/HEATHER CALAMITA/Supervisory Patent Examiner, Art Unit 1684 DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant canceled claims 9-22. Applicant newly adds claims 23 and 24. Claims 1-8 and 23-24 are currently pending and under examination. Any objection or rejection of record in the previous Office Action, which is not addressed in this action has been withdrawn in light of Applicant’s amendments and/or arguments. This action is Final.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4, 6, 8 and 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Morgante et al. (United States Patent Number 5,955,276, published September 21,
1999), cited on the IDS filed April 15, 2021, as evidenced by Hayden et al. (“Targeted development of informative microsatellite (SSR) markers”, Oxford University Press, Nucleic Acid Research, Vol. 29, No. 8, published February 20, 2001), cited in the July 09, 2025 office action, in view of Kurn et al. (U.S. Patent Application Publication US 2009/0203085, published August 13, 2009) cited on the IDS filed April 15, 2021. This rejection is modified as necessitated by amendments.
Regarding claim 1, Morgante teaches a method for evaluating genomic variation (Abstract). Morgante teaches generating nucleic acid fragments by fragmenting a nucleic acid, at least one of said nucleic acid fragments having a repeat motif (Column 2, Lines 35-57, Column 9, Lines 20-21 and Claim 12-a). Morgante teaches ligating an adapter molecule having an adapter sequence to the at least one of said nucleic acid fragments having a repeat motif (Column 27, Line 35—Column 28 Lines 1-6). Morgante teaches amplifying at least a portion of the at least one of said nucleic acid fragments having a repeat motif using an adapter primer (Column 31 Lines 1-24 and Claim 12-c). Morgante teaches using the adapter primers as taught by Zabeau EP 534,858 cited below (Column 16, Lines 50-52). Morgante teaches an adapter primer including a nucleic acid sequence homologous to the adapter sequence (Column 28, Lines 18-22 and Column 15, Lines 55-63, Claim 12-c, Table 1 and Example 1 of Zabeau, EP 534,858). Morgante teaches producing amplified nucleic acid fragments (Column 5, Lines 48—Column 6, lines 1-13). Morgante teaches having the adapter primer forming a second end of the amplified nucleic acid (Column 53, Lines 3-45). Morgante teaches one of skill in the art will also appreciate the unique compound SSR primers can also be used in conjunction with a variety of other primer types which include for example, non-adaptor primers, primers of fixed sequence, arbitrary primers or any primer that might hybridize with currently known or unknown dispersed repeated sequences in the genome (Column 26, lines 30-36).
Regarding claim 2, Morgante teaches wherein the repeat motif includes a nucleotide sequence including at least one of GTn, GTn-H, GTn-HV, GTn-A, V- GTn, HV-GTn, V-GTn-H, HV-GTn-HV, TGn, ACn, CAn, and a reverse complement thereof (Table 2, Column 25, Lines 35-56, Column 26, Lines 1-10 and Claim 9).
Regarding claims 3 and 4, Morgante teaches the repeat motif as discussed above.
Regarding claim 6, Morgante teaches the first nucleic acid sequence is downstream of the second nucleic acid sequence (Column 32, Lines 14-26).
Regarding claim 8, Morgante teaches wherein the nucleic acid comprises DNA (Column 6, Lines 29-31).
Regarding claim 23, Morgante teaches the adapter sequence is ligated to a 5' end and a 3' end of the at least one of said nucleic acid fragments having the repeat motif (Fig. 11). Morgante teaches amplifying includes priming the at least one of said nucleic acid fragments having the repeat motif ligated with the adapter sequence to the 5' end and the 3' end from (a) with the primer (Column 2, Lines 53-57, Column 6, Lines 25-32, Column 15, Lines 30-35). Morgante teaches elongating the primer on the at least one of said nucleic acid fragments having the repeat motif ligated with the adapter sequence to the 5' end and the 3' end (Column 5, Line 63—Column 6, Line 3, Column 12, Line 37-58, Column 16, Lines 23-29, Column 19, Lines 47-49, Column 28, Lines 13-17 and Fig. 11). Morgante teaches priming the at least one of said nucleic acid fragments having the elongated primer with the adapter primer, wherein the adapter primer does not bind to any nucleic acid fragments not having an elongated tailed primer (Column 5, Line 63—Column 6, Line 3, Column 12, Line 37-58, Column 16, Lines 23-29, Column 19, Lines 47-49, Column 28, Lines 13-17 and Fig. 11).
Regarding claim 24, Morgante teaches the at least one of said nucleic acid fragments having a repeat motif has a second repeat motif and amplifying includes using a second primer with a nucleic acid sequence complementary to the second repeat motif and a nucleic acid sequence that is at least partially non-complementary to the second repeat motif (Column 9, Lines 29-32, Column 12, Lines 43-58, Column 15, Line 54—Column 16, Line 4, Column 26, Lines 11-21, Column 27, Lines 37-39 Column 36, Lines 18-24, Column 38, Line 66—Column 39, Line 11 and Column 58, Lines 40-42).
Morgante does not explicitly teach or suggest using a tailed primer including a first nucleic acid sequence that binds to the repeat motif and a second nucleic acid sequence that does not bind to the at least one of said nucleic acid fragments having a repeat motif. Morgante does not teach or suggest the first nucleic acid sequence is complementary to the repeat motif. Morgante does not teach or suggest the second nucleic acid sequence is at least partially non-complementary to the at least one of said nucleic acid fragments having a repeat motif. Morgante does not explicitly teach or suggest having the tailed primer forming a first end of the amplified nucleic acid fragment. Morgante does not teach or suggest elongating the tailed primers. Morgante does not teach or suggest using a second tailed primer.
Hayden teaches selectively amplified microsatellite (SAM) analysis, for the targeted development of informative simple sequence repeat (SSR) markers (Abstract). Hayden teaches evaluating genomic variations (Abstract). Hayden teaches fragments having a repeat motif as well ligating an adapter molecule having an adapter sequence to the at least one of said nucleic acid fragments having a repeat motif (Page 1, Right Column, First Full Paragraph). Hayden teaches amplifying at least a portion of the at least one of said nucleic acid fragments having a repeat motif using adapter specific primer and that the adapter specific primer is homologous to the adapter sequence (Page 1, Right Column, First Full Paragraph). Hayden teaches using two primers, extending the primers as well as a second repeat motif (Page 1, Right Column, Second Paragraph).
Kurn teaches evaluating genomic variations (Page 7, [0074]). Kurn teaches a tailed primer (i.e., “Methods and compositions are provided related to the amplification of target polynucleotide sequences as well as total RNA and total DNA amplification” -Abstract and Claim 69-b, annealing a first primer or set of first DNA primers comprising a 3' end whereby a portion of the 3' end comprises a template annealing sequence and a 5' tail sequence whereby a portion of the tail sequence comprises a sequence (A)). Kurn teaches elongating the tailed primers (Page 2, [0010] and [0017]). Kurn teaches using a second tailed primer (Page 2, [0012]). Kurn teaches the tailed primer comprises a 3' end that is complementary to the template and a 5' end that is not complementary to the template (Claim 69-b and Claim 79). Kurn teaches the first nucleic acid sequence is downstream of the second nucleic acid sequence (i.e., annealing a first primer or set of first DNA primers comprising a 3' end whereby a portion of the 3' end comprises a template annealing sequence and a 5' tail sequence whereby a portion of the tail sequence comprises a sequence (A)- Claim 69-b). Kurn teaches having a tailed primer forming a first end of the amplified nucleic acid fragment (Page 2, [0010]).
It would have been obvious to one having ordinary skill in the art before the effective filing date of the claimed invention to have modified Morgante to incorporate the teachings of Kurn, using a tailed primer including a first nucleic acid sequence that binds to the repeat motif and a second nucleic acid sequence that does not bind to the at least one of said nucleic acid fragments having a repeat motif as well as using a tailed primer forming a first end of the amplified nucleic acid fragment because in accordance with MPEP 2141 section Ill (A) citing KSR International Co. v. Teleflex Inc. (KSR), 550 U.S. 398, 82 USPQ2d 1385, 1395 (2007) combining prior art elements according to known methods to yield predictable results is obvious. It would have been prima facie obvious to one of ordinary skill in the art to combine Morgante’s primers (or Hayden’s primers) with the tailed primers of Kurn with reasonable success because Kurn’s tailed primers are well suited for the methods of Morgante because Morgante teaches one of skill in the art will also appreciate the unique compound SSR primers can also be used in conjunction with a variety of other primer types which include for example, non-adaptor primers, primers of fixed sequence, arbitrary primers or any primer that might hybridize with currently known or unknown dispersed repeated sequences in the genome (i.e., the tailed primers of Kurn forming the first end of the amplified nucleic acid fragment, or Hayden’s primers homologous to the adapters; Column 26, lines 30-36).
Claims 5 is rejected under 35 U.S.C. 103 as being unpatentable over
Morgante et al. (United States Patent Number 5,955,276, published September 21,
1999), cited on the IDS filed April 15, 2021, as evidenced by Hayden et al. (“Targeted development of informative microsatellite (SSR) markers”, Oxford University Press, Nucleic Acid Research, Vol. 29, No. 8, published February 20, 2001), and in view of Kurn et al. (U.S. Patent Application Publication US 2009/0203085, published August 13, 2009) cited on the IDS filed April 15, 2021, 1-4, 6, 8 and 23-24 above, and further in view of Schumm et al. (U.S. Patent Application Publication US 2002/0012924 A1, published January 31, 2002) cited on the IDS filed April 15, 2021. This rejection is modified as necessitated by amendments.
Regarding claim 5, Morgante and Kurn teach fragmenting as discussed above.
Morgante and Kurn do not teach or suggest wherein fragmenting comprises sonicating the nucleic acid.
Schumm teaches evaluating genomic variation ( Page 2, [0016]). Schumm teaches using primers to amplify target intermediate tandem repeat sequences (Page 3, [0019]). Schumm teaches sonication to fragment DNA (Page 5, [0058]). Schumm teaches sonication is not limited to double stranded DNA, unlike restriction endonuclease fragmentation (Page 5, [0058]).
It would have been obvious to one having ordinary skill in the art before the effective filing date of the claimed invention to have modified Morgante and Kurn to incorporate the teachings of Schumm, using sonification to fragment the DNA. Using sonication instead of restriction endonuclease fragmentation would allow for fragmenting of double stranded as well as single stranded DNA, as taught by Schumm (Page 5, [0058]).
Claims 7 is rejected under 35 U.S.C. 103 as being unpatentable over
Morgante et al. (United States Patent Number 5,955,276, published September 21,
1999), cited on the IDS filed April 15, 2021, as evidenced by Hayden et al. (“Targeted development of informative microsatellite (SSR) markers”, Oxford University Press, Nucleic Acid Research, Vol. 29, No. 8, published February 20, 2001), in view of Kurn et al. (U.S. Patent Application Publication US 2009/0203085, published August 13, 2009) cited on the IDS filed April 15, 2021, as applied to claims 1-4, 6, 8 and 23-24 above, and further in view of Erlich et al. (U.S. Patent Application Publication US 2014/0163900 A1, published June 12, 2014) cited on the IDS filed April 15, 2021. This rejection is modified as necessitated by amendments.
Regarding claim 7, Morgante (and Kurn) teaches selecting the repeat motif using a bioinformatics protocol comprising (b) using a data structure (Linked lists) to store a sample of short DNA sequences ("Kmers") with corresponding melting temperatures ("Tm") (Tables 4 and 5). Morgante teaches (c) profiling each Kmer for genomic abundance to identify candidates (Column 31, Lines 40-45). Morgante teaches (d) profiling the candidates for a potential to mis-prime (Column 46, Lines 40—Column 47, Lines 1-7). Morgante teaches (e) profiling the candidates for sequence diversity in downstream flank (Column 9, Lines 25-32). Morgante teaches (g) profiling the candidates for levels of selection (Column 13, Lines 8-12); Morgante teaches (h) collapsing similar candidates using degenerate bases (Column 31, Lines 25-37) ; Morgante teaches (i) evaluating alignments of flanking regions of the candidates (Column 9, Lines 17-39, Column 36, Lines 12-24 and Column 59-60). Morgante teaches (j) evaluating the potential for the candidates to be a suitable primer (Column 23, Lines 47-54 and Table 2). Morgante teaches (k) selecting at least one suitable repeat motif for use in subsequent steps in the method (Column 14, Lines 4-6).
Morgante and Kurn ds not teach or suggest (a) loading a nucleic acid sequence into a software program. Morgante and Kurn do not teach or suggest (f) profiling the candidates for genomic uniformity
Erlich teaches evaluating genomic variation using bioinformatics (Abstract, Page 6, [0068] and Page 18, [0195]). Erlich teaches fragmenting a nucleic acid having a repeat motif (Page 6, [0067] and Page 8, [0092]). Erlich teaches (a) loading a nucleic acid sequence into a software program (Page , [0159]-[0160] and Page , [0162]). Erlich teaches (e) profiling the candidates for sequence diversity in downstream flank (Page 10, [0119]). Erlich teaches (f) profiling the candidates for genomic uniformity (Supplemental Table 1, Page 10, [0116] and Page 17, [0189]. Erlich teaches (h) collapsing similar candidates using degenerate bases (Page 19, [0210]). Erlich teaches (i) evaluating alignments of flanking regions of the candidates (Page 10, [0119]). Erlich teaches this approach may allow avoiding computation of a gapped alignment between the analyzed and reference DNA sequences, thus improving the speed of the STR identification (Page 10, [0119]). Erlich teaches loading a nucleic acid sequence into a software program would allow using sequencing data and report alleles to determine an STR locus using computer readable data which would allow for multiple different samples to be identified at the same time making alignment speeds 1000 time faster than alternative method (Page 14, [0159] and Page 6, [0068]).
It would have been obvious to one having ordinary skill in the art before the effective filing date of the claimed invention to have modified Morgante and Kurn to incorporate the teachings of Erlich to load a nucleic acid sequences into a software program and profiling the candidates for genomic uniformity. This would allow using sequencing data and report alleles to determine an STR locus using computer readable data with a processor having multithreaded processing capabilities which would allow for multiple different samples to be identified at the same time making alignment speeds 1000 time faster than alternative methods as taught by Erlich (Page 14, [0159] and Page 6, [0068]).
Response to Arguments
Applicant’s arguments filed June 10, 2025, with respect to the rejections of under 35 U.S.C. § 103 have been fully considered but they are not persuasive. Applicant asserts that Morgante does not teach an adapter primer including a nucleic acid sequence homologous to the adapter sequence, but rather only teaches a second primer that it complementary to (not homologous) with the adapter segment.
It is acknowledged that Morgante does in fact teach a primer adapter that is complementary to the adapter segment. However, as discussed above Morgante additionally discloses an adapter primer including a nucleic acid sequence homologous to the adapter sequence. Morgante teaches “adaptor-directed primers… comprises two different primers, one corresponding to one adaptor sequence and the second primer to the other adaptor sequence” as well as “two or more different adaptors are ligated to the ends of the restriction fragments. In this case, two different PCR primers, each matching the sequence of a particular adaptor, can be used for exponential amplification from a subset of the restriction fragments” (Column 28, Lines 18-22 and Column 15. Lines 55-63). Here, “corresponding” and “matching” are interpreted as “homologous”. Using the broadest reasonable interpretation as well as according to Dictionary.com, published March 18, 2016, the term “homologous” is defined as “having the same relation; corresponding, as in relative position or structure”. Additionally in Thesaurus.com, published December 10, 2011, the term “homologous” is synonymous with “corresponding” and “matching” is synonymous with “corresponding, equal”, thus the terms “corresponding” and “matching” may be reasonably interpreted as “homologous”.
Applicant further asserts that this interpretation is inconsistent with Morgante’s explicit teachings because Morgante uses the term “complementary” throughout. However the explicit use the term “complementary” would suggest that Morgante would not substitute the use of “corresponding” or “matching” to mean complementary. Morgante additionally explicitly uses the term “matching”, “two different PCR primers, each matching the sequence of a particular adaptor” (Column 28, Lines 18-22 and Column 15. Lines 55-63). Additionally, the instant specification, defines “homologous” as a sequence matching 30% or more to a nucleic acid sequence (see Instant Specification, Page 8, [0048]). Morgante discloses multiple primers with at least 30% matching sequences to the adaptor sequence, specifically in Table 1; especially Sau adaptor and primer example from table 1 reproduced below:
Sau. Adaptor: GGAATTCTGGACTCAGT
Sau. Primer : GGAATTCTGGACTCAGTATC
As shown above, Morgante does indeed disclose said adapter primer including a nucleic acid sequence homologous or matching to the adapter sequence.
Morgante additionally teaches use of adapter primers taught by Zabeau et al. (European Patent Application EP 534,858 A1, published March 31, 1993) (Column 27, Lines 10-12 and Column 16, Lines 50-52). While it is acknowledged that Zabeau discloses a primer complementary to the adapter, Zabeau additionally discloses an adapter primer that is identical, or homologous to the adapter sequence (specifically using the instant specification definition of “homologous”- a sequence matching 30% or more to a nucleic acid sequence; see Instant Specification, Page 8, [0048]), in Zabeau’s Example 1 reproduced below:
Adapters with the following structure, Page 10, Lines 19-24:
5- CTCGTAGACTGCGTACATGCA -3
3- CATCTGACGCATGT -5
Four different primers used, Page 11, Lines 13-24:
1. 5-CTCGTAGACTGCGTACA-3
2. 5-GACTGCGTACAtgcagA-3
3. 5-GACTGCGTACAtgcagAC-3
4. 5-GACTGCGTACAtgcagACC-3
Applicant asserts that “since primer 1 failed, Zabeau would not suggest modifying Morgante’s method to include an adapter primer with a sequence homologous to an adapter sequence”. However as pointed out in the applicant’s response, Zabeau in 10:29-36, discloses “in [the] case of the primer with 3 selective nucleotides…”, pointing to primer 4 above, with at least 30% of the primer sequence being identical to the adapter sequence, “…a clear ban pattern was obtained”, therefore identifying that primer 4 did not fail to function and would be suggested for use in the teachings of Morgante and therefore disclosing including an adapter primer with a sequence homologous to an adapter sequence.
Applicant further asserts that “A person having ordinary skill in the art would not have modified Morgante’s process to use Hayden’s adapter primers because Morgante’s adapter primers are specifically adapted for use in Morgante’s process … [and] Zabeau teaches that an adapter primer with a sequence homologous to the adapter does not work”. However, as discussed above, Zabeau does in fact teach an adapter primer sequence homologous to the adapter that does function and Morgante discloses that one could use “any primer that may hybridize with currently known or unknown dispersed repeated sequences in the genome” (Column 26, Lines 30-36), such as the functional primer 4 of Zabeau above or the “primers homologous to the adapter sequences” of Hayden (Page 1, Right Column, Second Paragraph). Therefore, claim 1 is deemed to be obvious and the rejection is maintained and modified as necessitated by Applicant’s arguments.
Therefore, for these reasons, and those listed above, Morgante as evidenced by Hayden and in view of Kurn, are deemed to render the instant invention obvious.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA DANIELLE PARISI whose telephone number is (571)272-8025. The examiner can normally be reached Mon - Friday 7:30-5:00 Eastern with alternate Fridays off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at 571-272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JESSICA D PARISI/Examiner, Art Unit 1684
/HEATHER CALAMITA/Supervisory Patent Examiner, Art Unit 1684
Prosecution Insights