DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on September 4, 2025 has been entered.
Application Status
Applicant’s remarks and amendments to the claims filed September 4, 2025 are acknowledged. Claim 1 was amended, and claim 6 was cancelled. Accordingly, claims 1-5, 7-18, and 20-24 are pending. Claims 8-16 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention. Claims 1-5, 7, 17-18, and 20-24 are under examination herein.
Withdrawn Rejections
As stated in the advisory action mailed June 20, 2025, Applicant’s amendments to the specification and claims filed June 4, 2025 were entered. The amendments were sufficient to overcome the objections to the specification and claims, and the § 112(a) rejection raised in the prior action. These objections and rejections were previously withdrawn.
Applicant’s amendment to claim 1 to require that the sgRNA synthesis system be “a reaction mixture for producing sgRNA in one step” is sufficient to overcome the § 102 rejections raised over Yu, and the § 103 rejections raised over Yu in view of Nelson or Varshney. This phrase is interpreted as requiring that the system be capable of producing sgRNA in a singular reaction step, e.g., a single incubation step (pg. 7, lines 9-14), as opposed to multiple reaction steps of other prior art systems (pg. 2, lines 5-11). This preamble phrase results in a structural difference compared to the system taught by Yu, and limits the claims to sgRNA synthesis systems which are suitable for producing sgRNA in one step. These rejections are withdrawn, accordingly.
Applicant’s remarks and amendments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Priority
Applicant’s priority claims to Application Nos. CN201810271411.2 and PCT/CN2019/080485 are acknowledged. Claims 1-5, 7, 17-18, and 20-24 find support in Application No. CN201810271411.2, filed March 29, 2018. The effective filing date of the claims under examination is March 29, 2018.
Claim Objections
Claims 17-18 and 20 are objected to because of the following informalities:
Claims 17-18 and 20 recite element lengths in “bp,” which would be understood by the skilled artisan to refer to base paired nucleotides. However, based on the specification, the nucleic acid construct is single-stranded, and therefore, not composed of base paired nucleotides (see diagrams on pgs. 16-17). The term “bp” is used throughout the specification to refer to single-stranded regions (e.g., the statements “The 5’ end 20bp of the Target DNA sequence PAM,” or “T7 promoter (20bp),” each refer to a single-stranded region in a diagram on pgs. 16-17), such that it is clear that the term “bp” refers to unpaired nucleotides. Accordingly, it would be preferable to amend the claims to recite the term “nts” or “nucleotides,” rather than “bp.”
Appropriate correction is required.
Claim Rejections - 35 USC § 103 – EnGen in view of iGEM and Nelson
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-5, 7, 17-18, 20, and 24 are rejected under 35 U.S.C. 103 as being unpatentable over EnGen (EnGen sgRNA Synthesis Kit (NEB, EnGen sgRNA Synthesis Kit, S. pyogenes, Product Information and Instruction Manual, available 13 July 2017 as evidenced by The WayBack Machine; of record), in view of iGEM (“Promoters/Catalog/T7”, published 14 August 2017, iGEM Registry of Standard Biological Parts, retrieved May 28, 2024 from The Wayback Machine; of record) and Nelson (Nelson and Fitch, 2011, “Overlap Extension PCR: An Efficient Method for Transgene Construction,” Methods in Molecular Biology, Vol. 772, pg. 459-470; of record). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Regarding claims 1-2, EnGen teaches a sgRNA synthesis system which is a reaction mixture for producing sgRNA in one step (“Synthesis of the dsDNA template and transcription of the RNA occur in a single reaction, resulting in the generation of a functional sgRNA… The EnGen sgRNA Synthesis Kit… provides a simple and quick method for transcribing high yields of sgRNA in a single 30 minute reaction,” pg. 3). EnGen teaches the system comprises, (a) a nucleic acid construct (“Target-specific oligo,” Fig. 3) (b) a reverse primer (“Scaffold Oligo,” Fig. 3), (c) a DNA polymerase (“DNA and RNA polymerases,” Fig. 3), and (d) an RNA polymerase (“DNA and RNA polymerases,” Fig. 3). Regarding the structure of the nucleic acid construct (i.e., EnGen’s “Target-specific oligo”), EnGen teaches the nucleic acid construct has a 5’ to 3’ structure shown in Fig. A below, wherein:
FIGURE A. Adapted from EnGen, “Target-specific oligo design,” pgs. 5-6
TTCTAATACGACTCACTATAGTGCAACCTTCATTTCCCTGCGTTTTAGAGCTAGA
(SEQ ID NO: 29) GTTTTAGAGCTAGAAATAGCA
NNNTAATACGACTCACTATAGG (SEQ ID NO: 21)
Y1 is a T7 RNA polymerase initiation region consisting of the sequence “TTCTAATACGACTCACTATA” (“To the 5’ end, append T7 promoter sequence,” step 3, pg. 5),
Y2 is a target DNA sequence (see steps 1-2, pg. 5),
Y3 is a reverse primer binding region consisting of the sequence “GTTTTAGAGCTAGA” (To the 3’ end, append the 14 nucleotide overlap sequence,” step 4, pg. 5),
and wherein each aforementioned element is linked by a bond to adjacent element(s).
As shown in Fig. A above, EnGen’s RNA polymerase initiation region is shorter than an instantly claimed RNA polymerase initiation region by two 3’ nucleotides (i.e., missing the 3’ dinucleotide “GG” relative to instant SEQ ID NO: 21). EnGen does not teach an RNA polymerase initiation region that meets the limitations of instant claim 1.
However, EnGen teaches that “transcription can be somewhat sequence dependent,” and “designing multiple sgRNAs per target is recommended” (pg. 11). Regarding design parameters that can overcome low sgRNA yield, EnGen teaches that “[i]t is important to have at least one G following the T7 promoter sequence” (pg. 11).”
iGEM teaches the T7 promoter sequence pattern at T7 RNA polymerase binding sites (“sequence logo”, pg. 1), as well as the sequences of various T7 promoters (“T7 promoter collection,” pg. 1-2). iGEM teaches the sequence of the “T7 consensus” promoter (“BBa_J64997,” pg. 1). As shown in Fig. B below, appending the 3’ dinucleotide “GG” of iGEM’s T7 consensus promoter (bolded) to the RNA polymerase initiation region of EnGen results in a sequence 100% identical to instant SEQ ID NO: 21.
FIGURE B.
TTCTAATACGACTCACTATA (EnGen, “T7 promoter sequence”)
TAATACGACTCACTATAGG (IGEM “T7 consensus,” “BBa_J64997”)
NNNTAATACGACTCACTATAGG (SEQ ID NO: 21)
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have modified the T7 RNA polymerase initiation region taught by EnGen, to comprise the T7 consensus promoter sequence taught by iGEM. It would have amounted to modifying a known T7 promoter sequence, with another substantially identical T7 promoter sequence, by known means, to yield predictable results. A skilled artisan would have had a reasonable expectation of success in modifying EnGen’s sequence, because iGEM’s T7 promoter sequence is the “consensus” promoter sequence, and naturally comprises at least one G at the end of the promoter sequence. The skilled artisan would have been motivated to modify the T7 RNA polymerase initiation region taught by EnGen in an effort to ensure that the T7 promoter sequence has at least one G at the end of the sequence, which EnGen teaches improves sgRNA yield.
As shown in Fig. A above, EnGen’s reverse primer binding region is shorter than the instantly claimed reverse primer binding region (i.e., missing 7 3’ nucleotides relative to instant SEQ ID NO: 29). EnGen does not teach a reverse primer binding region that meets the limitations of instant claim 1.
However, as stated above, EnGen teaches that “transcription can be somewhat sequence dependent,” and “designing multiple sgRNAs per target is recommended” (pg. 11).
Nelson teaches that “A general principle in designing [] overlap primers is that the 3’ portion that is complementary to the template should range 21-30 bp in length… so as to maximize the chances of overlap in subsequent steps” (pg. 464). A skilled artisan, therefore, would predict that extending the 14 nt reverse primer binding region of EnGen’s construct at the 3’ end, using the sgRNA scaffold base sequence taught by EnGen on pg. 6, would produce at least an equivalently functional sgRNA synthesis system, and may improve the system by “maximiz[ing] the chances of overlap.” As shown in Fig. C below, extending the 14 nt reverse primer binding region of EnGen (bolded) to 21 nts using the complement of the scaffold base sequence taught by EnGen on pg. 6 (italics), results in a reverse primer binding region 100% identical to instant SEQ ID NO: 29.
FIGURE C.
TTCTAATACGACTCACTATAGTGCAACCTTCATTTCCCTGCGTTTTAGAGCTAGAAATAGCA
(SEQ ID NO: 29) GTTTTAGAGCTAGAAATAGCA
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have extended the sequence of the reverse primer binding region of EnGen, using the scaffold base sequence of EnGen and the guidance of Nelson. It would have amounted to choosing from a finite number of identified predictable solutions, with a reasonable expectation of success. Nelson provides parameters for “maximiz[ing] the chances of overlap” in overlap PCR, including that the overlapping region should be between 21-30bp in length. The reverse primer binding region/overlapping region of EnGen is 14 nts in length. Applying Nelson’s design principles, the skilled artisan would have arrived at 3’ extensions of at least 7 nts using the scaffold base sequence of EnGen, resulting in, for example, the nucleic acid construct in Figure C above. The skilled artisan could have pursued the finite solutions with a reasonable expectation of success because the scaffold base sequence was known, and therefore, the system could have been easily adapted using the guidance provided by Nelson, design and synthesis of nucleic acid constructs was routine in the art as evidenced by Nelson and EnGen, and because Nelson teaches that overlapping regions between 21-30 bp in length contribute to maximizing the chances of overlap. The skilled artisan would have been motivated to extend the sequence of the nucleic acid construct of because doing so would be likely to maximize the chances of overlap in the method, and therefore, would have likely provided more DNA template for production of the sgRNA.
Regarding claim 3, the term “barcode sequence” is not defined by the claim or specification, and the specification also does not provide examples of such a barcode sequence. One of ordinary skill would interpret the term “barcode” as indicating that the sequence is used as an identifier for the nucleic acid construct. Thus, “barcode” is a term which indicates an intended use for the sequence of element Y3, but does not appear to further limit the structure of element Y3. Accordingly, the term “barcode sequence” is interpreted to mean any nucleotide sequence. The reverse primer binding region rendered obvious above is a nucleotide sequence, and therefore, meets the limitations of instant claim 3.
Regarding claim 4, the claim is interpreted as requiring that the nucleic acid construct have an L2 linker sequence which may be used as a “barcode sequence.” A “linker sequence” is not defined by the claim or specification, and the specification does not provide examples of such a linker sequence. Accordingly, the term “linker sequence” is interpreted to mean any nucleotide sequence between elements, i.e., Y2 and Y3 in the instant case. For the reasons recited above in paragraph 16, the term “barcode sequence” is also interpreted to mean any nucleotide sequence. Thus, claim 4 is interpreted as requiring any nucleotide sequence (i.e., two or more linked nucleotides) between elements Y2 and Y3. Regarding element Y2, the “target DNA sequence” is also interpreted to mean any nucleotide sequence of two or more linked nucleotides. Figure D below illustrates the locations of the elements Y1, Y2, L2, and Y3 in the nucleic acid construct rendered obvious above, wherein:
FIGURE D.
TTCTAATACGACTCACTATAGGGTGCAACCTTCATTTCCCTGCGTTTTAGAGCTAGAAATAGCA
(SEQ ID NO: 29) GTTTTAGAGCTAGAAATAGCA
NNNTAATACGACTCACTATAGG (SEQ ID NO: 21)
Y1 is a T7 RNA polymerase initiation region consisting of the sequence “TTCTAATACGACTCACTATAGG” which is 100% identical to instant SEQ ID NO: 21,
Y2 is a target DNA sequence,
L2 is a “barcode sequence,”
Y3 is a reverse primer binding region consisting of the sequence “GTTTTAGAGCTAGAAATAGCA” which is 100% identical to instant SEQ ID NO: 29,
and wherein each aforementioned element is linked by a bond to adjacent element(s).
Regarding claim 5, the term “universal primer binding region” is interpreted to mean that the element Y3 is a reverse primer binding region which is held constant across a set of nucleic acid constructs. The reverse primer binding region of EnGen is held constant across a set of nucleic acid constructs (“Target-specific oligo design,” pg. 5).
Regarding claim 7, EnGen teaches the sgRNA synthesis system further includes substrate for DNA and RNA synthesis (“NTPS, dNTPS”, Fig. 3).
Regarding claim 17, the length of element Y1 rendered obvious above is 22 nts, which is within the instantly claimed range.
Regarding claim 18, the length of element Y2 in the nucleic acid construct rendered obvious above is 20 nts, which is within the instantly claimed range (“Select 20 nucleotide target sequence,” step 1, pg. 5).
Regarding claim 20, EnGen does not teach that the nucleic acid construct contains an element Y4, which is a nucleotide sequence between 5-30bp.
The teachings of EnGen and Nelson regarding the reverse primer binding region are described above and applied hereinafter. As shown in Fig. E below, extending the 21 nt reverse primer binding region rendered obvious above (bolded) to other values within Nelson’s range (i.e., up to 30 nts) results in a nucleic acid construct comprising a region Y4 (italicized).
FIGURE E. Adapted from EnGen, “The overlapped oligos,” step 4, pg. 6
TTCTAATACGACTCACTATAGGGTGCAACCTTCATTTCCCTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAAT
(SEQ ID NO: 29) GTTTTAGAGCTAGAAATAGCA
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have extended the sequence of the nucleic acid construct rendered obvious above (i.e., comprising a 21 nt reverse primer binding region), using the scaffold base sequence of EnGen and the guidance of Nelson. It would have amounted to choosing from a finite number of identified predictable solutions, with a reasonable expectation of success. Nelson provides parameters for “maximiz[ing] the chances of overlap” in overlap PCR, including that the overlapping region should be between 21-30bp in length. The reverse primer binding region rendered obvious above is 21 nts in length, and 100% identical to instant SEQ ID NO: 29. Applying Nelson’s design principles, the skilled artisan would have arrived at 3’ extensions of 1, 2, 3, 4, 5, 6, 7, 8, and 9 nts using the scaffold base sequence of EnGen, resulting in, for example, the nucleic acid construct in Figure E above. The skilled artisan could have pursued the finite solutions with a reasonable expectation of success because the scaffold base sequence was known, and therefore, the system could have been easily adapted using the guidance provided by Nelson, design and synthesis of nucleic acid constructs was routine in the art as evidenced by Nelson and EnGen, and because Nelson teaches that overlapping regions between 21-30 bp in length contribute to maximizing the chances of overlap. The skilled artisan would have been motivated to extend the sequence of the nucleic acid construct rendered obvious above, because doing so would be likely to maximize the chances of overlap in the method, and therefore, would have likely provided more DNA template for production of the sgRNA.
Regarding claim 24, EnGen teaches systems which yield total sgRNA synthesis in the instantly claimed range of 1-10µg (“72 different target-specific oligos were designed and tested for RNA yield,” Fig. 4, pg. 8), from a total volume of 20µL (“Total volume,” step 2, pg. 6). Thus, EnGen teaches systems with the properties of instant claim 24.
Claim Rejections - 35 USC § 103 – EnGen, iGEM, and Nelson, in further view of Varshney
Claims 21-23 are rejected under 35 U.S.C. 103 as being unpatentable over EnGen (EnGen sgRNA Synthesis Kit (NEB, EnGen sgRNA Synthesis Kit, S. pyogenes, Product Information and Instruction Manual, available 13 July 2017 as evidenced by The WayBack Machine; of record), iGEM (“Promoters/Catalog/T7”, published 14 August 2017, iGEM Registry of Standard Biological Parts, retrieved May 28, 2024 from The Wayback Machine; of record) and Nelson (Nelson and Fitch, 2011, “Overlap Extension PCR: An Efficient Method for Transgene Construction,” Methods in Molecular Biology, Vol. 772, pg. 459-470; of record) as applied to claims 1-5, 7, 17-18, 20, and 24 above, in further view of Varshney (Varshney et al., 27 October 2016, Nature Protocols, pg. 2357-2375; of record). The rejections that follow are new, and necessitated by Applicant’s amendments to the claims.
The terms “substrate for RNA synthesis” and “substrate for DNA synthesis” are interpreted as encompassing a single NTP or multiple NTPs (e.g., ATP, CTP, GTP, UTP), a single dNTP or multiple dNTPs (e.g., dATP, dCTP, dGTP, dTTP), respectively (pg. 4, line 25 to pg. 5, line 1). The term also encompasses the nucleic acid construct, which is a substrate for DNA or RNA synthesis.
The teachings of EnGen, iGEM, and Nelson are recited above and applied as to claims 1-5, 7, 17-18, 20, and 24 above.
None of EnGen, iGEM, or Nelson teach the amounts of each element of the sgRNA synthesis system, or the total amount of sgRNA synthesized by the system. Specifically, the references do not teach that
the molar concentration of component (m), substrate for RNA synthesis, is 1 mmol/L - 1.5 mmol/L based on the final volume of the sgRNA synthesis system (claim 21), or
the molar concentration of component (n), substrate for DNA synthesis, is 0.3 mmol/L - 0.7 mmol/L based on the final volume of the sgRNA synthesis system (claim 22), or
the ratio of component (m) to component (n) is 10:1 – 4:1 (claim 23).
Varshney teaches an in vitro sgRNA synthesis system substantially similar to that rendered obvious above which yields sgRNA (Fig. 2A and 3C; Synthesis of guide RNA using cloning-free methods, pg. 2364-2365). Regarding claim 21, Varshney teaches the system includes component (m) (Table “(B)”, pg. 2365). Varshney shows that 0.5µL each of “10 mM ATP,” “10 mM CTP,” “10 mM GTP,” and “10 mM UTP” were added to a final reaction volume of 10µL. Thus, the final concentration of each NTP was 0.5mM, for a final NTP concentration of 2mM. Regarding claim 22, Varshney teaches the system includes component (n) (Table “(A)”, pg. 2364). Varshney shows that 1µL of 10mM dNTP was added to a final reaction volume of 50µL (Table “(A)”, pg. 2364). Thus, the final dNTP concentration was 0.2mM. Regarding claim 23, given the calculations above, in the sgRNA synthesis system of Varshney, the ratio of component (m) to component (n) is 10:1 (2mM final NTP concentration to 0.2mM final dNTP concentration).
Regarding claims 21-22, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have arrived at the range of molar concentrations of NTP and dNTPs in the instant claims through routine experimentation. It would have amounted to routine experimentation with NTP and dNTP molar concentrations, by known means, to yield predictable results. MPEP 2144.05(II)(A) states that “[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.” EnGen and Varshney show that the general conditions for the sgRNA system of claims 21 and 22 were disclosed in the art. A skilled artisan would have had a reasonable expectation of success in formulating the claimed range of molar concentrations of NTP and dNTPs because I) EnGen and Varshney implement routine, well-known techniques (e.g., overlap PCR, in vitro transcription reactions) such that modifications of reaction conditions would be well within a skilled artisan’s technical grasp, II) Varshney discloses NTP and dNTP molar concentrations which are near to the claimed ranges and are used in a system similar to that of EnGen’s, and II) as evidenced by EnGen and Varshney modifying the reaction conditions for sgRNA synthesis systems was known (see EnGen, pg. 11; Varshney, Table 1, pg. 2373). A skilled artisan would have been motivated to experiment with the concentrations of NTPs and dNTPs in the system because EnGen teaches that the total sgRNA yield varies between nucleic acid constructs, and such experimentation could improve yield.
Regarding claim 23, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the 10:1 ratio of NTP to dNTPs taught by Varshney in the sgRNA synthesis system rendered obvious above. It would have amounted to using a known ratio of known elements of an sgRNA synthesis system, by known means, to yield predictable results. A skilled artisan would have had a reasonable expectation of success in using the 10:1 ratio of NTP to dNTPs because Varshney teaches such a ratio yields sgRNA in a sgRNA synthesis system substantially similar to that taught by EnGen. A skilled artisan would have been motivated to use the 10:1 ratio taught by Varshney because I) EnGen is silent as to the ratio of NTPs to dNTPs, and II) Varshney teaches a successful sgRNA synthesis system where the ratio of NTP to dNTP are known.
Response to Remarks - 35 USC § 103
Applicant’s remarks with respect to the § 102 and 103 rejections raised in the prior action have been considered. The remarks are moot because the new grounds of rejection do not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600