Office Action Predictor
Last updated: April 16, 2026
Application No. 17/054,233

METHOD FOR DETECTING GUT MICROORGANISM IN A SAMPLE USING NORMAL GUT FLORA AS INTERNAL CONTROL

Final Rejection §103
Filed
Nov 10, 2020
Examiner
WOOLWINE, SAMUEL C
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seegene, INC.
OA Round
6 (Final)
61%
Grant Probability
Moderate
7-8
OA Rounds
3y 7m
To Grant
70%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allow Rate
515 granted / 843 resolved
+1.1% vs TC avg
Moderate +9% lift
Without
With
+8.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
54 currently pending
Career history
897
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
36.2%
-3.8% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
28.2%
-11.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 843 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Response to Amendment The amendment filed 10/30/2025 is acknowledged. Regarding the Office action mailed 07/30/2025: The rejection of claim 9 under 35 USC 112(d) is moot as this claim has been cancelled. The rejection of claims 1, 2, 6, 7, 9 and 11-14 under 35 USC 103 over Battrell (US 2013/0130262) in view of Leutenegger (US 2015/0275294), Gibson (US 2019/0290675) and Field (US 2004/0033547) is moot with regard to claims 9, 12 and 13 as these claims have been cancelled. The rejection is withdrawn for the remaining claims in view of the amendment requiring particular primers for the endogenous internal control nucleic acid. New grounds of rejection are set forth below. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 2, 6, 7, 11 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Battrell (US 2013/0130262, previously cited) in view of Leutenegger (US 2015/0275294, previously cited), Gibson (US 2019/0290675), Borisy (US 2010/0323345) and GenBank HE608159 [online] 10 May 2012 [retrieved on 31 Jan 2026] retrieved from https://www.ncbi.nlm.nih.gov/nuccore/HE608159. Regarding claim 1, Battrell disclosed: A method for detecting a nucleic acid of a gut microorganism in a sample using a nucleic acid of a bacterium as an endogenous internal control nucleic acid selected from a normal gut flora, Example 1, paragraph [0153]: “By example, the apparatus of the invention is shown to be useful in diagnosis of infectious disease by detection of the nucleic acids of a pathogen in a human sample such as feces. Of interest by way of illustration were the rfb gene useful in genetically detecting Enterobacteriaceae-like O-antigen serotype and the stx1 and stx2 genes (for shigatoxins). These genes are found for example in Shigella, Salmonella, Campylobacter, and Escherichia coli serotypes of interest in diarrheal disease.” Shigella, Salmonella, Campylobacter and Escherichia coli are all “gut microorganisms”. Paragraph [0154]: “Bacteroides DNA was used as an internal positive control on the amplification…”. Bacteroides is normal gut flora. the method comprising: collecting and preparing the sample; This is implied by Battrell’s disclosure of “detection of the nucleic acids of a pathogen in a human sample such as feces” (paragraph [0153]). In addition, Battrell disclosed (abstract) a device “for performing a diagnostic, molecular or biochemical assay thereon, where all dried and/or liquid reagents necessary for the assay are contained in the cartridge and the assay requires only the addition of sample.” This also implicitly discloses the collection of a sample. Battrell disclosed the device comprised microfluidic subcircuits “for extraction, amplification and detection of a nucleic acid target or targets” (paragraph [0088]). Extraction constitutes a “preparing” of the sample. performing an amplification reaction of a nucleic acid in the sample using (i) a pair of primers for amplifying the nucleic acid of the gut microorganism; and (ii) a pair of primers for amplifying the nucleic acid of the bacterium as the endogenous internal control nucleic acid selected from the normal gut flora, wherein the bacterium selected from the normal gut flora is Bacteroides spp., Example 1, paragraph [0154]: “Diluted samples 250 uL were loaded for analysis onto a cartridge of the invention. These cartridges contained all required dried and liquid reagents for PCR and molecular beacon amplicon detection. After DNA extraction, target and primers were denatured at 94 C for 2 minutes and then cycled for PCR amplification at about 12 sec per thermal cycle…Bacteroides DNA was used as an internal positive control on the amplification…”. This implicitly discloses a pair of primers for a gut microorganism as previously recited in paragraph [0153] (Shigella, Salmonella, Campylobacter and Escherichia coli) as well as Bacteroides, since PCR employs a pair of primers for each target to be amplified. See also paragraph [0095]: “Typically, nucleic acid amplification or extension involves…primers or primer pairs that bind to the template...”. detecting a resultant of the amplification reaction; Example 1, paragraph [0155]: “A FAM-labelled probe for bacteroides is detected by a first fluorescence (excitation 485 nm, emission 535 nm). A CAL fluor Red 610-labelled probe (excitation 590 nm, emission 610 nm) is used to detect the target analyte in this assay. Biplex amplification products were detected…”. Regarding the Bacteroides being used as an “endogenous” control, Battrell states ([0154]): “Negative fecal swabs were diluted in 2.5 mL of PBS and spiked with O157:H7 bacterial culture.” A fair reading of this passage would be understood to describe a “proof-of-principle” experiment for an assay for detecting E. coli O157:H7 (a pathogenic gut bacteria). The term “negative fecal swabs” connotes the presence of feces on the swabs, which were “negative” for E. coli O157:H7. One would understand that, in an actual (clinical) assay, the swabs would be used to collect fecal samples from subjects to test for the presence of E. coli O157:H7. If one wanted to test bacterial culture of E. coli O157:H7 (i.e., a culture known to contain E. coli O157:H7), and simply wanted to “spike in” an exogenous amplification control, there would be no reason to use a fecal swab to provide such a control, as opposed to some pure preparation control DNA. Nor would there be a reason to choose DNA of Bacteroides (a known human gut bacteria) for such a control. On the contrary, one of ordinary skill in the art would have understood precisely what Battrell’s reasoning was: that Bacteroides, being normally present in human gut (and feces), would serve as an endogenous amplification control in fecal swabs being tested for the presence of E. coli O157:H7. Regarding claim 2, Battrell discloses extracting as discussed above. Regarding claim 7, Battrell disclosed Bacteroides, which is a normal human gut flora. Regarding claim 11, Battrell disclosed (paragraph [0098]): “Fluorescent products can be assayed at the end of the assay, or by measuring the amount of amplified product in real time.” Regarding claim 14, Battrell disclosed the PCR cycles were about 12 seconds each (paragraph [0154]). This is a “fast” PCR method. Battrell did not explicitly disclose: determining a validity of the amplification reaction of the nucleic acid of the gut microorganism by using a resultant of the amplification reaction of the internal control nucleic acid; or determining whether the nucleic acid of the gut microorganism is present or not in the sample by (i) the determined validity and (ii) the resultant of the amplification reaction of the nucleic acid of the gut microorganism as recited in claim 1. Battrell also did not explicitly disclose: wherein the resultant of the amplification reaction of the nucleic acid of the gut microorganism is determined to be invalid when the internal control nucleic acid is not detected as recited in claim 6. However, these assessments would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the application, since Battrell disclosed the use of an internal control for amplification, and it was known to assess the validity of the assay based on the amplification of the control. For example, Leutenegger disclosed (paragraph [0191]): “Where both the target nucleic acids and an internal positive control do not amplify, then PCR inhibition or extraction failure is assumed and the assay test result is disregarded. If target is amplified and internal control is not amplified then it is concluded that the target nucleic acids are present in a much greater concentration than the internal control nucleic acids. This positive result can be considered valid, provided that all negative controls have the expected negative result. If the target is not amplified and the internal control and/or internal positive control is amplified, then it is concluded that the test is valid and negative for the target.” Battrell also did not disclose detecting a drug-resistant gut microorganism, or more specifically vancomycin-resistant Enterococci, as recited in claim 1. The particular example noted in Battrell was for detection of E. coli O157:H7. However, Battrell clearly did not intend to limit to only this pathogen, as Battrell also mentioned other pathogens (Shigella, Salmonella, Campylobacter; paragraph [0153]). Gibson discussed vancomycin-resistant Enterococci (paragraph [0528]): Bacteria of the genus Enterococcus are common members of the gut microbiota. Vancomycin-resistant members of this genus, commonly E. faecalis and E. faecium, can cause vancomycin-resistant enterococci (VRE) colonization and infection. Subjects colonized with VRE may present with a VRE-positive stool sample, rectal swab, perirectal swab, or sample from another body site. Vancomycin resistance can be assessed by bacterial culture or by PCR-based assays that detect vancomycin resistance (Van) gene operons. Although colonized subjects may be asymptomatic, this population is at increased risk for infection with VRE. Subjects with VRE infection may present with diarrhea, fever, chills, urinary tract infection (UTI), bacteremia, endocarditis, intra-abdominal and pelvic infection, respiratory infection, or infection at another body site. It would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the application to modify the methods disclosed by Battrell for detection of vancomycin-resistant Enterococci, since Gibson disclosed this to be a human pathogen of significance. It would also have been obvious to use rectal swabs as a sample, as this was also disclosed by Gibson. Furthermore, given that Enterococcus was also a gut pathogen, it would have been obvious to make use of Bacteroides as an endogenous internal amplification control, just as Battrell did for the detection of E. coli, since Bacteroides would have been expected to be present on rectal swabs taken as a sample for detection of Enterococcus. Battrell also did not disclose that the primers for amplifying nucleic acid of Bacteroides were SEQ ID NOs 7 and 8 as recited in claim 1. Borisy disclosed 16S rRNA as a target for the purpose of identifying bacteria. In particular, Borisy disclosed (paragraph [0025]): “…primers can be designed to highly variable regions of 16S/18S rRNA and thus amplify only a particular species or genus in a mixture of microorganisms.” GenBank HE608159 disclosed the sequence of the Bacteroides 16S rRNA gene. Within this sequence are found the sequences of SEQ ID NOs 7 and 8: SEQ ID NO: 7 Query 1 GGGGATGCGTTCCATTAG 18 |||||||||||||||||| Sbjct 175 GGGGATGCGTTCCATTAG 192 SEQ ID NO: 8 Query 1 CAATATTCCTCACTGCTGCC 20 |||||||||||||||||||| Sbjct 316 CAATATTCCTCACTGCTGCC 297 It would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the application to use primers and probe targeting Bacteroides 16S rRNA gene for amplifying and detecting Bacteroides DNA in the method suggested by the combined disclosures of Battrell, Leutenegger and Gibson, since Borisy taught designing primers based on 16S rRNA for amplifying particular genera or species of bacteria. In this case, Battrell’s purpose was to amplify and detect Bacteroides DNA, and the use of 16S rRNA as a target for such purpose, as well as the sequence of Bacteroides 16S rRNA, and the skill to design primers based on such sequence were known in the art as evidenced by the disclosures of Borisy and GenBank. Response to Arguments Applicant’s arguments with respect to claim(s) 1, 2, 6, 7, 11 and 14 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMUEL C WOOLWINE whose telephone number is (571)272-1144. The examiner can normally be reached 9am-5:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY BENZION can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SAMUEL C WOOLWINE/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Nov 10, 2020
Application Filed
Nov 04, 2023
Non-Final Rejection — §103
Feb 06, 2024
Response Filed
Mar 23, 2024
Final Rejection — §103
Jun 26, 2024
Response after Non-Final Action
Jul 09, 2024
Response after Non-Final Action
Jul 18, 2024
Request for Continued Examination
Jul 24, 2024
Response after Non-Final Action
Oct 05, 2024
Non-Final Rejection — §103
Jan 06, 2025
Response Filed
Feb 27, 2025
Final Rejection — §103
Jun 03, 2025
Request for Continued Examination
Jun 05, 2025
Response after Non-Final Action
Jul 26, 2025
Non-Final Rejection — §103
Oct 30, 2025
Response Filed
Feb 01, 2026
Final Rejection — §103
Mar 30, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595462
HIGH THROUGHPUT GENETIC BARCODING AND ANALYSIS METHODS
2y 5m to grant Granted Apr 07, 2026
Patent 12584167
METHOD FOR AMPLIFYING NUCLEOTIDE SEQUENCE AND SEQUENCE DETERMINATION
2y 5m to grant Granted Mar 24, 2026
Patent 12545951
SIMPLIFIED POLYNUCLEOTIDE SEQUENCE DETECTION METHOD
2y 5m to grant Granted Feb 10, 2026
Patent 12534569
FLOW CELLS
2y 5m to grant Granted Jan 27, 2026
Patent 12529097
DIGITAL ANALYTE ANALYSIS
2y 5m to grant Granted Jan 20, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

7-8
Expected OA Rounds
61%
Grant Probability
70%
With Interview (+8.9%)
3y 7m
Median Time to Grant
High
PTA Risk
Based on 843 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month