. col. 3, line 22; col. 5, line 30; claim 15).
Similarly, Dmochowski et al is considered relevant prior art for having disclosed a nucleic acid heteroduplex comprising a sense strand and an antisense strand (e.g. Figure 1; claim 1), wherein the sense (syn. passenger strand) or antisense (syn. guide strand) strand may comprise a phosphorodiamidate morpholino oligomer (e.g. col. 9, lines 62-63; col. 10, line 5; claims 10 and 12, sense oligonucleotide comprises PMO).
Summerton et al is considered relevant prior art for having taught phosphordiamidate morpholino oligomers, being advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA (e.g. pg 653, col. 1, Morpholino Structure), and exquisite sequence specificity (Abstract).
Morcos et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 2).
Similarly, Gebski et al is considered relevant prior art for having taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a chemically modified carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, thereby forming a heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides (e.g. Figure 1). Gebski et al also taught wherein the heteroduplex nucleic acid molecule comprising a chemically modified carrier strand and a PMO oligonucleotide strand is conjugated to a binding moiety, e.g. cholesterol (Figure 1).
Kraynack et al is considered relevant prior art for having taught heteroduplex siRNA molecules in which the sense strand (syn. passenger strand) is fully chemically modified, consisting of 2’-O-methylribonucleotides (e.g. Figure 1).
Kraynack et al taught that the fully modified passenger strands provide increased nuclease resistance yet still retains siRNA potency (e.g. Abstract; pg 164, col. 1).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the passenger strand consisting of phosphorodiamidate morpholino modified non-natural nucleotides, as opposed to comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, and/or 25 phosphorodiamidate morpholino modified non-natural nucleotides.
It would have been obvious to one of ordinary skill in the art to combine a guide strand comprises at least one 5’ vinylphosphonate modified non-natural nucleotide and a passenger strand consisting of phosphorodiamidate morpholino oligomer-modified non-natural nucleotide in an siRNA heteroduplex molecule with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a binding moiety-siRNA heteroduplex conjugate comprising a passenger strand comprising at least one phosphordiamidate morpholino non-natural nucleotide to further comprise at least 6 or more phosphordiamidate morpholino non-natural nucleotides in the passenger strand with a reasonable expectation of success, the ordinary artisan being motivated to do so because both Morcos et al and Gebski et al successfully demonstrated the ability to synthesize a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand hybridized to a carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide, whereby the carrier nucleic acid strand complementary to at least a portion of the PMO oligonucleotide is chemically modified (Gebski et al), and those of ordinary skill in the art long-recognized that phosphordiamidate morpholino oligomers have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al).
Khvorova et al and Dmochowski et al disclosed wherein the siRNA heteroduplex oligonucleotide(s), including the passenger strand oligonucleotide, comprises at least one a phosphorodiamidate morpholino non-natural nucleotide.
Morcos et al and Gebski et al taught a heteroduplex nucleic acid molecule comprising a PMO oligonucleotide strand, wherein the PMO oligonucleotide comprises 25 phosphorodiamidate morpholino non-natural nucleotides.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorodiamidate morpholino non-natural nucleotides in the passenger strand.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to modify and/or substitute the passenger strand of ‘591 with a passenger strand comprising at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to modify and/or substitute the passenger strand of ‘591 with a passenger strand comprising at least one phosphorodiamidate morpholino oligomer-modified non-natural nucleotide because those of ordinary skill in the art previously recognized the scientific and technical concepts that:
i) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides (Khvorova et al; co-authors to Haraszti et al);
ii) dsRNA molecules, including siRNA molecules, may comprise one or more chemically modified nucleotides, including morpholino nucleotides, more specifically a phosphorodiamidate morpholino oligonucleotide in the passenger (syn. sense) strand (Dmochowski et al); and
iii) phosphordiamidate morpholino oligomers had long-been recognized (at least a decade prior to the filing date of the instant application) to be advantageous for multiple reasons, including: completely stable in biological systems, have a much higher affinity for their complementary RNA sequences than phosphorothioate-linked (S-) DNA, bind RNA with a higher affinity than DNA binds RNA, and much higher affinity than S-DNA for RNA, and exquisite sequence specificity (Summerton et al); and
iv) siRNA passenger strands consisting of fully chemically modified ribonucleotides was previously successfully reduced to practice (e.g. Kraynack et al).
Furthermore, it would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Those of ordinary skill in the art have long-recognized that there are only two, finite, and predictable potential options, to wit, the siRNA guide strand or the siRNA passenger strand, from which to choose chemical modification, and could have pursued the known potential options with a reasonable expectation of success.
With respect to the limitations:
wherein the guide strand comprises an overhang of at least 3 nucleotides, and
wherein the passenger strand comprises an overhang of at least 2 nucleotides, ‘591 does not claim the presently recited overhangs. However, Figure 20b clearly illustrates a 2 nucleotide overhang in both the guide and passenger strands.
Nevertheless, Cuellar et al taught wherein the guide strand comprises an overhang of 2 nucleotides in length and the passenger strand comprises an overhang of 6 nucleotides in length, for example, working examples of:
passenger strand 6nt overhang: guide strand 2 nt (pg 2, col. 2, Materials and Methods, siRNAs).
Haraszti et al taught wherein the guide strand comprises an overhang of 5 nucleotides (Figure 1a).
Khorova et al disclosed wherein the guide strand comprises an overhang of 5 nucleotides (Figure 35a).
Dmochowski et al disclosed wherein the guide strand comprises an overhang of 6 nucleotides (e.g. Figures 14-15 and 18a).
Morcos et al taught wherein the guide strand comprises an overhang ranging from 8 to 9 nucleotides in length and the passenger strand comprises an overhang of 10 nucleotides in length, for example, working examples of:
passenger strand 10nt overhang: guide strand 8 nt; and
passenger strand 10nt overhang: guide strand 9 nt (Figure 2).
Gebski et al taught wherein the guide strand comprises an overhang ranging from 1 to 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1 to 10 nucleotides in length, for example, working examples of:
passenger strand 1nt overhang: guide strand 5 nt;
passenger strand 5nt overhang: guide strand 3 nt;
passenger strand 6nt overhang: guide strand 1 nt; and
passenger strand 5nt overhang: guide strand 5 nt (Figure 1b).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The instant application fails to disclose an element of criticality for the presence of at least 2 overhang nucleotides in the passenger strand and at least 3 overhang nucleotides in the guide strand, as opposed to the guide strand comprises an overhang of 1, 3, 4, 5, 6, or 7 nucleotides in length and the passenger strand comprises an overhang ranging from 1, 2, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
With respect to Claim 42, ‘591 claims (claim 1) wherein the binding moiety is an antibody. The Examiner notes that ‘monoclonal antibody, or binding fragment thereof’ is a product-by-process limitation. The claim is recited at a high level of generality. The claims fail to recite, and the specification fails to disclose, a monoclonal antibody that is not derived from an antibody that is objectively distinguished from an antibody necessarily derived from a monoclonal antibody, nor an antibody binding fragment not derived from a monoclonal antibody that is objectively distinguished from an antibody binding fragment necessarily derived from a monoclonal antibody.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, the instant claims are considered to be an obvious variant of the ‘591 patented claims.
Conclusion
9. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638