Office Action Predictor
Last updated: April 17, 2026
Application No. 16/981,908

MODIFIED GUIDE RNAS FOR CRISPR GENOME EDITING

Non-Final OA §112§DP
Filed
Sep 17, 2020
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University Of Massachusetts
OA Round
3 (Non-Final)
62%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
98%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allow Rate
38 granted / 61 resolved
+2.3% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
58 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.8%
-9.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/29/2025 has been entered. Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 09/29/2025 is acknowledged. Claims 3-6,8,10-14,16-28,30-33,35,36,39,40,43-47,51-59,62-65,67,69-72 stand cancelled. Claims 1,7,9,15,29,34,37,42,48-50,60,61,68,73 and 77-80 were amended. Claim 81 is new. Claims 1,2,7,9,15,29,34,37,38,41,42,48-50,60,61,66,68 and 73-81 are pending. Claims 1 and 37 are free of the art. SEQ ID NOs: 11,12,14-30 in claim 15 and claim 41, previously withdrawn from consideration as a result of a restriction/election requirement, includes all the limitations of an allowable claim. Pursuant to the procedures set forth in MPEP § 821.04(a), the species election requirement, as set forth in the Office action mailed on 04/23/2024, is hereby withdrawn and SEQ ID NOs: 11,12,14-30 in claim 15, and claim 41 is hereby rejoined and fully examined for patentability under 37 CFR 1.104. In view of the withdrawal of the restriction requirement, applicant(s) are advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Claims 1,2,7,9,15,29,34,37,38,41,42,48-50,60,61,66,68 and 73-81 are under examination. Priority This application is a 371 of PCT/US2019/022818, filed 03/18/2019 which claims benefit of 62/644,944, filed 03/19/2018. Response to Arguments Applicant’s arguments and amendments, see page 18, filed 09/29/2025, with respect to the objection to claim 7 have been fully considered and are persuasive due to the amendment to claim 7. The objection to claim 7 has been withdrawn. Applicant’s arguments and amendments, see pages 18-19, filed 09/29/2025, with respect to the 35 U.S.C. 112(d) rejection of claims 77-80 have been fully considered and are persuasive due to the amendments to claims 1 and 77-80 in which claims 77-80 specify a further limitation of claim 1 by reciting that all of the nucleotides at the recited positions comprise a chemical modification. The 35 U.S.C. 112(d) rejection of claims 77-80 has been withdrawn. Applicant’s arguments and amendments, see pages 19-25 filed 09/29/2025, with respect to the 35 U.S.C. 103 rejections of claims 1,2,7,9,29,37,38,42,49,50,60,61,66,68 and 75-80 over Yin and Rahdar; claims 15 and 34 over Yin, Rahdar and Collingwood and claims 37,38 and 42 over Collingwood and Rahdar have been fully considered and are persuasive due to the amendments to the claims reciting specific modifications required at particular positions which is not taught by any of the above references. In addition, Applicants argument regarding that Yin teaches that positions 1,12,15 and 19 are 2’OH interacting positions and that modification of the interacting 2’OH abolishes the activity of the crRNA (paragraph 0439) was found persuasive, and therefore, there would be no motivation or reasonable expectation of success to modify at these positions, and the instant claims require specific modifications at positions 1 and 12. In addition, Applicants arguments that Rhadar teaches away from 2’-fluoro modifications to the seed region, (i.e., positions 11-20 in Yin, Fig 2A) were found persuasive. Therefore, the 35 U.S.C. 103 rejections have all been withdrawn, as a case of obviousness cannot be made with the above cited references given the present claim amendments. Applicant’s arguments and amendments, see pages 25-27, filed 09/29/2025, with respect to the obviousness type nonstatutory double patenting rejections of claims 1,2,7,9,15,29,34,37,38,42,49,50,60,61,66,68 and 73-80 over pending claims of US ‘849 and Rahdar; claims 1,2,7,9,15,29,34,37,38,42,49,50,60,61,66,68 and 73-890 over pending claims US ’611 and Rhadar; and claims 1,2,7,9,15,29,34,37,38,42,49,50,60, 61,66,68 and 73-80 over pending claims of US ‘505 over Yin and Rahdar, have been fully considered and are persuasive due to the amendments to the instant claims as well as a lack of a case of obviousness using the cited references given the claim amendments and teachings of the references against modifying at the recited positions. The above nonstatutory double patenting rejections have been withdrawn. The following rejections have been newly applied. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1,2,7,9,29,34,37,38,41,42,49,50,60,61,66,68,73-77 and 81 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claims 1,37,49 and 60, the recitation in these claims that in the crRNA portion “and at least two of the nucleotides at positions 2,3,5-10,20-21 and 27-36”, and “at least two of the nucleotides at positions 13,14,17,18,25 and 26 from the 5’ end”, and in the tracrRNA portion the recitation of “at least two of the nucleotides at positions 1-11,14,16-17,19-22,25,29 and 33-67” is not recited in the alternative using “or” for the position numbers and therefore creates confusion as to the scope of the minimum number of modifications required. As the minimum requirement is that 2 of the recited positions are modified with the recited modification, the “and” for the position numbers does not make the scope clear, and therefore “or” would be more appropriate. Claims 29,34 and 81 depend on claim 1 and does not correct the issues and are therefore included in the rejection. Claim 38 depends on claim 37 and does not correct the issue and is therefore included in the rejection. Claim 50 depends on claim 49 and does not correct the issue and is therefore included in the rejection. Claim 68 depends on claim 60 and does not correct the issue and is therefore included in the rejection. Regarding claim 73, the recitation “in the crRNA portion: the nucleotides at positions 1 and 4 from the 5’ end and a plurality of nucleotides at positions 2,3,5-10,20-21 and 27-36”, and “in the tracrRNA portion: at least two of the nucleotides at positions 1-11,14,16,17,19-22,25,29 and 33-67…..and at least two of the nucleotides at positions 18,23,24,27 and 28..” has the same issues as the claims above regarding the uncertainty of the scope regarding the minimum number of required modifications with recitation of “plurality”, as well as “at least two” while using “and” regarding the position numbers rather than the alternative “or”. Claim 74 depends on claim 73 and does not correct the issue and is therefore included in the rejection. Regarding claims 2,42, and 61, the limitation "the modified nucleotides” in lines 1-2 of claim 2, and the limitation “the chemically modified nucleotides” in line 2 of claim 42, and “the modified nucleotides” in line 4 of claim 61, lacks antecedent basis for these limitations in the claims. Regarding claim 2, as amended claim 1 recites multiple instances of “the nucleotides”, including three different instances in the crRNA portion regarding the nucleotides with 2’-O-methyl chemical modifications, 2’-fluoro chemical modifications and chemical modifications that are not 2’-O-methyl chemical modifications, as well as the nucleotides at specific positions in the tracrRNA portion comprising a 2’-O-methyl chemical modification, it is not clear which of “the modified nucleotides” claim 2 is referring to. Is it all of the modified nucleotides, or just the modified nucleotides of the crRNA or just of the tracrRNA or just specific modified nucleotide positions such as the nucleotides with 2’-O-methyl chemical modifications within the crRNA? The same issue arises in claim 42 which depends on claim 37, and claim 61 which depends on claim 60, which also recites multiple instances of “the nucleotides” and which comprise different chemical modifications for both the crRNA and the tracrRNA portion. Therefore, there is lack of antecedent basis regarding the limitations in claims 2,42 and 61. Claims 75 and 76 depend on claim 2 and do not correct the issues and are therefore included in the rejection. Regarding claims 7 and 66, the recitation “wherein at least 90% or 100% of the nucleotides comprise a chemical modification” creates confusion as to which of “the nucleotides” are being referred to as claim 1 which claim 7 depends on and claim 60 which claim 66 depends on have multiple recitations of “the nucleotides” including the nucleotides in the crRNA portion and the nucleotides in tracrRNA portion, and also has the recitation in claim 1 “wherein at least 80% of the nucleotides of the chemically modified guide RNA comprise a chemical modification”. Applicant should clarify what nucleotides the limitation of claims 7 and 66 are referring to. Regarding claim 9, the recitation of “a plurality of the nucleotides at positions 13, 14,17-18 and 25-26 from the 5’ end of the crRNA portion each comprise a 2’-fluoro chemical modification”, and the recitation of “a plurality of the nucleotides at positions 18,23-24 and 27-28 from the 5’ end of the tracrRNA portion each comprise a 2’-fluoro chemical modification is indefinite, as it is not clear what the required number of modified nucleotides are. The word “plurality” followed by reciting “positions 13,14,17-18 and 25-26…each comprise” in the crRNA portion, and the recitation of “plurality “ followed by reciting positions “18,23-24, and 27-28…each comprise in the tracrRNA portion. Do all of the recited positions require the specifically recited modification as the claim uses “and” between the position numbers as well as “each”, or are only some of the positions required to have the modification? Regarding claim 41 which depends on claim 37, claim 41 recites that the crRNA portion comprises a guide RNA modification pattern of NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCGAGCGC (SEQ ID NO: 31) and the tracrRNA portion comprising a guide modification pattern of GCGCUCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUU (SEQ ID NO: 32), wherein N = any nucleotide, however there is no modification pattern recited but rather only a nucleotide sequence. Therefore, the claim is indefinite regarding the modification pattern required for the specifically recited sequences of SEQ ID NOs: 31 and 32. Regarding claim 77, nucleotide positions 11 and 12 are not included in the nucleotide positions that are all chemically modified in claim 77 and positions 11 and 12 are required by claim 1 to be chemically modified. This creates an issue with the scope of the positions that are included as being chemically modified. Allowable Subject Matter Claims 1,2,7,9,29,34,37,38,41,42,49,50,60,61,66,68,73-77 and 81 would be allowable if rewritten or amended to overcome the rejection(s) under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), 2nd paragraph, set forth in this Office action. In addition, Claims 15 and 78-80 are objected to as being dependent upon a rejected base claim rejected under 35 U.S.C. 112(b), and would also be allowable once the base claims have been rewritten or amended to overcome the rejection(s) under 35 U.S.C. 112(b). As indicated in the previous office action, SEQ ID NOs: 33 and 37 and the modification pattern in claim 48 are free of the art and allowed. Conclusion Claims 1,2,7,9,29,34,37,38,41,42,49,50,60,61,66,68,73-77 and 81 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Sep 17, 2020
Application Filed
Aug 23, 2024
Non-Final Rejection — §112, §DP
Dec 02, 2024
Response Filed
Feb 24, 2025
Final Rejection — §112, §DP
May 28, 2025
Notice of Allowance
Aug 22, 2025
Interview Requested
Sep 03, 2025
Examiner Interview Summary
Sep 29, 2025
Request for Continued Examination
Oct 06, 2025
Response after Non-Final Action
Dec 23, 2025
Non-Final Rejection — §112, §DP
Mar 30, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
2y 5m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
2y 5m to grant Granted Jan 27, 2026
Patent 12522830
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12522826
THERAPEUTICS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS
2y 5m to grant Granted Jan 13, 2026
Patent 12496347
NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING NUCLEIC ACID, PREPARATION METHOD THEREFOR AND USE THEREOF
2y 5m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
62%
Grant Probability
98%
With Interview (+35.7%)
3y 6m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month