DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 8/8/2025 has been entered.
Note
Please note that Khaleda Bhuiya Hasan is now the examiner of record.
Application Status/Examiner’s Note
This action is written in response to applicant’s correspondence received 8/8/2025. Claims 7, 11, 22, and 45 were cancelled. Claims 1, 9, 19, 23, and 34 were amended. Claims 1-2, 9, 19, 23-24, 31-32, 34, and 42 are currently pending.
The restriction requirement mailed 4/8/2024 is still deemed proper. Applicant's elected Group I, claims without traverse in the reply filed 7/5/2024. Claims 6-7 and 11 were withdrawn from prosecution as being drawn to non-elected subject matter. Claims 6-7 and 11 were cancelled in claim amendments filed 8/8/2025. Accordingly, claims 1-2, 9, 19, 23-24, 31-32, 34, and 42 are examined herein.
Applicant incorporated into claim 1 the limitations “wherein the inhibitory RNA targeting KrasG12D comprises SEQ ID NO: 2” from cancelled claim 22 and “wherein prior to administration, the lipid-based nanoparticle is stimulated with epidermal growth factor (EGF) to induce motility to an EGF gradient at a site of the cancer to deliver the inhibitory RNAs to the site” from cancelled claim 45.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Objections
Claim 1 is objected to because of the following informalities: claim 1, reciting the term “SEQ.ID NO: 1” should read “SEQ ID NO: 1” without the period between “SEQ” and “ID”. Appropriate correction is required.
Claim 1 is objected because the administration step is not complete because there is no nexus between where the composition is administered and patient in need thereof. The Office suggests amending the claim on line 2 to recite “administering a composition to the patient in need thereof”.
Drawings
The drawings are objected to for the following reasons: 37 CFR 1.84(i) states “Words must appear in a horizontal, left-to-right fashion when the page is either upright or turned so that the top becomes the right side, except for graphs utilizing standard scientific convention to denote the axis of abscissas (of X) and the axis of ordinates (of Y).” In the current case, the words “Liver” and “Pancreas” in Figure 2 do not appear in a left-to-right hand fashion.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112 – withdrawn
Rejection of claims 9, 22, and 23 under 35 U.S.C. 112(b) or 35 U.S.C. 112
(pre-AIA ), second paragraph, as being indefinite for failing to particularly point out
and distinctly claim the subject matter which the inventor or a joint inventor (or for
applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the
invention is withdrawn in view of Applicant’s amendment cancelling claim 22 and amending claims 9 and 23.
Claim Rejections - 35 USC § 112 – new
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 9, 23-24, 31-32, 34, and 42 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 is drawn to a method of treating a cancer in a patient in need thereof comprising administering a composition comprising a lipid-based nanoparticle comprising inhibitory RNAs targeting TP53R273H and KrasG12D wherein the inhibitory RNA targeting TP53R273H comprises SEQ ID NO: 1, wherein the inhibitory RNA targeting KrasG12D comprises SEQ ID NO: 2, and wherein prior to administration, the lipid-based nanoparticle is stimulated with epidermal growth factor (EGF) to induce motility to an EGF gradient at a site of the cancer to deliver the inhibitory RNAs to the site. Claim 9 limits the scope to inhibitory RNAs comprising an siRNA, shRNA, miRNA, or pre-miRNA. Therefore, the genus of inhibitory RNAs of claim 1 reads on miRNA and pre-miRNA, which have not been have not been defined in terms of structure. Accordingly, the specification as filed does not satisfy the written description requirement for the genus as claimed.
Applicant is referred to MPEP 2163(II)(A)(3)(a) which indicates that the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. The disclosure of only one species encompassed within a genus adequately describes a claim directed to that genus only if the disclosure indicates that the patentee has invented species sufficient to constitute the genus. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by
disclosing only one species within the genus. An applicant may show possession of an
invention by disclosure of drawings or structural chemical formulas that are sufficiently
detailed to show that applicant was in possession of the claimed invention as a whole. An applicant may also show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics.
The specification discloses treating cancer in a patient in need thereof comprising administering exosomes containing siRNAs targeting TP53R273H and KrasG12D (Example 1). The specification discloses siRNA and shRNA design and an exemplary protocol for electroporation of exosomes and liposomes with siRNA or shRNA (paras 0055-0059). The specification further discloses siRNA design in terms of structure and desired effect (paras 00120-124).
The specification as filed does not disclose a single example of treating cancer in a patient in need thereof comprising administering shRNA, miRNA or pre-miRNA in lipid-based nanoparticles targeting TP53R273H and KrasG12D. The specification only mentions miRNA and pre-miRNA (paras 008 and 0047) within the genus of inhibitory RNA with regard to function without any structure.
Although many algorithms existed for designing inhibitory nucleic acids at the time of the invention, these algorithms generally served as guidelines for design and did not function to place one in possession of a genus of active inhibitors for a given target. For example, Angart et al. (Pharmaceuticals 2013, 6, 440-468; cited in PTO-892) taught that although siRNAs were routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic had proven challenging. Early efforts to design an siRNA therapeutic demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue (see abstract). One issue that renders the activity of oligonucleotide inhibitors of gene expression unpredictable is the structure of the target mRNA. Although there existed algorithms for predicting mRNA structure based on sequence alone, the actual mRNA structure in a living cell is dynamic and sequence-based predictive approaches will provide only incomplete information that can guide choices of potential target regions that are not occluded by secondary or tertiary structures (Angart at section 3.4 on page 445). See also Kwok et al. (Nature Communications 4:2971, 12 pages, 12/2013; cited in PTO-892) who taught that the structures of all but the few most abundant RNAs were unknown in vivo at the time of the invention (abstract), and that empirical physical interrogation of mRNAs can dramatically improve secondary structure prediction (first paragraph on page 2). Thus because in vivo mRNA structure was unpredictable at the time of the invention, it was unpredictable as to which oligonucleotide agents would have access to target regions and provide adequate inhibition of gene expression.
With regard to shRNAs (as recited in claim 9), an additional factor rendering Fellman et al. (Molecular Cell 41, 733–746, March 18, 2011; cited in PTO-892) taught that the requirements for efficient shRNA biogenesis and target suppression were largely unknown at the time of the invention, such that many predicted shRNAs failed to efficiently suppress their target (abstract). To address this issue, Fellman developed a large scale screening assay to empirically identify potent shRNAs (abstract), thus demonstrating a need to empirically identify active shRNAs despite the availability of prediction algorithms. So, while those of skill in the art are generally capable of developing nucleic acid agents that can hybridize and inhibit target gene expression (e.g., siRNAs, shRNAs, miRNAs, and pre-miRNAs, as recited in claim 9) through the use of design algorithms, the unpredictability in the art generally requires empirical testing of agents predicted to be active by such algorithms. Accordingly the existence of predictive algorithms, and the general state of the art at the time of the invention, did not generally place one of skill in possession of specific inhibitory oligonucleotides for a given target gene, much less two.
Because the specification as filed does not disclose a single example of miRNA or pre-miRNA targeting TP53R273H and KrasG12D, and because the general functional description of such agents does not constitute a disclosure of relevant, identifying characteristics due to the unpredictability in the art, the specification as filed fails to disclose a representative number of species of the claimed genus, and there is a failure to meet the written description requirement.
Claim Rejections - 35 USC § 103 - withdrawn
Rejection of claims 1-2, 9, 19, and 22-24, 31-32, 34, and 42 under 35 U.S.C. 103 as being unpatentable over Kalluri (WO2016201323A1, Pub date 12/15/2016) in view of Parrales (Frontiers in oncology vol. 5, article 288, published 21 December 2015) and further in view of Cheng (WO2018033110A1, pub date 2/22/2018) is withdrawn in view of Applicant’s amendment filed 8/8/2025.
Rejection of claim 45 under 35 U.S.C. 103 as being unpatentable over Kalluri (WO2016201323A1, Pub date 12/15/2016) in view of Parrales (Frontiers in oncology vol. 5, article 288, published 21 December 2015) and Cheng (WO2018033110A1, Pub date 2/22/2018) as applied to claims 1-2, 9, 19, and 22-24, 31-32, 34 and 42 above and further in view of Lee (US20170269095A1, Pub date 09/21/2017) is withdrawn in view of Applicant’s amendment filed 8/8/2025.
Claim Rejections - 35 USC § 103 – new rejection necessitated by amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-2, 9, 19, 23-24, 31-32, 34, and 42 are rejected under 35 U.S.C. 103 as being unpatentable over Kalluri et al. (WO2016201323A1; cited in the IDS filed 9/6/2022), in view of Parrales et al. (Frontiers in oncology vol. 5, article 288, published 12/21/2015; cited in the 892 mailed 4/10/2025), Cheng (WO2018033110A1, published 2/22/2018; cited in the 892 mailed 4/10/2025), and Nakase et al. (Sci Rep. 5, 10300; published 6/3/2015; cited in IDS filed 1/17/2025).
Kalluri’s disclosure is directed to lipid-based nanoparticles (e.g., liposomes or exosomes) having CD47 on their surface and comprising a therapeutic agent (e.g., a therapeutic protein, an antibody, an inhibitory RNA, and/or a small molecule drug) for the treatment of cancer (abstract and entire document).
Regarding claim 1, Kalluri teaches methods of treating a cancer in a patient in need thereof comprising administering compositions comprising exosomes (lipid-based nanoparticles) wherein the lipid-based nanoparticle comprises an RNAi therapeutic agent targeting an oncogene or a tumor suppressor gene (claims 1, 17-21; paras 0003-0005). Kalluri teaches that human plasma-derived exosomes were reported to enable RNAi delivery to recipient cells, supporting their potential utility in RNAi delivery for gene expression modification in target cells (para 0003). Kalluri further teaches that siRNA is transfected into exosomes or liposomes targeting wild type or mutant versions of developmental genes, tumor suppressor genes comprising P53 and KRAS and indicates that shRNA or siRNA is designed to specifically target a mutant version of a gene expressed in a cancer cell while not affecting the expression of the corresponding wild-type version (para 0080). Kalluri specifically teaches the inhibitory RNA targeting KrasG12D comprising SEQ ID NO: 1 with 100% sequence identity to the claimed SEQ ID NO: 2 (see alignment below).
(Qy is Applicant’s SEQ ID NO: 2)
Qy 1 GUUGGAGCUGAUGGCGUAGTT 21
|||||||||||||||||||||
Db 1 GUUGGAGCUGAUGGCGUAGTT 21
(DB is Kalluri’s SEQ ID NO: 1)
However, Kalluri does not specifically teach an inhibitory RNA targeting TP53273H comprising SEQ ID NO: 1 and further does not specifically teach
Parrales’s disclosure is directed to therapeutic strategies targeting oncogenic mutant p53 in cancers (entire document; abstract).
Regarding claim 1, Parrales teaches oncogenic gain of function activities by mutant TP53 (pg. 2, left column, para 1). Parrales further teaches that targeting and downregulating the mutant TP53 using siRNA or shRNA could be a potent strategy to reduce malignant properties of cancer cell and use it as a useful tool for cancer therapy and knocking down of TP53R273H by siRNA specific for this point mutation (pg. 8, left column, para 1).
Cheng’s disclosure is directed to a gene editing method for efficiently and precisely repairing a gene point mutation (entire document). Cheng teaches gene editing methods can be used to activate or inhibit target genes (background).
Regarding claim 1, Cheng teaches a human TP53 target site for sgRNA having 100% sequence identity to Applicant’s claimed SEQ ID NO: 1 (Example 2; Figure 13; see alignment below).
(Qy: Applicant’s SEQ ID NO: 1)
Qy 1 CAGCUUUGAGGUGCAUGUUUG 21
||||:::||||:|||:|:::|
Db 9 CAGCTTTGAGGTGCATGTTTG 29
(Db: Cheng’s target sequence; Example 2; Figure 13)
Regarding claim 1, Cheng further teaches that the mutant TP53 derived human glioma cell line comprises R273H point mutation and an sgRNA designed to specifically target the TP53R273H site of point mutation (i.e. referring to Applicant’s claimed SEQ ID NO: 1) (Example 2). Both siRNA and sgRNA are well-known in the art and specifically designed to bind target gene sequence with desired sequence manipulation (in this case TP53R273H point mutation) such as gene editing or inhibition. Accordingly, siRNA and sgRNA sequences refer to the same target binding region comprising the desired TP53 mutation (R273H).
Nakase’s disclosure is directed to active induction of macropinocytosis by stimulation of cancer-related receptors and oncogenic Kras expression and that the epidermal growth factor (EGF) receptor significantly enhances the cellular uptake of exosomes (entire document). Nakase teaches inhibitory RNAs, such as oncogenic microRNAs and siRNA delivery by exosomes (pg. 2, para 1 and pg. 5, para 2).
Regarding claim 1, Nakase teaches that stimulation of exosomes (lipid-based nanoparticles) with EGF regulates signal transduction pathways for proliferation, motility, and survival and enhances cellular uptake of exosomes to targeted cells (Figure 2). Nakase further teaches that MIA PaCa-2 cells (human pancreatic adenocarcinoma cells), which are homozygous for the K-RasG12C allele, have been reported to exhibit high levels of macropinocytosis for the transport of extracellular proteins into the cells as an important route of nutrient uptake compared with BxPC-3 cells, which express wild-type K-Ras (pg. 2, para 3).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified Kalluri’s lipid-based nanoparticles comprising inhibitory RNAs targeting KrasG12D and mutant TP53 such that it could be specifically designed to comprise SEQ ID NO: 1 and target TP53 mutation R273H, as described by Parrales and Cheng, and further stimulating the lipid-based nanoparticles with epidermal growth factor (EGF) to optimize delivery of the inhibitory RNAs to the site of the cancer, as taught in Nakase. Parrales teaches that knocking down TP53R273H by siRNA or shRNA for this point mutation could be a valuable tool for cancer therapy (pg. 8, left column, para 1). Cheng teaches targeting a specific TP53 genomic site which includes the R273H mutation comprising SEQ ID NO: 1 (Example 2; Figure 13). And Nakase teaches that enhanced delivery of exosomes by EGF stimulation. One of ordinary skill in the art would have been motivated to modify Kalluri’s lipid-based nanoparticles in order to successfully design and deliver an inhibitory RNA via exosomes that would specifically bind the target sequence comprising TP53R273H and KrasG12D to treat cancer. One would have had a reasonable expectation of success because Kalluri, Parrales, Cheng, and Nakase are directed to methods of treating cancer by delivering lipid-based nanoparticles comprising nucleic acids to inhibit gene expression. Thus, the claimed invention as a whole is prima facie obvious.
Regarding claim 2, Kalluri teaches that the lipid-based nanoparticle comprises CD47 on its surface (claim 1).
Regarding claim 9, Kalluri teaches that the inhibitory RNAs comprise an siRNA, shRNA, miRNA, or pre-miRNA (para 0007).
Regarding claim 19, Kalluri teaches that the inhibitory RNAs are siRNA (para 0007 and claim 10).
Regarding claim 23, Kalluri teaches lipid-based nanoparticles comprising different inhibitory RNAs and/or therapeutic agents (paras 0041; 0078-0082; and 0081-0097). Kalluri teaches that therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect and that a tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulation(s) comprising one or more of the agents, or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations. Kalluri further teaches that such a combination therapy can be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy (paras 0091-0097). Kalluri teaches that sh/siRNA may be designed to specifically target a mutant version of a gene expressed in a cancer cell while not affecting the expression of the corresponding wild-type version. In fact, any inhibitory nucleic acid that can be applied in the compositions and methods of the present invention if such inhibitory nucleic acid has been found by any source to be a validated downregulator of a protein of interest (para 0080). Kalluri further teaches the greater homology between the siRNA and the gene to be inhibited, the less likely expression of unrelated genes will be affected (para 0081).
Regarding claim 24, Kalluri teaches lipid-based nanoparticles further comprising an excipient (paras 0006, 0018, and 00109).
Regarding claims 31-32, Kalluri teaches that the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus (para 0087). Kalluri further teaches that the pancreatic cancer includes pancreatic ductal adenocarcinoma (paras 0017 and 0168).
Regarding claim 34, Parrales teaches oncogenic gain-of-function activities by mutant TP53R273H (pg. 2, left column, para 1). Parrales teaches that in the late stage of tumor development, cancer cells express only mutant p53 with loss-of-heterozygosity of the other wild-type p53 allele (i.e. interpreted as homozygous for the mutant p53) wherein such cancer cells often have high metastatic and chemotherapy resistant properties (pg. 2, left column, para 2). Parrales also teaches that depletion of mutant p53 (i.e. by siRNA targeting and knockdown) is an effective strategy to suppress tumor progression (pg. 2, left column, para 2).
Regarding claim 42, Kalluri teaches the origin and isolation of exosomes used in the therapeutic treatment by indicating that exosomes are isolated from a patient in need of treatment (i.e., autologous to the patient) (para 0006).
Therefore the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Response to Arguments
Applicant's arguments filed 8/8/2025 have been fully considered but they are not persuasive. Applicant argues that Kalluri, Parrales, Cheng, and Lee, alone or in combination, do not teach or suggest the method for treating cancer as claimed in amended claim 1 (incorporating the subject matter of cancelled claim 45).
This argument is moot because a new rejection has been made without Lee and with Kalluri, Parrales, Cheng, and Nakase. The new rejection was necessitated by amendment because the amendment of claim 1 included subject matter of claim 45 and from the specification as filed, including at least at ¶ [0063], as well as ¶ [0046] and ¶¶ [00209]-[00211], Examples 6 and 7 of U.S. App. No. 62/649,057, incorporated at ¶ [0063] by reference in its entirety. The claimed invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date in view of Kalluri, Parrales, Cheng, and Nakase as detailed in the 103 rejection above.
Applicant argues that a POSITA would not be motivated to combine two different inhibitory RNAs targeting two distinct cancer genes (TP53R273H and KrasGl2D) within a lipid-based nanoparticle composition because TP53 and KRAS mutations drive cancer through different biological mechanisms. TP53R273H is a gain-of-function mutation in a tumor suppressor gene, while KrasG12D is an activating mutation in an oncogene. Therapeutic strategies targeting these mutations often require distinct delivery systems, dosing regimens, and cellular contexts, making their simultaneous targeting scientifically and clinically non-obvious. Applicant argues that there is also no clear teaching or suggestion in the prior art that co-delivery of inhibitory RNAs targeting both TP53R273H and KrasG12D would result in a synergistic or additive therapeutic benefit. Applicant further argues that combining multiple inhibitory RNAs increases the complexity of nanoparticle design, potentially affecting stability, loading efficiency, and biodistribution and also raises the risk of off-target gene silencing, immune activation, or unintended interactions between the RNA molecules, which a POSITA would seek to avoid. Applicant argues that accordingly, the art cited by the Office fails to provide any motivation or reasonable expectation of success for combining two distinct inhibitory RNAs targeting TP53R273H and KrasG12D, as in Applicant's claim 1 because these mutations involve separate oncogenic pathways and therapeutic strategies, and their co-delivery introduces significant design and biological complexities not addressed or suggested by the cited references.
The Office disagrees.
First, regarding Applicant’s assertion that co-delivery of inhibitory RNAs targeting both TP53R273H and KrasG12D would result in a synergistic or additive therapeutic benefit, Applicant has not provided clear evidence to support this. The specification on pages 5-6 and pages 44-45 and Drawings at Figures 1B and 1C disclose data resulting from delivery of exosomes comprising siRNA targeting TP53R273H and exosomes comprising siRNA targeting both TP53R273H and KrasG12D. In Figures 1B and 1C, engineered exosomes comprising siRNA targeting both TP53R273H and KrasG12D appear to have a more pronounced effect on tumor growth (monitored by IVIS imaging and expressed as total flux (p/s)) compared to exosomes comprising siRNA targeting only TP53R273H. However, it cannot be ruled out from the data provided that the effect observed may have been the result of the exosomes comprising siRNA targeting KrasG12D alone rather than a synergistic or additive effect from the combination of both targets. Accordingly, this argument is not persuasive.
Second, as discussed in the 103 rejection above, Kalluri teaches that therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, that a tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulations comprising one or more of the agents, or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations. Kalluri further teaches that such a combination therapy can even be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy (paras 0091-0097). Kalluri teaches that sh/siRNA may be designed to specifically target a mutant version of a gene expressed in a cancer cell while not affecting the expression of the corresponding wild-type version and that any inhibitory nucleic acid that can be applied in the compositions and methods if such inhibitory nucleic acid has been found by any source to be a validated downregulator of a protein of interest (para 0080). Kalluri further teaches the greater homology between the siRNA and the gene to be inhibited, the less likely expression of unrelated genes will be affected (para 0081). Thus, one of ordinary skill in the art would have considered these in designing a method of treating cancer with optimal delivery of multiple gene targets specific to cancer, and especially pancreatic ductal adenocarcinoma. Therefore the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KHALEDA B HASAN whose telephone number is (571)272-0239. The examiner can normally be reached IFP, Monday - Friday 7:30am-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KHALEDA B HASAN/Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636