Prosecution Insights
Last updated: April 19, 2026
Application No. 17/005,858

B-CELL MATURATION COMPLEX CAR T CONSTRUCT AND PRIMERS

Non-Final OA §103§112
Filed
Aug 28, 2020
Examiner
HANEY, AMANDA MARIE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Janssen Biotech Inc.
OA Round
6 (Non-Final)
36%
Grant Probability
At Risk
6-7
OA Rounds
3y 7m
To Grant
80%
With Interview

Examiner Intelligence

Grants only 36% of cases
36%
Career Allow Rate
256 granted / 702 resolved
-23.5% vs TC avg
Strong +44% interview lift
Without
With
+44.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
57 currently pending
Career history
759
Total Applications
across all art units

Statute-Specific Performance

§101
22.8%
-17.2% vs TC avg
§103
23.5%
-16.5% vs TC avg
§102
12.1%
-27.9% vs TC avg
§112
31.6%
-8.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 702 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on November 25, 2025 has been entered. Claims 1, 3, 5-7, and 9-41 are currently pending. Claims 10-38 and 41 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on July 19, 2022. Claim Rejections - 35 USC § 112(a) 3. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 39 and 40 are rejected under 35 U.S.C. 112, first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection. The newly presented claims recite the following limitation: “wherein the CD137/ CD3ζ forward primer hybridizes upstream of the 4-1BB intracellular domain and the reverse primer hybridizes across the junction between the CD137 and CD3ζ domains, producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions”. The specification does not appear to provide support for the recitation that the forward and reverse primers produce “an amplicon of 113 bp± 10 bp”. It is noted that the Applicant points to paragraph [00227] of the specification for support for the newly added claim at page 1 lines 2-5 for support. However this paragraph does NOT provides support for “an amplicon of 113 bp± 10 bp”. The specification Table 1 teaches that the PCR product produced by amplification with SEQ ID NOs: 11 and 12 is 90 bp. PNG media_image1.png 256 360 media_image1.png Greyscale There is no teaching in the specification that this primer pair can produce an amplicon having anything other than 90bp. Thus while the specification provides support for forward and reverse primers (SEQ ID NOs: 11 and 12) that produce an amplicon of 90 bp, the specification does not provide specific support for the recitation that the forward and reverse primers (SEQ ID NOs: 11 and 12) produce an amplicon of 113 bp± 10 bp. Claim Rejections - 35 USC § 112(d) 4. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 39 and 40 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. In the instant case the newly presented claims fail to further limit the subject matter of claims 1 and 3 because they do not impose any additional structural limitations on the primers. The recitation that “the CD137/ CD3ζ forward primer hybridizes upstream of the 4-1BB intracellular domain and the reverse primer hybridizes across the junction between the CD137 and CD3ζ domains” merely restates a property of the claimed primers. The recitation that the primers are for “producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions” is an intended use of the claimed products and does not limit the scope of the claims. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 5. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 6. Claims 1, 3, 39, and 40 are rejected under 35 U.S.C. 103 as being unpatentable over Till (Blood April 26, 2012 Vol 119 Number 17 pages 3940-3950) in view of Fan (US 2018/0230225 Pub 8/16/2018) Meissner (US 2019/0309259 Pub 10/10/2019 and Filed 11/8/2017), and Payne (US 2017/0051035 Pub 2/23/2017). This rejection is further evidenced by Wang (“High-throughput primer and probe design” Real-Time PCR 1 (2006) pages 93-106). Regarding Claims 1, 3, 39, and 40 Till teaches modifying T cells with a chimeric antigen receptor (CAR). Till teaches that CD20-specific T cells were generated as previously described. Patient PBMCs were activated with OKT3 and IL-2, and 4 days later were electroporated with the L29.19.1 plasmid, which encodes a Leu16 (murine anti–human CD20) scFv fused to a human IgG1 CH2-CH3 hinge, CD4 transmembrane, intracellular CD28 (with mutated dileucine motif) and CD137 (4-1BB) costimulatory domains, and CD3ζ, under the control of the CMV immediate-early promoter, hereafter denoted as the αCD20-28-BB-ζ CAR, as well as a neomycin resistance gene under the control of an SV40 promoter (page 3940, col 1). Till teaches that the CAR transgene was detected by performing quantitative PCR using a primer amplifying a 113bp fragment spanning the junction of CD137 domain and adjacent CD3ζ chain (forward primer: 5′-GAAGAAGGAGGATGTGAACT-3′, reverse primer: 5′-TCCTCTCTTCGTCCTAGATT-3′, probe: 5′-FAM-AGGGCCAGAACCAGCTCTATAA-TAMRA-3′) (page 3940, col 2). FAM is a fluorophore and TAMRA is a fluorescence quencher. It is noted that the term “kit" used in claim 3 has been broadly interpreted to mean a collection of reagents. It is a property of the primers and probes of Till that they will bind to the CD137/ CD3ζ junction of a chimeric antigen receptor comprising a CD137 domain and a CD3ζ domain. Till does not specifically teach a probe and primer set comprising a probe consisting of the nucleotide sequence of SEQ ID NO: 10 and at least one label attached to the probe; a first primer consisting of the nucleotide sequence of SEQ ID NO: 11; and a second primer consisting of the nucleotide sequence of SEQ ID NO: 12. Till does not specifically teach the forward primer hybridizes upstream of the 4-1BB intracellular domain and the reverse primer hybridizes across the junction between the CD137 and CD3ζ domains, producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions. However Fan discloses numerous CARs that comprise intracellular CD28, CD137, and CD3ζ (see Table 4). In particular Fan discloses SEQ ID NO: 175, a portion of which is shown below. The primers and probes of Till are shown underlined. It is noted that the forward primer of Till spans the junction of CD137 domain and adjacent CD3ζ chain shown in all caps. Additionally the claimed primers and probes are shown in bold. It is noted that the reverse primer of the present claims (SEQ ID NO: 12) spans the junction of CD137 domain and adjacent CD3ζ chain shown in all caps. ttcgcagcct atcgctccaa acggggcaga aagaaactcc tgtatatatt caaacaacca 840 tttatgagac cagtacaaac tactcaagag gaagatggct gtagctgccg atttccagaa 900 gaagaagaag gaggatgtga ACtgagagtg aagttcagca ggagcgcaga cgcccccgcg 960 tacaagcagg gccagaacca gctctataac gagctcaatc taggacgaag agaggagtac 1020 gatgttttgg acaagagacg tggccgggac cctgagatgg ggggaaagcc gagaaggaag 1080 aaccctcagg aaggcctgta caatgaactg cagaaagata agatggcgga ggcctacagt 1140 gagattggga tgaaaggcga gcgccggagg ggcaaggggc acgatggcct ttaccagggt 1200 ctcagtacag ccaccaagga cacctacgac gcccttcaca tgcaggccct gccccctcgc 1260 tga 1263 Additionally Meissner discloses an oligonucleotide (SEQ ID NO: 237,090) that consists of nucleotides 2-21 of SEQ ID NO: 10. SEQ ID NO:10 2 CTTCTGGAAATCGGCAGCTA 21 |||||||||||||||||||| SEQ ID NO: 237,090 1 CTTCTGGAAATCGGCAGCTA 20 Meissner also discloses an oligonucleotide (SEQ ID NO: 242,181) that consists of nucleotides 3-22 of SEQ ID NO: 11. SEQ ID NO: 11 3 AGTACAAACTACTCAAGAGG 22 |||||||||||||||||||| SEQ ID NO: 242181 1 AGTACAAACTACTCAAGAGG 20 Further Payne discloses an oligonucleotide (SEQ ID NO: 23) that comprises the full length of SEQ ID NO: 12. SEQ ID NO: 12 1 GCTGAACTTCACTCTCAGTT 20 |||||||||||||||||||| SEQ ID NO: 23 26 GCTGAACTTCACTCTCAGTT 7 While the prior art does not teach a probe and primer set comprising a probe consisting of the nucleotide sequence of SEQ ID NO: 10 and at least one label attached to the probe; a first primer consisting of the nucleotide sequence of SEQ ID NO: 11; and a second primer consisting of the nucleotide sequence of SEQ ID NO: 12, it was well known in the art at the time of the invention that transgene integration into a CAR T cell could be quantitated by PCR using a primer pair and probe set comprising a primer that spans the junction of a CD137 domain and adjacent CD3ζ (see teachings of Till). As evidenced by the prior art of Wang, the parameters and objectives involved in the selection of primers and probes for PCR were known. For example Wang teaches guidelines for designing primers and probes including primer length, GC content, 3’melting temperature, amplicon size, etc. (see pages 93-97). Wang further discloses primer and probe design tools such as Primer3, Primer Express, and Premier Biosoft International (pages 104-105). As evidenced by Wang, designing primer pairs and probes which are equivalent to those recited by the claims is considered routine experimentation. A skilled artisan having knowledge of the sequence of the junction of the CD137 domain and adjacent CD3ζ (as disclosed by Fan) would have it found it “obvious to try” the primers and probe recited in the claimed method because the artisan would have had a finite number of identified, predictable, sequence options for the primers and probe. Further the skilled artisan would have recognized the parameters and objectives involved in the selection of primers and probes. Thus the prior art is replete with guidance and information necessary to permit the ordinary artisan to design primers and probes for the detection of transgene integration into a CAR T cell. Thus, for the reasons provided above, modifying the primers and probes disclosed in the prior art to arrive at probe consisting of the nucleotide sequence of SEQ ID NO: 10 and at least one label attached to the probe; a first primer consisting of the nucleotide sequence of SEQ ID NO: 11; and a second primer consisting of the nucleotide sequence of SEQ ID NO: 12 would have been obvious to one of ordinary skill in the art. Further it is noted that it is a property of the SEQ ID NO: 11 that is hybridizes upstream of the 4-1BB intracellular domain and it is a property of SEQ ID NO: 12 that it hybridizes across the junction between the CD137 and CD3ζ domains. The recitation that the primers are for “producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions” is an intended use of the claimed primers and does not limit the scope of the invention. 7. Claims 5, 6, and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Till (Blood April 26, 2012 Vol 119 Number 17 pages 3940-3950) in view of Fan (US 2018/0230225 Pub 8/16/2018), Meissner (US 2019/0309259 Pub 10/10/2019 and Filed 11/8/2017) and Payne (US 2017/0051035 Pub 2/23/2017) as applied to claim 3 above and in further view of Fahey (US 2011/0251091 Pub 10/13/2011). Note the rejection of claim 3 was further evidenced by Wang (“High-throughput primer and probe design” Real-Time PCR 1 (2006) pages 93-106). The teachings of Till, Fan, Meissner, and Payne are discussed above. The combined references do not teach a kit that comprises an array that comprises the probe (clm 5). The combined references do not teach the array is a multi-well plate (clm 6). The combined references do not teach a kit further comprising a reference gene probe and reference gene primers (clm 9). However Fahey teaches a kit comprising primers and probes for detecting expression of a gene. Fahey teaches that the kit can also include primers and probes for detecting particular control nucleic acid sequences. Fahey teaches that the probes and/or primers can be provided on a microarray or can be provided in separate vials or wells of an assay plate (e.g., a microtiter plate) (para 0118). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the kit of Till, Fan, Meissner, and Payne by placing the nucleic acids in a multi-well plate in the kit as suggested by Fahey. One of skill in the art would have been motivated to put the nucleic acids in a multi-well plate because such plates were known in the art and were routinely used in the art when performing amplification reactions. Further it would have been obvious to additionally include primers and probes for detecting a control nucleic acid (reference gene) since Fahey teaches that expression level controls (such as constitutively expressed genes) can be used to evaluate the efficiency of cRNA preparation (para 0104). 8. Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Till (Blood April 26, 2012 Vol 119 Number 17 pages 3940-3950) in view of Fan (US 2018/0230225 Pub 8/16/2018), Meissner (US 2019/0309259 Pub 10/10/2019 and Filed 11/8/2017), and Payne (US 2017/0051035 Pub 2/23/2017) as applied to claim 3 above and in further view of Ying (Nature Medicine Vol 25 June 2019 pages 947-953), GenBank (Accession EF649953 pub 7/23/2007) and Bretelle (US 2010/0075306 Pub 3/25/2010). This rejection is further evidenced by Wang (“High-throughput primer and probe design” Real-Time PCR 1 (2006) pages 93-106). The teachings of Till, Fan, and Meissner are discussed above. The combined references do not teach that the kit further comprises a primer pair and probe for detecting hALB. However Ying teaches performing qPCR analysis of CAR T cell expression. Ying teaches that a pair of Scorpion primers targeting a specific fragment of the CAR sequence spanning the junction of 4-1BB and CD3ζ was used to determine the copy number of the CAR construct in PBMCs. The human albumin gene (ALB) was used as an endogenous reference for final sample normalization (page 954, col 2). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the kit of Till, Fan, and Meissner by including primers and a probe for hALB gene as suggested by Ying. One of skilled in the art would have been motivated to include primers and a probe for hALB in a kit comprising primers and a probe for a CAR-T cell for the benefit of being able to use hALB to normalize CAR-T. . The combined references do not teach a kit further comprising a hALB probe consisting of the nucleotide sequence of SEQ ID NO: 22 and at least one label attached to the probe; a first hALB primer consisting of the nucleotide sequence of SEQ ID NO: 23; and a second hALB primer consisting of the nucleotide sequence of SEQ ID NO: 24 (clm 7). The combined references do not teach that the probe is labeled with a fluorophore or fluorescence quencher (clm 7). Additionally GenBank discloses the homo sapiens albumin (ALB) gene, complete coding sequence, a portion of which is shown below. The claimed primers and probes are shown in bold. 16501 tataattgca taaaatttag ctatagaaag ttgctgtcat ctcttgtggg ctgtaatcat 16561 cgtctaggct taagagtaat attgcaaaac ctgtcatgcc cacacaaatc tctccctggc 16621 attgttgtct ttgcagatgt cagtgaaaga gaaccagcag ctcccatgag tttggatagc 16681 cttattttct atagcctccc cactattagc tttgaaggga gcaaagttta agaaccaaat Further Bretelle discloses an oligonucleotide (SEQ ID NO: 16) that comprises nucleotides 3-25 of SEQ ID NO: 22. SEQ ID NO: 22 3 GGAGAGATTTGTGTGGGCATGAC 25 ||||||||||||||||||||||| SEQ ID NO: 16 26 GGAGAGATTTGTGTGGGCATGAC 4 Bretelle also discloses an oligonucleotide (SEQ ID NO: 14) that comprises of nucleotides 1-18 of SEQ ID NO: 23. SEQ ID NO: 23 1 TCATCTCTTGTGGGCTGT 18 |||||||||||||||||| SEQ ID NO: 14 5 TCATCTCTTGTGGGCTGT 22 While the prior art does not teach a probe and primer set comprising a probe consisting of the nucleotide sequence of SEQ ID NO: 22 and at least one label attached to the probe; a first primer consisting of the nucleotide sequence of SEQ ID NO: 23; and a second primer consisting of the nucleotide sequence of SEQ ID NO: 24, it was well known in the art at the time the invention how to design primers and probes for detecting the hALB gene. As evidenced by the prior art of Wang, the parameters and objectives involved in the selection of primers and probes for PCR were known. For example Wang teaches guidelines for designing primers and probes including primer length, GC content, 3’melting temperature, amplicon size, etc. (see pages 93-97). Wang further discloses primer and probe design tools such as Primer3, Primer Express, and Premier Biosoft International (pages 104-105). As evidenced by Wang, designing primer pairs and probes which are equivalent to those recited by the claims is considered routine experimentation. A skilled artisan having knowledge of the sequence of the hALB (as disclosed by GenBank) would have it found it “obvious to try” the primers and probe recited in the claimed method because the artisan would have had a finite number of identified, predictable, sequence options for the primers and probe. Further the skilled artisan would have recognized the parameters and objectives involved in the selection of primers and probes. Thus the prior art is replete with guidance and information necessary to permit the ordinary artisan to design primers and probes for the detection of hALB. Thus, for the reasons provided above, modifying the primers and probes disclosed in the prior art to arrive at probe consisting of the nucleotide sequence of SEQ ID NO: 22 and at least one label attached to the probe; a first primer consisting of the nucleotide sequence of SEQ ID NO: 23; and a second primer consisting of the nucleotide sequence of SEQ ID NO: 24 would have been obvious to one of ordinary skill in the art. Further it would have been obvious to label the probe with fluorescein and a quencher as taught by Till for the benefit of being able to detect PCR products. Response To Arguments 9. In the response the Applicants traversed the rejection under 35 USC 103 over the combination of Till, Fan, Meissner, and Payne (as evidenced by Wang). In the response (pages 11-12) the Applicants argue that the obviousness rejection is based on an insufficient obvious to try analysis because the rejection fails to articulate a recognized problem or need in the art. The response states that Till is directed to, in part, confirming the integration of anti-CD20 CAR-T cells by performing quantitative PCR using a primer amplifying a 113 bp fragment spanning the junction of CD137 domain and adjacent CD3ζ chain. The Applicants argue that because the primer set of Till worked for its intended use there was no problem in the art. They argue that a POSA, requiring a probe and primer set directed toward the CD137/ CD3ζ junction of a CAR-T cell, would have simply used the exact sequences taught by Till. The Office has articulated no reason why a POSA would be motivated to design a new probe and primer set using the cited art. This argument has been fully considered but is not persuasive. The fact that the primers of Till worked for their intended use does not mean that there was no need to develop additional primers and probes that were capable of amplifying this particular junction. One of skill in the art would have been motivated to continue to design additional primers and probes for the benefit of optimizing the method of detecting the CAR transgene. In the response (pages 12-14) the Applicants argue that the obviousness rejection is based on an insufficient obvious to try analysis because there is an exceptionally large number of possible solutions. The Applicants argue that there are over 830 million possible primer and probe combinations. This vast number is the result of numerous factors involved in primer and probe design, including but not limited to primer length, GC content, melting temperature, target position within the sequence, and orientation (whether the forward or reverse primer spans the junction), among other factors. They further argue that the Office is engaging in impermissible hindsight analysis because it is directly using the claimed invention to reach a finite number of solutions from the prior art and thus conclude obviousness. This argument has been fully considered but is not persuasive. In the instant case, the nucleic acid sequence of the CD137/ CD3ζ junction was known in the prior art. A skilled artisan having knowledge of this nucleic acid sequence would have had a finite number of predictable sequence options for primers and probes which can amplify and detect the CD137/ CD3ζ junction. Even a long list of options can still be considered a finite list. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In the response (pages 14-17) the Applicants argue that the obviousness rejection is based on an insufficient obvious to try analysis because the rejection fails to articulate a reasonable expectation of success. They argue that Till teaches away because the reference uses a forward primer that spans the junction rather than a reverse primer that spans the junction. They argue that in Fan the claimed SEQ ID NOs: 10 and 12 are present only in reverse complement form and that the skilled artisan would not know how to reverse and/or inverse them to make them functional. They argue that Meissner discloses oligonucleotides that partially overlap with the claimed probe (SEQ ID NO: 10) and forward primer (SEQ ID NO: 11). However, Meissner does not teach or suggest using these sequences in the context of detecting the CD137/ CD3ζ junction. Similarly, Payne discloses an oligonucleotide that includes SEQ ID NO: 12 (reverse primer) as part of a longer 34-nucleotide fragment used for cloning the CD3ζ domain. They argue that Wang only provides general principles and guideline from primer design and does not offer any specific guidance on selecting sequences required for detecting the CD137/ CD3ζ junction. Further they argue that experimental results in the present application show that only one primer/probe configuration (the claimed set) achieved required efficiency (95- 105 %) and R2> 0.99 in multiplex with hALB. See Specification, paras. [0347], [0350]-[0351]. Such performance was unexpected and not predictable from any of the cited art. These arguments have been fully considered but are not persuasive. It is noted that obviousness does not require absolute predictability, but at least some degree of predictability is required. The Examiner is unpersuaded by Applicants assertion that a skilled artisan would not have had a reasonable expectation of successfully arriving at the claimed primers and probe. Till discloses performing PCR accords the junction using a forward primer that overlaps the junction. Fan discloses the nucleic acid sequence of the junction. Meissner discloses an oligonucleotide (SEQ ID NO: 237,090) that consists of nucleotides 2-21 of SEQ ID NO: 10 and an oligonucleotide (SEQ ID NO: 242,181) that consists of nucleotides 3-22 of SEQ ID NO: 11. Payne discloses an oligonucleotide (SEQ ID NO: 23) that comprises the full length of SEQ ID NO: 12. Wang discloses the parameters and objectives involved in the selection of primers and probes for PCR and design tools such as Primer3, Primer Express, and Premier Biosoft International (pages 104-105). These disclosures when read in combination provide evidence that a skilled artisan at the time of the invention would have a reasonable expectation of success at developing the claimed primers and probe. Applicants have not considered that skill in the art at the time of the invention, was very high. Applicants have not established that it was beyond the skill of the ordinary artisan to design the claimed primers and probe in view of the disclosure of the relevant sequences, the guidance in the prior art, and the available primer design software. Further Applicants state that the performance of the claimed primers and probe in a multiplex PCR with hALB was “unexpected and not predictable from any of the cited art”. This is a mere a conclusory statement made by Applicants, as there is no comparison of the claimed invention with the closest prior art that is commensurate in scope with the claims. In the response (pages 18-20) the Applicants argue that the cited PTAB case Ex parte Kostrikis (Appeal No. 2010-001111) is distinguishable. They argue that an important factor in Kostrikis was the prior art's demonstration of a high success rate in primer functionality, specifically within the context of the Buck reference. Buck conducted a systematic study in which 95 primers were tested, covering more than one-third of all possible 18-mer primers in a 300-base-pair target sequence. This extensive testing provided empirical evidence that virtually all primers selected from a target sequence were capable of undergoing hybridization and extension by a polymerase. The Applicants argue that the present case involves a much more highly unpredictable field with no prior art demonstrating systematic testing showing high success rates in primer and probe design for the CD137/ CD3ζ junction. They argue that the prior art in the present case does not get close to the claimed sequences and lacks specific guidance or empirical support. The significant differences in sequence orientation, nucleotide identity, and application preclude any reasonable expectation of success. Moreover, there are no prior art studies demonstrating successful primer design for the CD137/ CD3ζ junction, while the applicant's own experimental data shows all but one of the tested primers failed to meet the necessary criteria. These arguments have been fully considered. The Examiner agrees that the fact patterns between the instant application and Ex parte Kostrikis are different. However, that does not mean that the decision is not relevant to the instant application. In the Final Office Action mailed August 28, 2024 the examiner wrote the following on page 13: Finally it is relevant to point out that the PTAB has routinely rejected a similar argument alleging the non-obviousness of selecting particular primers from known sequences. The PTAB states it is "more than reasonable to find that selection of particular real-time primer sequences from a known sequence using commercially available software 'would have had a resoundingly reasonable expectation of success' in deriving the claimed invention in light of the teachings of the prior art" (see Ex parte Kostrikis, Appeal No. 2010-001111, and Ex Parte Wulischick, Appeal 2017-000266). Thus the Office is relying on a single quotation from this decision, rather than the decision as a whole. Ex parte Kostrikis on page 13 states the following: PNG media_image2.png 532 680 media_image2.png Greyscale The cited quotation is relevant because the target sequence of the CD137/ CD3ζ junction was known in the prior art. Further the prior art disclosed commercially available software for designing primers and probes for PCR. In particular Wang discloses parameters and objectives involved in the selection of primers and probes for PCR and design tools such as Primer3, Primer Express, and Premier Biosoft International (pages 104-105). Therefore it follows that one of skill in the art would have had a reasonable expectation of success in deriving the claimed primers and probe using commercially available software. In fact the inventors derived the claimed primers and probe using the Primer Quest Tool (see instant specification (para 0347)). Thus it is maintained that there was more than a reasonable expectation of success in light of the teachings of the prior art. This quotation has nothing to do with Buck, it only has to do with the fact that there is resounding high expectation of success of designing primers and probes to known sequences when using commercially available software. In the response (pages 18-22) the Applicants argue that the cited PTAB case Ex parte Wuitschick (Appeal No. 2017-009266) is distinguishable. They argue that the prior art in Wuitschick provided specific guidance on designing primers and probes targeting the PRAME mRNA. The PRAME mRNA sequence was well-characterized and available in public databases, with precise exon boundaries known. The prior art (Pollack and Mansfield) provided exact sequences of primers and probes that were highly similar to the claimed sequences, both in their nucleotide composition and their binding sites. The Board noted that selecting primers from known sequence data and designing similar probes was routine, and the sequence similarity in Wuitschick led to the conclusion of obviousness. In contrast, the present case involves a field with no prior art disclosing primers or probes that are similar to the claimed sequences, either in sequence identity, binding regions, or context. These arguments have been fully considered. The Examiner agrees that the fact patterns between the instant application and Ex parte Wuitschick are different. However, that does not mean that the decision is not relevant to the instant application. In the Final Office Action mailed August 28, 2024 the examiner wrote the following on page 13: Finally it is relevant to point out that the PTAB has routinely rejected a similar argument alleging the non-obviousness of selecting particular primers from known sequences. The PTAB states it is "more than reasonable to find that selection of particular real-time primer sequences from a known sequence using commercially available software 'would have had a resoundingly reasonable expectation of success' in deriving the claimed invention in light of the teachings of the prior art" (see Ex parte Kostrikis, Appeal No. 2010-001111, and Ex Parte Wulischick, Appeal 2017-009266). Thus the Office is relying on a single quotation from this decision, rather than the decision as a whole. Ex parte Wuitschick on pages 9-10 states the following: PNG media_image3.png 264 672 media_image3.png Greyscale PNG media_image4.png 484 678 media_image4.png Greyscale The cited quotation is relevant because the target sequence of the CD137/ CD3ζ junction was known in the prior art. Further the prior art disclosed commercially available software for designing primers and probes for PCR. In particular Wang discloses parameters and objectives involved in the selection of primers and probes for PCR and design tools such as Primer3, Primer Express, and Premier Biosoft International (pages 104-105). Therefore it follows that one of skill in the art would have had a reasonable expectation of success in deriving the claimed primers and probe using commercially available software. In fact the inventors derived the claimed primers and probe using the Primer Quest Tool (see instant specification (para 0347)). Thus it is maintained that there was more than a reasonable expectation of success in light of the teachings of the prior art. This quotation has nothing to do with Pollack and Mansfield, it only has to do with the fact that there is resounding high expectation of success of designing primers and probes to known sequences when using commercially available software. In the response (page 22-23) the Applicants address the additional rejections. Regarding Claims 5, 6, and 9 the Applicants argue that Fahey does not make up for the deficiencies in Till, Fan, Meissner, and Payne. Regarding Claims 7 and 8 the Applicants argue that Ying, GenBank and Bretelle do not make up for the deficiencies in Till, Fan, Meissner, and Payne. These arguments have been fully considered but are not persuasive. The Applicants arguments regarding what is missing in Till, Fan, Meissner, and Payne have been fully addressed above. The response to Applicants arguments, as set forth above, applies equally to these grounds of rejection. In the response (page 23) the Applicants argue that the new claims would not have been obvious over the cited art for the same reasons outlined above with respect to claims 1 and 3. They argue that a person of ordinary skill in the art not have arrived at the claimed probe and primer sets with any expectation of success for the reasons outlined above, much less where "the CD137/ CD3ζ forward primer hybridizes upstream of the 4-1BB intracellular domain and the reverse primer hybridizes across the junction between the CD137 and CD3ζ domains, producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions," as recited in new claims 39 and 40. This argument has been fully considered but is not persuasive. The newly presented claims do not impose any additional structural limitations on the claimed primers and probe. The recitation that “the CD137/ CD3ζ forward primer hybridizes upstream of the 4-1BB intracellular domain and the reverse primer hybridizes across the junction between the CD137 and CD3ζ domains” merely restates a property of SEQ ID NOs: 11 and 12. The recitation that the primers are for “producing an amplicon of 113 bp± 10 bp that detects transgene integration with >95% efficiency under multiplex qPCR conditions” is an intended use of the claimed products and does not limit the scope of the claims. 10. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached on Monday-Friday, 8:15am-4:45pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached on 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA HANEY/ Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Aug 28, 2020
Application Filed
Oct 21, 2022
Non-Final Rejection — §103, §112
Apr 24, 2023
Response Filed
Aug 02, 2023
Final Rejection — §103, §112
Nov 07, 2023
Request for Continued Examination
Nov 09, 2023
Response after Non-Final Action
Nov 14, 2023
Non-Final Rejection — §103, §112
May 15, 2024
Response Filed
Aug 23, 2024
Final Rejection — §103, §112
Feb 20, 2025
Request for Continued Examination
Feb 26, 2025
Response after Non-Final Action
Apr 30, 2025
Final Rejection — §103, §112
Jul 26, 2025
Examiner Interview Summary
Nov 04, 2025
Notice of Allowance
Nov 25, 2025
Request for Continued Examination
Dec 01, 2025
Response after Non-Final Action
Mar 18, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577612
DEVICES AND METHOD FOR DETECTING AN AMPLIFICATION EVENT
2y 5m to grant Granted Mar 17, 2026
Patent 12546786
CIRCULATORY BIOMARKERS FOR PLACENTAL OR FETAL HEALTH
2y 5m to grant Granted Feb 10, 2026
Patent 12545957
METHOD OF DETERMINING ENDOMETRIAL RECEPTIVITY AND APPLICATION THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12516390
Methods and Systems for Predicting Whether a Subject Has a Cervical Intraepithelial Neoplasia (CIN) Lesion from a Suspension Sample of Cervical Cells
2y 5m to grant Granted Jan 06, 2026
Patent 12503733
METHODS OF IDENTIFYING AND TREATING A PERSON HAVING A PREDISPOSITION TO OR AFFLICTED WITH A CARDIOMETABOLIC DISEASE
2y 5m to grant Granted Dec 23, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

6-7
Expected OA Rounds
36%
Grant Probability
80%
With Interview (+44.0%)
3y 7m
Median Time to Grant
High
PTA Risk
Based on 702 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month