Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
The text of those sections of Title 35, U.S. Code not included in this action can be found
in a prior Office action.
This application is in response to the papers filed on July 25, 2025. Pursuant to the amendment filed on July 25, 2025, claims 3,5-6,9,12-13,15,17,19-21,23,25-28,30,32-37,39,41 and 43 are currently pending. Claims 9, 12-13, 15, 17, 19-21, 23, 25-28, 30, 32-37, 39, 41 and 43 were previously withdrawn in the Office Action dated July 25, 2025. The restriction requirement was previously made FINAL in the Office Action dated July 3, 2024.
Therefore, claims 3, 5-6 are currently under examination to which the following grounds of rejection are applicable.
Response to Arguments
Maintained Objections/Rejections in response to Applicants’ arguments or amendments:
Claim Rejections - 35 USC § 103
Claims 3, 5-6 remain rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al . (US 8,771,945 B1; hereinafter ‘Zhang’; of record) in view of Kim et al. (Blood, The Journal of the American Society of Hematology 129.9 (2017): 1155-1165; hereinafter ‘Kim’; of record), and Clough et al. (“132. Targeting the BTK locus in primary human hematopoietic cells with TALENs and AAV donor template." Molecular Therapy 24 (2016): S54; hereinafter ‘Clough’).
Claim 3 is directed to a gene editing composition comprising: a) a Cas protein or a polynucleotide encoding a Cas protein; b) a guide-RNA (gRNA), wherein the gRNA comprises a nucleotide sequence set forth in SEO ID NOs: 9-17; and c) a repair template comprising a functional BTK gene or fragment thereof.
Zhang teaches a gene editing composition comprising: a) a Cas protein or a polynucleotide encoding a Cas protein (col 16, ln 32-43 , col 18, ln 17-19); b) a guide-RNA (gRNA) (col 12, ln 8-18); and c) a repair template capable being integrated during homologous recombination via homology directed repair (Example 7; Fig. 21B). Furthermore, Zhang describes the CRISPR complex can target the BTK gene encoding a functional protein in relation to B cell receptor signaling ((Table C); col. 30, lines 1-6).
Zhang does not teach the gRNA comprises a nucleotide sequence set forth in SEO ID NOs: 9-17.
Kim teaches using a CRISPR-Cas9 system to knockout BTK expression, wherein several gRNAs were designed by a readily available sgRNA design tool then subsequently employed (“Materials and methods,” “BLK and BTK knockout using CRISPR-Cas9 system”). Kim describes the specific sgRNAs employed, wherein the BTK1 sequence is closely related to instant SEQ ID NO: 11. Particularly the primers of BTK1, “BTK1 top” and “BTK1 bottom,” reveal a highly similar region to the claimed SEQ ID NO: 11 as seen in the highlighted region provided in Table 1 below, but does not include the last nucleotide on the 3’ end (thymine) (Supplemental, p 4; Table 1 below). Based on these sequences, the sgRNA of Kim is different from instant SEQ ID No: 11 by one nucleotide.
The human BTK mRNA transcript, specifically NM_000061.2 as described in the specification on p 41, reveals that from 5’-3’ direction the sequence is ATGAGTATGACTTTGAACGT|GGG (Sequence provided below in Figure 1). The last three nucleotides are guanine repeats which would be used as a PAM site for Cas9, being that the endonuclease recognizes a 5’-NGG-3’ sequence. Therefore, it could be seen that with regard to the BTK sequence, there would be a high expectation of binding by the gRNA and subsequent PAM recognition due to the next three nucleotides being 5’-TGG-3’.
Table 1:
Sequence Identity
Sequence (5’-3’)
SEQ ID NO: 11 (Instant App.)
ATGAGTATGACTTTGAACGT
SEQ ID: BTK1 top
CACCGTATGAGTATGACTTTGAACG_
SEQ ID: BTK1 bottom [Rev Comp.]
GTATGAGTATGACTTTGAACGGTTT
Figure 1:
PNG
media_image1.png
781
766
media_image1.png
Greyscale
Kim teaches a sequence identical to the full length of the nucleotide sequence set forth in SEQ ID NO: 11 except for the last nucleotide on the 3’ end (thymine), e.g., T → G. However, Kim does not teach a repair template that is a functional version of BTK, but rather uses the gene editing composition to knockout the BTK gene.
Clough teaches targeting the BTK locus in primary human hematopoietic cells with TALENs and AAV donor template to treat X-linked agammaglobulinemia (XLA), a rare immunodeficiency, that is caused by mutations in the Bruton’s Tyrosine Kinase (BTK) gene. Clough describes a strategy to edit the endogenous BTK locus in primary human T-cells, targeting a codon-optimized BTK cDNA into the first coding exon of BTK using BTK specific DNA nucleases and donor template (abstract)
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the prior art elements according to known methods to yield the predictable result of a gene editing composition capable of editing BTK. In particular, Zhang teaches a gene editing composition that employs all the limitations of the claimed composition except for the specific gRNA sequences, and further states such compositions can be used to target BTK. In respect to the remaining limitations, Kim teaches CRISPR to specifically target BTK by providing one sgRNA sequence which is identical to the nucleotide sequence set forth in SEO ID NO: 11 except for the last nucleotide on the 3’ end (thymine), e.g., T → G, and Clough teaches the use of the repair template to complement homology directed repair to resolve XLA that is caused by BTK mutants. Therefore, the combination of the prior art elements would have led one of ordinary skill to arrive at this invention.
Secondly, it would have been prima facie obvious to have optimized the sgRNA sequences described by Kim based on the presence of a PAM site in the target region of the BTK gene. Such optimization would have been possible based on the gRNA site tools readily available as Applicant has described in the Specification (p 38-39) along with Kim (described above) in view of the sequences of the BTK gene/transcript being known. There is an expectation that despite the one nucleotide difference in the gRNA provided by Kim, that the sequence would remain functional based on the presence of the NGG site or PAM site, and based on Kim teaching the gRNA capable of binding to the template sequence followed by cleavage.
Regarding claim 5, Zhang teaches a polynucleotide encoding the gene editing composition (p 53, par 2) or a vector comprising the polynucleotide (p 23, par 2; p 27, par 2).
Regarding claim 6, Zhang teaches the polynucleotide as a cDNA encoding the gene editing composition (Fig 22; p 13, par 2; p 53, par 2).
Response to Applicants’ Arguments as they apply to the rejection of claims 3, 5-6 under 35 USC § 103
Starting on page 7 of the remarks filed on July 25, 2025, Applicants essentially argue the following:
“Applicant traverses and submits that the instant claims are non-obvious over the combination of cited references in the least because there would have been no motivation to use let alone modify the gRNA of Kim et al. as part of a gene editing composition with predictable results. It is respectfully noted that the mere fact that references can be combined or modified does not render the resultant combination obvious unless the results would have been predictable to one of ordinary skill in the art.”
Applicant states that "knock-in" or "gene editing" approaches, are more challenging and require complex optimization processes than knock-out approaches. The Applicant describes the Kim references that teaches that knock-outs rely upon a different editing pathway in comparison to knock-in, i.e. non-homologous-end joining (NHEJ) pathway versus homology-directed repair (HDR) pathway. Based on this difference, the Applicant states, “Without more, this difference alone renders unpredictable any efforts to apply the gRNA of Kim et al. to the methods of Zhang et al. or Clough et al., let alone modify the gRNA of Kim et al. for such a purpose.”
In response to the argument it has been fully considered but is not persuasive due to the following reasons:
Regarding these arguments, , the design and selection of gRNAs is considered routine optimization based on the genome sequence and tools for determining efficient sgRNAs being readily available. This is supported by Kim stating “sgRNA design and cloning were performed according to Ran et al’s method with use of a CRISPR design tool (http://crispr.mit.edu).”, followed by knocking out BTK with three different gRNAs to determine efficiencies. This is presented in Fig. 4A in which all three of the used BTK sgRNAs revealed decreased cell viability compared to the EV control for the conducted XTT assay. In respect to the knockout versus repair pathways (HDR:NHEJ), Zhang teaches CRISPR-Cas9 can be used for either pathway wherein a repair template may be supplied for proper repair of the target gene. Additionally, Clough teaches that TALENs targeting BTK can use a repair template after cleavage for increased HDR. SgRNA function by recognizing a complementary target sequence, and despite Kim teaches using a sgRNA to recognize a complementary sequence for the CRISPR-Cas9 system to cleave DNA for BTK silencing/knockout, it is expected that the sgRNA would recognize the complementary sequence for cleave by the CRISPR-Cas9 system for subsequent insertion of the repair template for successful HDR. Therefore, in view of these teachings it is expected that after cleavage via the sgRNA of Kim, that repair would occur via HDR when the BTK repair template is supplied as described by Clough. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
It is noted by the Examiner that the claims are not restricted to a specific gRNA for which the repair template is used in conjunction with for HDR, but rather the gene editing composition comprises several different gRNAs that are not held to any sequence similarity. Arguments pertaining to unexpected results such as the percentage of HDR::NHEJ, are only meaningful in view of a specific gRNA, e.g. 100 % sequence similarity, in combination with findings of using this particular gRNA.
New Grounds of Rejection
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 3, 5-6 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
a gene editing composition comprising: b) a guide-RNA (gRNA), wherein the gRNA consists of a nucleotide sequence 100% identical to SEQ ID NO: 11 (guide RNA 3; “G3”),
it does not reasonably provide enablement for the remaining SEQ ID Nos: 9, 10, and 12-17 (G1, 2, 4-9). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The factors to be considered in determining whether undue experimentation is required are summarized In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). The Court in Wands states: "Enablement is not precluded by the necessity for some experimentation such as routine screening. However, experimentation needed to practice the invention must not be undue experimentation. The key word is 'undue,' not 'experimentation.' " (Wands, 8 USPQ2d 1404). Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. "Whether undue experimentation is needed is not a single, simple factual determination, but rather is a conclusion reached by weighing many factual considerations." (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: (1) the quantity of experimentation necessary, (2) the amount or direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims. While all of these factors are considered, a sufficient amount for a prima facie case is discussed below.
Claim 3 is directed to a gene editing composition comprising: a) a Cas protein or a polynucleotide encoding a Cas protein; b) a guide-RNA (gRNA), wherein the gRNA comprises a nucleotide sequence set forth in SEQ ID NOs: 9-17; and c) a repair template comprising a functional BTK gene or fragment thereof. The Specification adequately describes the claimed gRNA sequences wherein they were used to cause disruption in the BTK gene (Fig. 2A-C), yet it can be seen that only that G3 and G9 (less effective than G3) provided adequate disruption, and therefore the remaining examples employ G3. As a whole, there is insufficient support that the remaining gRNA sequences outside of G3 would be effective in the gene editing composition for the BTK gene.
(1) Quantity of experimentation needed: There is not considerable experimentation required to use SEQ ID Nos: 9, 10, and 12-17 (G1, 2, 4-9) based on Example 2 clearly describing them being tested for the disruption of the BTK gene. The section states, “FIG. 2B shows percent(%) disruption at the BTK locus with guides G1 through G9 as determined by T7 endonuclease (New England Biolabs). Percent disruption was quantified using Licor Image Studio Lite software. Guide G3 was used in experiments in subsequent figures.” As depicted in Fig. 2B, listed below, the % disruption was effective for only G3 and G9. However, there is considerable experimentation required to test SEQ ID Nos: 9, 10, and 12-17 (G1, 2, 4-9) in combination with a BTK repair template comprising a functional BTK gene or fragment thereof.
PNG
media_image2.png
447
552
media_image2.png
Greyscale
(2) Amount or direction or guidance presented & (3) the presence or absence of working examples: Applicants adequately describe using a gene editing composition comprising the claimed elements (a)-(c), however they fail to show the entirety of element (b) in combination with (a) and (c), specifically the gRNA comprising a nucleotide sequence set forth in SEQ ID Nos: 9, 10, and 12-17.
The remaining working Examples, other than Example 2 described above, employ only gRNA 3 (G3) for editing with Cas9, specifically Examples 3 and 5.
In reference to gRNAs structure and function , the Specification states, “ A guide RNA (gRNA) comprises two segments, a DNA-binding segment and a protein-binding segment. In some embodiments, the protein-binding segment of a gRNA is comprised in one RNA molecule and the DNA-binding segment is comprised in another separate RNA molecule. Such embodiments are referred to herein as "double-molecule gRNAs" or "two-molecule gRNA" or "dual gRNAs." In some embodiments, the gRNA is a single RNA molecule and is referred to herein as a "single-guide RNA" or an "sgRNA." The term "guide RNA" or "gRNA" is inclusive, referring both to two-molecule guide RNAs and sgRNAs.
The protein-binding segment of a gRNA comprises, in part, two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex ( dsRNA duplex), which facilitates binding to the Cas protein.
The DNA-binding segment ( or "DNA-binding sequence") of a gRNA comprises a nucleotide sequence that is complementary to and capable of binding to a specific sequence target DNA sequence. The protein-binding segment of the gRNA interacts with a Cas polypeptide and the interaction of the gRNA molecule and site-directed modifying polypeptide results in Cas binding to the endogenous DNA and produces one or more modifications within or around the target DNA sequence. The precise location of the target modification site is determined by both (i) base-pairing complementarity between the gRNA and the target DNA sequence; and (ii) the location of a short motif, referred to as the protospacer adjacent motif (PAM), in the target DNA sequence. The PAM sequence is required for Cas binding to the target DNA sequence” (p 27). The section then further describes the PAM recognition site and its proximity to the target modification site.
On page 34, a section directed to “gRNAs” reiterates the structure and functions described earlier. There is further information regarding percent similarity of the DNA binding segments of the gRNAs with the complementary strand. In reference to the claimed the claimed sequences, the Specification describes, “In some embodiments, the DNA-binding segments of the gRNA sequences bind to a target DNA sequence that is at least 90% identical to one of the sequences in Table 3… In some embodiments, the DNA-binding segments of the gRNA sequences bind to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 3.” The section then describes varying sequence alignment similarity thresholds for the DNA binding segments, in addition to different modifications and different locations thereof on the gRNAs.
Altogether, the Specification provides extensive information relating to gRNA design; however, there remains a lack of working examples of the total gene editing composition with each of the gRNAs.
(4) Nature of the invention & (8) the breadth of the claims: As described above, claim 3 includes gRNA sequences that have been shown to be poor in editing of the BTK gene, and moreover have not been used in combination with a repair template comprising a functional BTK gene or fragment thereof. The nature of the invention is a composition for editing of the BTK, yet it appears doubtful that the composition can effectively edit when using SEQ ID Nos: 9, 10, and 12-17.
(5) State of the prior art:
The Specification provides sufficient information relating to the BTK gene wherein a large number of mutations of the gene causes X-linked agammaglobulinemia. There is information relating to different approaches to treating these mutations, e.g. integration of a self-inactivating lentiviral vectors (LV) encoding BTK cDNA under the control of the native proximal BTK gene promoter. The Specification then deals with using a gene editing composition requiring gRNAs and Cas9 or an approach utilizing TALENS to for effective gene editing.
In reference to CRISPR, and more specifically gRNA design and testing, Mohr et al. 2016 describes that the design of gRNAs must also be coupled with the intended application. Depending on the application, the appropriate position of gRNA(s) relative to the transcription or translation start site of the target gene might be different than the appropriate position of gRNA(s) intended for other applications, e.g. knockout, knock-in allele, CRISPR-activation, CRISPR interference. Additionally, gRNAs need to be tested for off-targets, and based on known genome sequences researchers have developed algorithms for predicting off-targets effects and maximal effectiveness at the target site. However, off-targets remains a real concern for the technology (p 3232-3233) Figure 1 describes a workflow in which gRNAs are designed, tested, analyzed, and selected for a CRISPR system.
Zhang et al 2016 reinforces the concern of off-targets, “The off-target activity is especially of great concern in medicine where it could produce unwanted and potentially pathologic consequences.” (p 166, col 2); “Because the CRISPR-Cas9 DSB activity is modulated solely by a single 20 nucleotide gRNA and is tolerant to some base pair mismatches between gRNA and the target DNA, there is a possibility that it could cut at genomic locations only partially complementary to the gRNA.” (p 169, col 1). In attempt to address these issues bioinformatics tools for gRNA design and selection have been improved, using different gRNA lengths, and using inducible CRISPR-Cas9 as well as applying the CRISPR Cas9 protein–gRNA complex directly. Zhang describes these attempts have had limited success due because the target DNA sequences and genetic context are different for each DNA target (p 169, col 2).
In the instant case, the Applicant have designed and tested the gRNAs of SEQ ID NOs: 9-17, and have found that only SEQ ID NO:3 was efficient based on percent(%) disruption at the BTK locus, wherein G3 was the only used sgRNA thereafter.
(6) Relative skill of those in the art: The level of skill in the art is high.
(7) Predictability or unpredictability of the art: There is a high predictability that the gRNA comprising a nucleotide sequence set forth in SEQ ID Nos: 9, 10, and 12-17 will not function in the gene editing composition based on these sequences not functioning in BTK disruption as seen in Fig. 2B.
Based on this analysis, the Specification does not provide an enabling disclosure for the full scope of gRNAs listed in claim 3 in respect to functioning in the gene editing composition. This is fully supported by Fig. 2B, and moreover the lack of teaching using these gRNAs in the Examples, with the exception being G3 (SEQ ID NO: 11), and lastly, the prior art supporting the challenges that exist with gRNA design, especially in the case of off-targets and effective editing.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 3 , 5 and 6 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Claim 3 is indefinite in the recitation “ a functional BTK gene or fragment thereof” as it is unclear as to “the function ” or functions that are intended as being encompassed by the noted phrase. Genes are known in the prior art to have numerous functions , both specific and general. For example, all genes of a sufficient length are known to be transcribed to produce a functional RNA. It is suggested that applicant clarify the intended meaning of the noted phrase.
Conclusion
Claims 3, 5-6 are rejected. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MICHAEL A RIGA whose telephone number is (571)270-0984. The examiner can normally be reached Monday-Friday (8AM-6PM).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria G Leavitt can be reached at (571) 272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MICHAEL ANGELO RIGA/Examiner, Art Unit 1634
/MARIA G LEAVITT/Supervisory Patent Examiner, Art Unit 1634