Prosecution Insights
Last updated: April 19, 2026
Application No. 17/055,061

SUBSTITUTION OF THE MESSENGER RNA CAP WITH TWO RNA SEQUENCES INTRODUCED AT THE 5-PRIME END THEREOF

Non-Final OA §103
Filed
Nov 12, 2020
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Messenger Biopharma
OA Round
3 (Non-Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
3y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
32 granted / 61 resolved
-7.5% vs TC avg
Strong +60% interview lift
Without
With
+60.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
49 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
7.3%
-32.7% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.5%
-17.5% vs TC avg
§112
28.4%
-11.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 07/11/2025 has been entered. Claim Status Claims 1-19, 22 are pending. Claims 1-8, 13, 15-18, 22 are examined here. Claims 9-12, 14, 19 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Thus, the priority to the foreign application FR1854052, filed on 05/15/2018, via its PCT application PCT/FR2019/051103, filed on 05/15/2019, is recognized. Since the priority claim has not been perfected because English translation have not been filed for either prior documents, the filing date that was used to search the art is 11/12/2020. Claim Rejections - 35 USC § 103 Rejection of claims 1-8, 13, and 15-18 is maintained, while new claim 22 is rejected as noted below. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 2, 5, 13, and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403). Regarding instant claim 1, 2, 5, 13, and 22, first the limitation of “a purified in vitro synthesized mRNA”, is a product-by-process claim and the determination of patentability is based on the product itself since the product is not defined by the process steps, nor would the manufacturing process steps impart a distinctive structural characteristics; see also Ex parte Gray cited in MPEP 2113(II): Kieft discloses various applications of RNA sequences derived from flavivirus that are resistant to the dominant cytoplasmic 5’ to 3’ exonuclease Xrn1, termed xrRNAs or Xrn1-resistant RNAs (pg. 3, line 8-10); and broadly contemplates that the current invention could remove an xrRNA sequence from its native context in the viral genomic RNA and place it within any other RNA, and thus protect any downstream sequences from degradation by Xrnl (pg.34, line 2-5), including uncapped mRNAs (Fig. 7). Claim 1 further discloses that the exonuclease resistant RNA sequence ligated to a 5’ end of a heterologous RNA sequence (pg. 46). One embodiment is introduction of an xrRNA sequence “in cis” upstream of desired heterologous mRNA sequences to improve the half-life of the heterologous mRNA sequences by protecting the RNA from exonuclease degradation (pg. 3, line 14-17). Kieft contemplates most elements that are claimed in instant application: uses a viral internal ribosome entry site (IRES) to allow translation to occur internally or in the middle of an mRNA sequence (pg. 6, line 15); discloses heterologous RNA sequences comprising an open reading frame (ORF) (pg. 5, line 3-4); Fig. 8 discloses a similar consensus sequence to xrRNA of instant claim 1: a sequence with GUCAGxxxC…GCCA..UGC…CUG and discloses stem-loops (SL) within the structure (Fig. 8A, relevant to instant cl. 5); and discloses a highly modified xrRNA-based RNA with a protein binding sequence/site or an aptamer at 3’ end (pg. 25, line 20-21). Kieft discloses “tandem copies of xrRNA” in Fig. 6, pg. 24, line 16 (relevant to instant cl. 2) A skilled artisan recognizes that RNA sequence can be dissolved in sterile water and sterile water is a pharmaceutical acceptable excipient (relevant to instant cl. 13). Kieft does not disclose the SEQ ID NO: 89 of claim 1; mRNA with two copies of xrRNA (cl. 2) nor explicitly purified in vitro synthesized mRNA transcript. Pijlman discloses XRN1 resistant sequences of the 3’-UTR of flaviviruses by demonstrating that the XRN1 resistant sequences, also termed subgenomic flavivirus RNA (sfRNA), are a unique feature of the Flavivirus genus when compared with pestivirus, hepavirus, and alphavirus and other Flaviviridae family viruses (see Fig. 1, pg. 580); the Supplemental Figure 3 provides sequence alignment between different flaviviruses of the conserved flavivirus RNA structures of the 3’UTR, with some sequences with 100% homology between the different viruses (see below); and further discloses predicted secondary RNA structure of some sequences (pg. 584). Fig. S3 of Pijlman PNG media_image1.png 306 985 media_image1.png Greyscale The recited sequence of claim 1 is GUCAGryC(n7-19)GCCA(n12-19)UGCnryCUG, with r=A or G, y = C or T (U in mRNA, SEQ ID NO: 89), while Pijlman ALF_SL-II (see figure above, 5th from top) has a GUCAGgcC(n11)GCCA(n18)UGCugcCUG sequence and so is a species of SEQ ID NO: 89 of instant claim 1 (reading on instant SEQ ID NO: 89, relevant to instant cl. 1). Pijlman’s mutational analyses identified that removal of the region identified as SL-II resulted in loss of protection of downstream sequences, and identified additional rigid secondary/tertiary RNA structures, including SL-IV, which also has the consensus sequence of claim 1, i.e. a species of SEQ ID NO: 89, that provided protection from complete degradation (pg. 583, relevant to instant cl. 2). Pijlman discloses a fragment of WNVKUN full-length and various mutational sequences cloned into pBluescript plasmid and were linearized and were transcribed in vitro (pg. 588, relevant to instant cl. 1). Kieft and Pijlman do not disclose explicitly purified in vitro synthesized decapped mRNA transcript. Pijlman cites Varnavski for various pKUN-β-gal plasmids (pg. 588). Varnavski indicates that “[t]he RNA templates were either in vitro transcribed from the C20UbHDVrep plasmid DNA (as described in reference 24 with omission of the synthetic cap analogue; lanes 2 and 3) or extracted from purified KUN virus grown in Vero cells and decapped (pg. 4396, Fig. 1). Thus purifying decapped viral transcript and synthesizing uncapped or omitting synthetic cap viral transcript is known in the art. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, a skilled artisan can substitute the xrRNA sequence upstream of uncapped or capped mRNA sequence of Kieft with Pijlman’s ALF-SL-II sfRNA sequence, upstream of a mRNA sequence and transcribed in vitro as taught by Pijlman to further stabilize or protect the uncapped mRNA from degradation and to deliver the naked mRNA to a cell. Because Pijlman and Kieft have similar mRNA sequences with xrRNA sequence at 5' end that protect downstream sequences, a person of ordinary skill in the art would have expected that substituting the Kieft xrRNA sequence with that of Pijlman's sequence would successfully result in a XRN1-protected uncapped transcript. Thus, the purified mRNA synthesized mRNA molecule lacking a cap of claims 1, 2, 5, 13 is prima facie obvious. Regarding instant cl. 22, based on Pijlman’s mutational analysis studies and Pijlman’s mutational analyses identified that removal of the region identified as SL-II resulted in loss of protection of downstream sequences, and identified additional rigid secondary/tertiary RNA structures, including SL-IV, which also has the consensus sequence of claim 1, i.e. a species of SEQ ID NO: 89, that provided protection from complete degradation (pg. 583). Further, fig. 4B of Pijlman discloses less than 5 nt. in between the stem-loops to allow for hybridization between the “spacer” and the loop structure for forming pseudo-knot structures, potentially providing structural configuration for the protective feature (Excerpt of Fig. 4B below, see dashed arrow pointing to “spacer” sequence below and the line designating an interaction for forming pseudo-knot structure). PNG media_image2.png 699 1033 media_image2.png Greyscale Thus, a skilled artisan would reasonably expect successful protection of downstream sequence introducing another stem-loop structure upstream of the xrRNA sequence with a spacer sequence equal to or less than 5 nt. due to its ability to protect the downstream sequences from Xrn1 nucleases. Claims 3 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Barrett et al. (US20080268423A1, pub. 10/30/2008, referred as Barrett). Pijlman, in their mutational studies to identify core sequences, note that an xrRNA sequence designated by their 2 dimensional structure as SL-II is essential for protection, and identify the core essential sequence of the xrRNA based on the alignment of different flaviviruses. Kieft, Pijlman and Varnavski do not disclose one of SEQ ID NO: 1-44, nor mRNA with xrRNA sequences of SEQ ID NO: 11 and SEQ ID NO: 26. Barrett disclosed a composition of flavivirus to detect flavivirus in an organism, including West Nile Virus (WNV), and discloses a contiguous nucleic acid sequence of a flavivirus (a WNV strain) as SEQ ID NO: 1 (Abstract, par. 149), which comprises both instant SEQ ID NO: 11 and SEQ ID NO: 26 (see alignment at end of 103 rejection). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have substituted the xrRNA sequence of Kieft in view of Pijlman and Barrett and arrive at the claimed invention with a reasonable expectation of success. Here, based on the core protective xrRNA sequence provided by Pijlman, a skilled artisan can identify similar consensus sequence in other flavivirus, including in a WNV flavivirus strain (SEQ ID NO: 1) of Barrett, which comprises both instant SEQ ID NOs: 11 and 26, and can be substituted in xrRNA sequence of Kieft and would successfully result in similar protective effects of a downstream sequence and a more stable mRNA. Thus, the mRNA molecule of claim 3 and 16 is prima facie obvious. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Schrum et al. (US20120251618, pub. 10/04/2012). Kieft, Pijlman and Varnavski do not disclose the EMCV IRES. The EMCV IRES is well known in the art as a strong translation initiation sequence for synthesis of mRNA from cDNA template (see Schrum et al., par. 495-496). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have substituted a viral IRES sequence of Kieft and Pijlman in view of Schrum and arrive at the claimed invention with a reasonable expectation of success. Here, Kieft contemplates the use of viral IRES sequence to allow internal translation and Schrum discloses a specific EMCV IRES that has a strong translation initiation sequence for synthesis of mRNA, thus substituting a viral IRES with EMCV IRES would result in successful translation from an internal site of a mRNA sequence. Thus, the mRNA molecule of claim 4 with EMCV IRES is prima facie obvious. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Errichelli et al. (WO2019092145A1, pub. 05/16/2019, EFD: 11/8/2017, serving as 102(a)(2)). Claim 6 recites an mRNA of claim 1 comprising at least one aptamer selected from aptamer A having the sequence of SEQ ID NO: 64 and aptamer C having the sequence of SEQ ID NO: 66; As noted above, Kieft disclose that a highly modified engineered xrRNA-based RNA, which includes at 3’ end an RNA structure, such as an aptamer, which is a protein binding structure (pg. 25, line 20-21). Kieft, Pijlman and Varnavski do not disclose an aptamer with SEQ ID NO: 64 (aptamer A) or SEQ ID NO: 66 (aptamer C). Errichelli et al. discloses extracellular vesicle (EV)-based delivery of RNA therapeutics, including mRNA (pg. 1); the EV comprises a fusion polypeptide comprising an exosomal polypeptide fused to at least one nucleic acid (NA)-binding domain wherein that domain may bind to a nucleic acid aptamer (pg. 3); the fusion polypeptide provides for highly efficient loading of NA into the EV and for effective release of NA (pg. 3); discloses that aptamer RNA sequences recognized by the fusion protein can be inserted into the 3’ and/or 5’ of the untranslated regions of an mRNA intended for loading into the EV (pg. 16); discloses one aptamer sequence is SEQ ID NO: 5 (a 37 nt. sequence which comprises instant SEQ ID NO: 64, i.e. aptamer A) which has a high affinity for a stretch of histidine amino acids (i.e. a poly-histidine tag, pg. 16, see sequence alignment below). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have substituted an aptamer of Kieft and Pijlman in view of Errichelli and arrive at the claimed invention with a reasonable expectation of success. Here, Kieft contemplates the use of an aptamer sequence at the 3' end of an mRNA structure to bind to proteins, and Errichelli’s SEQ ID NO: 5, also an aptamer sequence, binds to a polyhistidine peptide, thus substituting Errichelli’s aptamer for Kieft’s aptamer would successfully result in efficient loading of the mRNA cargo into the EV for delivery of mRNA therapeutics. Thus, the mRNA molecule of claim 6 is prima facie obvious. Claims 6 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Errichelli et al. (WO2019092145A1, pub. 05/16/2019, EFD: 11/8/2017), Divita et al. (WO2017205846, pub. date 11/30/2017) and Bhat et al. (US20190224326, pub. 07/25/2019, EFD is 03/29/2017 or 07/11/2016). The Kieft, Pijlman and Varnavski references rendered obvious an mRNA according to claim 1. These references did not teach an mRNA comprising an aptamer of SEQ ID NO: 64 or 66, nor a mRNA bound to CPP fused to a poly-histidine tag. Divita discloses that mRNAs could be complexed with cell penetrating peptides to promote uptake into cells (see e.g. par. 96 and Examples 13a-b, 14, 17, 20-25; e.g. Ex. 13b discloses CPP-mediated functional delivery of Cas9mRNA and gRNA, par. 514). In Divita’s examples the CPPs and mRNAs are complexed by electrostatic interaction. Bhat discloses guidance of conjugating molecules of interest, such as CPPs, to nucleic acids such as mRNAs (see abstract and e.g. claims 1 and 47). Thus it was known in the art to form covalent complexes of CPPs and mRNAs. In view of the teachings of Errichelli, it was known in the art that an mRNA of interest could be linked to a protein of interest by fusing the mRNA to an anti-His Tag aptamer sequence comprising SEQ ID NO: 64, and fusing a His-Tag peptide to the protein of interest and allowing the resulting molecules to form a complex based on the interaction of the aptamer and its ligand. Thus the prior art taught a variety of means of linking mRNAs of interest to proteins of interest (such as CPPs). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the mRNA containing xrRNA and his-tag aptamer of Kieft and Pijlman by applying the teachings of Errichelli, Divita and Bhat to arrive at an mRNA of interest in order to facilitate uptake of the mRNA into a cell. One of ordinary skill in the art would have been motivated to modify mRNA containing xrRNA sequence with SEQ ID NO: 64 of Kieft and Pijlman with any variety of methods useful for attaching a protein to an mRNA as taught by Divita and Bhatt. And it would have been obvious to have applied the approach of Errichelli to bind a CPP to an mRNA, whereby one would make a fusion of a His-Tag to a CPP and also fuse an anti-His Tag aptamer to the mRNA of interest. This would allow complex formation between the CPP and the mRNA, and would have been no more than the application of the known technique of Errichelli to known products (the mRNA of Kieft as modified and a CPP of Divita or Bhat) ready for improvement to yield predictable results (MPEP 2143(I)(D). One would have been motivated to apply this approach to the mRNA, which would successfully result in the uptake of the mRNA into a cell. Thus mRNA molecule of claims 6 and 7 would be prima facie obvious. Claim 18 is rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft), Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman), Varnavski et al. (2000, J. of Virology, 74, 4394-4403), Errichelli et al. (WO2019092145A1, pub. 05/16/2019, EFD: 11/8/2017, serving as 102(a)(2)), Divita et al. (WO2017205846, pub. date 11/30/2017), and Bhat et al. (US20190224326, pub. 07/25/2019, EFD is 03/29/2017 or 07/11/2016) as applied to claims 1, 2, 5, 6, 7, 13, and 22 above, and further in view of Milletti (2012, Drug Discovery Today, 17, pg. 850-860) and Klein et al. (2014, Prot. Eng. Design and Selection, 27, 325-330). Disclosure of Kieft, Varnavski, Pijlman, Errichelli, Divita and Bhat is disclosed above. Kieft, Pijlman, Varnavski, Errichelli, Divita and Bhat do not disclose a CPP of SEQ ID NO: 75-78 Milletti discloses various small cell-penetrating peptides (CPPs) of about 5-30 a.a. that can cross a cellular membrane (pg. 850); discloses three major classes of CPP: cationic, amphipathic and hydrophobic (pg. 851); discloses hydrophobic as a low net charge or have a hydrophobic motif or chemical group that is crucial for uptake regardless of the rest of the sequence (pg. 855); and discloses hydrophobic sequences of GPFHFYQFLFPPV and GSPWGLQHHPPRT (Table 6, pg. 854, these are the N-terminal peptides of SEQ ID NO: 77 and 78) (relevant to claim 18). Klein disclose flexible linkers composed of small, non-polar residues such as glycine and serine, the most common is the (Gly4Ser)n linker, which reduce linker-protein interactions and preserve protein function (pg. 325) (relevant cl. 18); Klein does not disclose (Gly4Ser)4, but discloses (Gly4Ser)n, with n value of 2, 3, 5-9, so it is routine optimization, as provided under MPEP 2144.05, to modify with a value of 4. As provided by Klein, the properties of (Gly4Ser) with n value 3, 5-9 are similar, see Fig. 4, the hydrodynamic radius are very similar, ranging from 5.9-6.1. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified mRNA complexed to a CPP fused to His-tag of Kieft, Pijlman, Errichelli, Divita and Bhat in view of Milletti and Klein and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to combine the modified mRNA complexed to CPP fused to His-tag of Kieft, Pijlman, Errichelli, Divita and Bhat with specific hydrophobic CPP noted by Milletti and fused to histidine by a linker of Klein that would successfully result in improved uptake of the modified mRNA as taught by Milletti and Klein. Claims 8 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Foeger et al. (2003, Enzyme Catalysis and Regulation, 278, p33200-33207). Rejection of claims 1 and 13 is noted above. Kieft, Pijlman and Varnavski do not discloses an mRNA of claim 1 wherein the open reading frame (ORF) encodes 2Apro protein of the HRV2 virus, nor a composition of claim 15 comprising a second mRNA with an ORF encoding a 2Apro protein sequence. Foeger et al. disclose a plasmid encoding 2A cysteine proteinase (2Apro) of human rhinovirus serotype 2 (HRV2) (pg. 33201); discloses that 2Apro binds to and cleaves eukaryotic initiation factor (eIF) 4G, which is required for cap-dependent mRNA translation (pg. 33200), thus 2Apro interferes with initiation of translation of cellular mRNA but not viral mRNAs since viral RNA translation is not cap-dependent but rather IRES dependent (pg. 33200, last sentence of paragraph bridging columns). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the mRNA molecule with ORF and viral IRES sequences of Kieft and Pijlman in view of Foeger and arrive at the claimed invention with a reasonable expectation of success. Here, Kieft discloses a mRNA with ORF and IRES sequence, and Foeger discloses an HRV2 2Apro ORF to increase IRES dependent mRNA expression, thus the combination of both HRV2 2Apro ORF and IRES in a mRNA molecule would successfully result in increased expression of mRNA with IRES sequence. Thus, the mRNA molecule of claims 8 and 15 would be prima facie obvious. Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over Kieft et al. (WO2017112492A2, pub. 06/29/2017, in IDS, referred as Kieft) and Pijlman et al. (2008, Cell Host & Microbe, 4, 579-591, referred as Pijlman) and Varnavski et al. (2000, J. of Virology, 74, 4394-4403) as applied to claims 1, 2, 5, 13, and 22 above, and further in view of Emory et al. (1992, Genes and Development, 6, 135-148). Disclosure of rejection of claims 1, 2, 5, 13, and 22 is noted above. Kieft, Pijlman and Varnavski do not disclose a stem loop comprising SEQ ID NO: 87. Emory et al. (1992, Genes and Development, 6, 135-148) discloses a 5’-terminal stem-loop (SL) structure that stabilizes mRNA in E.coli; demonstrate that an ompA mRNA 5’-terminal stem-loop prolongs mRNA lifetime and is a potent mRNA stabilizer to shield the mRNA from ribonucleases (pg. 141); demonstrated that moving the SL structure downstream by 12-16 nt. reduced the mRNA half-life to just 3-6 min, where a single SL structure’s half-life is about 17 min., about the same as wild-type dual SL structures at 5’ end (Table 1). Emory demonstrate that the stabilization by the 5’-terminal stem loop is independent of the sequence, when the SL size was reduced to 19 nt. by removing 44 nt. of original length of 63 nt., there was approximately 28% reduction in half-life (pg. 137); when the SL sequence was replaced with an entirely different but perfectly paired SL structure, the mRNA had similar stability as with original SL, suggesting “that the presence of this terminal stem-loop is more important than its sequence” (pg. 137). Although Emory does not disclose SEQ ID NO: 87, one of skill in the art can perform routine optimization of a SL sequence and structure to design a ~19 nt. length SL structure based on the study of Emory, as provided under MPEP 2144.05. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Here, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the mRNA molecule with xrRNA sequence of Kieft and Pijlman in view of Emory and arrive at the claimed invention with a reasonable expectation of success. Here, Emory discloses SL that can be optimized to provide stem-loop that prolongs mRNA lifetime and Kieft and Pijlman discloses the use of xrRNA sequence to protect the mRNA from degradation, thus the combination of both the elements will result in likelihood of success to stabilize the mRNA molecule for increased mRNA expression. Thus, the mRNA molecule of claim 17 is prima facie obvious. Response to Arguments Applicant's arguments filed 07/11/2025 (“the Remarks”) have been fully considered but they are not persuasive. The Remarks make similar arguments as previous Remarks: 1) “Kieft does not teach or suggest a in vitro synthesized mRNA molecules lacking a cap molecule” and that the RNAs are synthesized with a cap in the nucleus of transfected yeast cells and are “uncapped when translocate into the yeast cytoplasm” and point to figure 5 (pg. 5), thus are “markedly different from the molecules of the invention which are synthesized with any cap” (pg. 7); 2) “Kieft does not teach or suggest a purified RNA molecule” since Kieft’s RNAs are synthesized within the cells from plasmid (pg. 5); 3) Pijlman does not remedy these deficiencies, since their method of in vitro transcription point to a reference where a m7G caps were added (pg. 7), thus, presumably, “Pijlman does not teach that the RNA molecule is synthesized without any cap or purifying such molecules” (pg. 7); 4) “with respect to claim 5” the Remarks disputes the interpretation of claim 5, insisting the claim 5 “relates to a mRNA comprising an additional stem-loop located at the 5’ end of the 5’-UTR region that is not included in the xrRNA sequence” (pg. 7) with the instant application showing beneficial effects of the 5’-SL. The argument is not persuasive. Regarding arguments 1), 2) and 3), the issue is addressed in the action with the citation of Varnavski. Claim 5 (argument 4) requires the mRNA of claim 1, comprising a stem-loop, i.e. any stem-loop, and is located at the 5’ end of the 5’-UTR region. Here, the scope of the claim encompasses SEQ ID NO: 89, which comprises a stem-loop, at the 5’ end of the 5’-UTR; during the examination process a broad reading of the claims is allowed and required. Thus the examined claims are obvious and the rejection is maintained. Sequence Alignments SEQ ID NO: 11 alignment US-10-524-939-1 (NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report) Sequence 1, US/10524939 Publication No. US20080268423A1 GENERAL INFORMATION APPLICANT: BARRETT, ALAN APPLICANT: BEASLEY, DAVID APPLICANT: HOLBROOK, MICHAEL TITLE OF INVENTION: Compositions And Methods Related To Flavivirus Envelope TITLE OF INVENTION: Protein Domain III Antigens FILE REFERENCE: UTSG:260US CURRENT APPLICATION NUMBER: US/10/524,939 CURRENT FILING DATE: 2007-10-08 PRIOR APPLICATION NUMBER: 60/445,581 PRIOR FILING DATE: 2003-02-06 PRIOR APPLICATION NUMBER: 60/403,893 PRIOR FILING DATE: 2002-08-16 NUMBER OF SEQ ID NOS: 25 SEQ ID NO 1 LENGTH: 10962 TYPE: DNA ORGANISM: West Nile virus FEATURE: NAME/KEY: CDS LOCATION: (97)..(10389) Query Match 100.0%; Score 51; Length 10962; Best Local Similarity 78.4%; Matches 40; Conservative 11; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUCAGGCCAGAUUAAUGCUGCCACCGGAAGUUGAGUAGACGGUGCUGCCUG 51 Db 10441 GTCAGGCCAGATTAATGCTGCCACCGGAAGTTGAGTAGACGGTGCTGCCTG 10491 SEQ ID NO: 26 alignment: US-10-524-939-1(NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report)Sequence 1, US/10524939Publication No. US20080268423A1GENERAL INFORMATION APPLICANT: BARRETT, ALAN APPLICANT: BEASLEY, DAVID APPLICANT: HOLBROOK, MICHAEL TITLE OF INVENTION: Compositions And Methods Related To Flavivirus Envelope TITLE OF INVENTION: Protein Domain III Antigens FILE REFERENCE: UTSG:260US CURRENT APPLICATION NUMBER: US/10/524,939 CURRENT FILING DATE: 2007-10-08 PRIOR APPLICATION NUMBER: 60/445,581 PRIOR FILING DATE: 2003-02-06 PRIOR APPLICATION NUMBER: 60/403,893 PRIOR FILING DATE: 2002-08-16 NUMBER OF SEQ ID NOS: 25 SEQ ID NO 1 LENGTH: 10962 TYPE: DNA ORGANISM: West Nile virus FEATURE: NAME/KEY: CDS LOCATION: (97)..(10389) Query Match 100.0%; Score 45; Length 10962; Best Local Similarity 75.6%; Matches 34; Conservative 11; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUCAGACCACACUUUAAUGUGCCACUCUGCGGAGAGUGCAGUCUG 45Db 10601 GTCAGACCACACTTTAATGTGCCACTCTGCGGAGAGTGCAGTCTG 10645 SEQ ID NO: 64 alignment: CC PA (EVOX-) EVOX THERAPEUTICS LTD. XX CC PI Errichelli L, Gupta D, Hean J, Nordin J; XX DR WPI; 2019-41872V/38. XX CC PT Extracellular vesicle used in pharmaceutical composition for medicine, CC PT comprises fusion polypeptide having nucleic acid-binding domain and an CC PT exosomal polypeptide, where binding domain is PUF, Cas6 or Cas13 and NA CC PT aptamer-binding domain. XX CC PS Disclosure; SEQ ID NO 5; 42pp; English. XX CC The present invention relates to an extracellular vesicle (EV) comprising CC a fusion polypeptide having a nucleic acid (NA)-binding domain and an CC exosomal polypeptide. The NA-binding domain is of Pumilio and FBF CC homology protein (PUF), CRISPR-associated protein (Cas6), Cas13, and an CC NA aptamer-binding domain. The invention further discloses: (1) a CC polypeptide construct comprising the fusion polypeptide having NA-binding CC domain and exosomal polypeptide; (2) a polynucleotide construct encoding CC the polypeptide construct; (3) a method for producing EVs comprising: (a) CC introducing one polynucleotide construct into an EV-producing cell; (b) CC expressing the polypeptide construct in the EV-producing cell encoded by CC the polynucleotide construct, thereby generating the EVs; (4) a cell CC comprising the polynucleotide construct, the polypeptide construct and CC the EV; (5) an in vitro method for intracellular delivery of RNA cargo CC molecule, comprising contacting a target cell with the EV or at least one CC polynucleotide construct; and (6) a pharmaceutical composition comprising CC the polynucleotide construct, the polypeptide construct, the EV, the CC cell, Evs population, and pharmaceutically acceptable excipient or CC carrier. The extracellular vesicle of the invention is useful for CC delivering nucleic acid based therapeutics into target cells. XX SQ Sequence 37 BP; 5 A; 7 C; 14 G; 11 T; 0 U; 0 Other; Query Match 100.0%; Score 33; Length 37; Best Local Similarity 69.7%; Matches 23; Conservative 10; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCC 33 Db 2 GGTATATTGGCGCCTTCGTGGAATGTCAGTGCC 34 Allowable Subject Matter No claim is allowed. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Nov 12, 2020
Application Filed
Sep 14, 2024
Non-Final Rejection — §103
Dec 12, 2024
Response Filed
Apr 09, 2025
Final Rejection — §103
Jul 11, 2025
Request for Continued Examination
Jul 17, 2025
Response after Non-Final Action
Nov 26, 2025
Non-Final Rejection — §103
Mar 11, 2026
Examiner Interview Summary
Mar 11, 2026
Applicant Interview (Telephonic)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
2y 5m to grant Granted Apr 14, 2026
Patent 12570974
OLIGONUCLEOTIDES FOR CONTROLLING TAU SPLICING, AND USES THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12516322
MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12509716
FUNCTIONAL LIGANDS TO TARGET MOLECULES
2y 5m to grant Granted Dec 30, 2025
Patent 12509681
COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+60.4%)
3y 8m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month