DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 12/31/2025 has been entered.
Amended claims 2, 5-6, 13, 29-35, 37-39 and new claims 45-48 are pending in the present application, and they are examined on the merits herein.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 2, 5-6, 13, 29-35 and 45-48 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2014/0024599; IDS) in view of Rubenstein et al (US 6,602,680; IDS), Zhu et al (US 2012/0301446; IDS) and Chen et al (WO 2014/015261; IDS). This is a slightly modified rejection.
The instant claims are directed to a composition, wherein said composition comprises an adeno-associated viral (AAV) vector comprising a nucleic acid sequence encoding a neurogenic differentiation 1 (NeuroD1) polypeptide and a nucleic acid sequence encoding a distal-less homeobox 2 (Dlx2) polypeptide, and wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence (e.g., a GFAP promoter sequence and/or an Aldh1L1 promoter sequence), wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain (e.g., brain of a living mammal having Huntington’s disease with a reduced number of GABAergic medium spiny neurons or reduced number of GABAergic interneurons in the striatum) (an intended use), and wherein said composition is capable of converting astrocytes in the striatum into GABAergic interneurons (e.g., parvalbumin-positive interneurons) or GABAergic medium spiny neurons (e.g., DARPP32-positive GABAergic neurons) upon administration into the striatum (an intended use).
Chen et al already taught a composition comprising the nucleic acid of SEQ ID NO: 1 encoding NeuroD1 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 1 of the present application, wherein the nucleic acid is included in an expression vector to produce NeuroD1 in a host cell in vitro or in vivo (see at least Abstract; Summary of the Invention; particularly paragraphs [0076]-[0097], [0156]; Examples 2, 12 and 16; and attached sequence search below). Chen et al disclosed that exemplary expression vectors include plasmids and viral expression vectors such as adenovirus, adeno-associated virus, retrovirus and lentivirus (paragraph [0079]); and an expression vector contains one or more regulatory elements that include an enhancer, an internal ribosome entry site (IRES) or a 2A domain, an intron, an origin of replication, a polyadenylation signal (pA), a promoter, and a transcription termination sequence (paragraph [0080]). Chen et al stated “In addition to one or more nucleic acids encoding NeuroD1, one or more nucleic acid sequences encoding additional proteins can be included in an expression vector” (paragraph [0082]). Chen et al also taught that a recombinant expression vector including a nucleic acid encoding NeuroD1 is introduced into glial cells, astrocytes, or reactive astrocytes in a subject, and expression of exogenous NeuroD1 in the glial cells, astrocytes, or reactive astrocytes converts these cells into neurons (paragraphs [0088]-[0090]). An exemplary recombinant pCAG-NeuroD1-IRES-GFP retrovirus was prepared and the recombinant retrovirus was directly injected into somatosensory cortex of a mouse (Examples 2 and 5); and it was demonstrated that NeuroD1-converted neurons in the Alzheimer’s disease (AD) brain were innervated by glutamatergic and GABAergic terminals (Example 12, particularly paragraph [0156] and Fig. 7D). Chen et al also disclosed that expression of exogenous Dlx2 in cultured human astrocytes changed astrocytes into GAD-positive GABAergic neurons, with some glutamatergic events being detected, suggesting that Dlx2 can convert human astrocytes into both GABAergic and glutamatergic neurons (Example 16 and Fig.8). Chen et al also disclosed that it is well known that glial cells become reactive following brain or spinal cord injury, after a stroke or neurodegenerative diseases such as Alzheimer’s disease, and these reactive glial cells can proliferate and maintain a high number in the injury site, and eventually form a dense scar tissue called glial scar to prevent the growth of neurons; and the general aspects of the invention relate to in situ conversion of glial cells to functional neuronal cells both in vitro and in vivo (paragraphs [0003]-[0004]).
Chen et al did not teach specifically at least a composition comprising an adeno-associated viral (AAV) vector comprising a nucleic acid sequence encoding a neurogenic differentiation 1 (NeuroD1) polypeptide (e.g., the amino acid sequence of SEQ ID NO:1) and a nucleic acid sequence encoding a distal-less homeobox 2 (Dlx2) polypeptide (e.g., the amino acid sequence of SEQ ID NO:2), wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence (e.g., a GFAP promoter sequence or an Aldh1L1 promoter sequence).
Before the effective filing date of the present application (02/18/2016), Rubenstein et al already disclosed polynucleotides encoding Dlx gene products, including the nucleotide sequence of SEQ ID NO: 1 that encodes the human Dlx2 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 2 of the present application, wherein the polynucleotides are at least in the form of a recombinant virus, preferably replication-deficient virus to increase Dlx activity which causes differentiation of an immature neuronal cell into a neuronal cell exhibiting the GABAergic phenotype (Abstract; Summary of the Invention; particularly col. 7, line 38 continues to line 27 on col. 8; Examples; issued claims 1-7; and attached sequence search below). Rubenstein et al taught specifically that the Dlx-encoding nucleic acid is operably linked to a promoter that facilitates a desired level of DLX polypeptide expression (e.g., a promoter derived from CMV, SV40 or adenovirus virus), or a tissue-specific or cell type-specific promoter (e.g., beta-actin or neuronal-specific promoter) (col. 8, lines 1-11). Rubenstein et al stated “The vast majority of neurons in the forebrain use either glutamate or gamma aminobutyric acid (GABA) as a neurotransmitter…..Unlike the cerebral cortex, most projection neurons of the basal ganglia (striatum and globus pallidus) are GABAergic. Disorders such as Huntington’s disease lead to the degeneration of these neurons” (col. 1, lines 21-37), and “These transgenic animal studies have supported the notion that development of GABAergic forebrain cells depend on the function of Dlx genes; roughly 80% of neocortical, and greater than 95% of olfactory bulb and hippocampal GABAergic interneurons do not fully develop in Dlx1/Dlx2 double mutant transgenic mice” (col. 2, line 66 continues to line 5 at col. 3).
Additionally, Zhu et al also disclosed at least a composition for re-programming glial cells into neurons, wherein the composition comprises a transducible material comprising at least an effector domain which is a transcription factor polypeptide selected from the group consisting of pax6, ASCL1, Brn2, MYT1L, Neurod1, Neurod6, Prdm8, Npas4, Mef2c, Dlx1, Tbr1, ISL1, Foxp1, Foxp2, Nhlh2, Sox2, Brn4, Hes1, Hes5, Lhx2, Oligo2, Ngn2, Dlx2, Zie1, NAP1L2, Nrip3, Satb2, Chd5, Smarca1, Brm, Brg1 and any combination thereof (Abstract; particularly paragraphs 33-34, 37-40, 46, 57, 66, 68, 72, 100-102; Tables 1 and 3; Example 4; Figs. 7, 18 and 19(w)). In an exemplification, Zhu et al stated “As shown in FIG. 18, treatment with His-Ngn2-11R or His-Dlx2-11R protein alone can reprogram some astrocytes to neurons, as labeled in the picture by green fluorescence from Tuj1 antibody. But the most prominent reprogramming effects were produced by double protein treatment. Also the newly created neurons from His-Ngn2-11R and His-Dlx2-11R treatment show more mature processes” (paragraph 102).
Moreover, Chen et al (WO 2014/015261) already disclosed expression vectors comprising a glial cell-specific promoter that is operably linked to a nucleic acid encoding NeuroD1 for introducing NeuroD1 into a glial cell, particularly into a reactive astrocyte or NG2 cell, thereby “converting” the reactive glial cell into a functional neuron; wherein the promoter is a GFAP promoter or Aldh1L1 promoter, and wherein the expression vectors can be adeno-associated virus (see at least Abstract; Summary of the Invention; particularly paragraphs [0006]-[0008], [0011], [0051] and [00209]-[00211]). Chen et al also stated “Conversion of astrocytes, reactive astrocytes, NG2 cells and/or reactive NG2 cells to neurons in vitro, ex vivo and/or in vivo may be used to treat neurodegenerative disease and injury, replacing degenerated neurons and restoring neural function” (paragraph [00173]). Chen et al also demonstrated that NeuroD1 converts astrocytes and reactive astrocytes into functional glutamatergic neurons and converts NG2 cells and reactive NG2 cells into predominantly into functional GABAergic neurons along with a few functional glutamatergic neurons (Examples 17 and 21-22).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of Chen et al by also preparing at least a composition comprising a recombinant AAV vector comprising the nucleic acid sequence encoding the human NeuroD1 polypeptide of SEQ ID NO: 2 and the nucleic acid sequence encoding the human Dlx2 polypeptide of SEQ ID NO: 2 disclosed by Rubenstein et al, wherein at least the nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter such as a GFAP promoter or an Aldh1L1 promoter for converting glial cells such as astrocytes, reactive astrocytes, NG2 cells and/or reactive NG2 cells into functional neuronal cells (e.g., glutamatergic neurons and/or GABAergic neurons) in vitro and/or in vivo with a reasonable expectation of success, in light of the teachings of Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) as set forth above.
An ordinary skilled artisan would have been motivated to carry out the above modifications because Rubenstein et al already disclosed the nucleotide sequence of SEQ ID NO: 1 that encodes the human Dlx2 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 2 of the present application, wherein the polynucleotide is at least in the form of a recombinant virus for increasing Dlx2 activity which causes differentiation of an immature neuronal cell into a neuronal cell exhibiting the GABAergic phenotype. Additionally, Zhu et al also disclosed at least a composition for re-programming glial cells into neurons, wherein the composition comprises a transducible material comprising at least an effector domain which is a transcription factor polypeptide that includes the combination of NeuroD1 and Dlx2; and demonstrated in an exemplification that the most prominent reprogramming effects were produced by double protein treatment vs single protein treatment. Moreover, Chen et al (WO 2014/015261) already disclosed expression vectors comprising a glial cell-specific promoter that is operably linked to a nucleic acid encoding NeuroD1 for introducing NeuroD1 into a glial cell, particularly into a reactive astrocyte or NG2 cell, thereby “converting” the reactive glial cell into a functional neuron; wherein the promoter is a GFAP promoter or Aldh1L1 promoter, and wherein the expression vectors can be adeno-associated virus. Furthermore, please note that the primary Chen reference already demonstrated that NeuroD1-converted neurons in the Alzheimer’s disease (AD) brain were innervated by glutamatergic and GABAergic terminals and expression of exogenous Dlx2 in cultured human astrocytes changed astrocytes into GAD-positive GABAergic neurons, with some glutamatergic events being detected, suggesting that Dlx2 can convert human astrocytes into both GABAergic and glutamatergic neurons. Moreover, the primary Chen reference also stated clearly “In addition to one or more nucleic acids encoding NeuroD1, one or more nucleic acid sequences encoding additional proteins can be included in an expression vector” (paragraph [0082]).
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261); coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) as set forth above is structurally indistinguishable from the composition of the present application that is formulated for direct injection to a striatum of a living mammal’s brain (an intended use). It is noted that the claimed composition that is formulated for direct injection of a striatum of a living mammal’s brain does not contain any additional structural component(s) or element(s) that is different from the modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261), particularly the composition of Chen et al is already at least suitable for direct injection into a brain of a mouse. Accordingly, with respect to the “wherein functional” limitation of “wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAeregic interneurons or GABAergic medium spiny neurons upon administration into the striatum” the modified composition would also necessarily possess a capability of converting astrocytes to GABAergic interneurons (e.g., parvalbumin-positive GABAergic neurons) or GABAergic medium spiny neurons (e.g., DARPP32-positive GABAergic neurons) upon administration into a striatum of a living mammal’s brain such as a mammal with Huntington’s disease (e.g., a Huntington’s disease with a reduced number of GABAergic medium spiny neurons or a reduced number of GABAergic interneurons in a striatum) when it is directly injected into the requisite striatal environment. Especially, Rubenstein et al already taught that greater than 95% of olfactory bulb and hippocampal GABAergic interneurons do not fully develop in Dlx1/Dlx2 double mutant transgenic mice, suggesting the roles of Dlx1/Dlx2 in the formation of GABAergic interneurons.
Please note that the patentability of composition claims depends on the claimed structure and not on the use or purpose of the structure, and stating an intended use is not sufficient to structurally distinguish from the prior art. Please, also note that where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke. Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 12/31/2025 (pages 5-9) have been fully considered but they are respectfully not found persuasive for the reasons discussed below.
A. Once again, Applicant argued basically that the claimed invention is not taught or suggested by the cited references, particularly currently amended claims recite the limitation “wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAergic interneurons or GABAergic medium spiny neurons upon administration into the striatum”. Applicant also argued that the primary Chen reference did not teach specifically a composition comprising an AAV vector comprising nucleic acid sequences encoding NeuroD1 and Dlx2 polypeptides, with the NeuroD1 sequence operably linked to an astrocyte-specific promoter; nor does this reference discuss Huntington’s disease, medium spiny neurons, or expression or injection targeted to the striatum. Applicant further argued that none of the other cited references could remedy the deficiencies of the Chen reference namely: (i) The Rubenstein teaches the use of Dlx genes for the production of GABAergic cells but it does not teach or suggest combining Dlx2 with NeuroD1, nor does Rubenstein teach reprogramming of glial cells, particular already mature glial cells, in the striatum and/or cooperative interaction between Dlx2 and NeuroD1; (ii) The Zhu reference mentions NeuroD1 and Dlx2 in a list of potential factors for reprogramming cells, but only provided working example of reprogramming of astrocytes into neurons in vitro using Ngn2 and Dlx2, but does not teach the specific combination of NeuroD1 and Dlx2 for in vivo conversion of astrocytes to neurons, let alone GABAergic interneurons and/or GABAergic medium spiny neurons in a striatum of a living mammal’s brain as claimed; and (iii) Chen et al (WO 2014/015261) focuses only on NeuroD1 alone with a discussion of Dlx2 in an in vitro example showing that Dlx2 expression in astrocytes can induce reprogramming into both GABAergic and glutamatergic neurons; but it does not address cooperative transcription factor effects nor mentioning striatal targeting or Huntington’s disease, nor provide any in vivo data.
First, the instant claims are directed to a composition and not a method, wherein said composition comprises an adeno-associated viral (AAV) vector comprising a nucleic acid sequence encoding a neurogenic differentiation 1 (NeuroD1) polypeptide and a nucleic acid sequence encoding a distal-less homeobox 2 (Dlx2) polypeptide, and wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence (e.g., a GFAP promoter sequence and/or an Aldh1L1 promoter sequence), wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain (e.g., brain of a living mammal having Huntington’s disease with a reduced number of GABAergic medium spiny neurons or reduced number of GABAergic interneurons in the striatum) (an intended use), and wherein said composition is capable of converting astrocytes in the striatum into GABAergic interneurons (e.g., parvalbumin-positive interneurons) or GABAergic medium spiny neurons (e.g., DARPP32-positive GABAergic neurons) upon administration into the striatum (an intended use). Please refer to the above modified 103 rejection for details.
Second, since the above rejection was made under 35 USC 103 none of the cited references have to teach every limitation of the instant claims. For example, neither the primary Chen reference nor the Zhu reference have to teach a nucleic acid sequence encoding NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence. It is also apparent that Applicant considered each of the cited references in total isolation one from the others, without taking into consideration of the specific combination of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261).
Third, the primary Chen reference already disclosed that it is well known that glial cells become reactive following brain or spinal cord injury, after a stroke or neurodegenerative diseases such as Alzheimer’s disease, and these reactive glial cells can proliferate and maintain a high number in the injury site, and eventually form a dense scar tissue called glial scar to prevent the growth of neurons; and the general aspects of Chen’s invention relate to in situ conversion of glial cells to functional neuronal cells both in vitro and in vivo (paragraphs [0003]-[0004]). Thus, a conversion of glial cells, including astrocytes, reactive astrocytes, NG2 cells and reactive NG2 cells, to any functional neuronal cells (e.g., glutamatergic neurons, GABAergic neurons, DARPP32-positive neurons and parvalbumin-positive neurons) is desirable and beneficial in the treatment of brain, spinal cord injury, stroke or any neurodegenerative disease.
Fourth, as stated in the above modified 103 rejection it would have been obvious and a POSITA would have been motivated to modify the teachings of Chen et al by also preparing at least a composition comprising a recombinant AAV vector comprising the nucleic acid sequence encoding the human NeuroD1 polypeptide of SEQ ID NO: 2 and the nucleic acid sequence encoding the human Dlx2 polypeptide of SEQ ID NO: 2 disclosed by Rubenstein et al, wherein at least the nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter such as a GFAP promoter or an Aldh1L1 promoter for converting glial cells such as astrocytes, reactive astrocytes, NG2 cells and/or reactive NG2 cells into functional neuronal cells (e.g., glutamatergic neurons and/or GABAergic neurons) in vitro and/or in vivo with a reasonable expectation of success because: (i) Rubenstein et al already disclosed the nucleotide sequence of SEQ ID NO: 1 that encodes the human Dlx2 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 2 of the present application, wherein the polynucleotide is at least in the form of a recombinant virus for increasing Dlx2 activity which causes differentiation of an immature neuronal cell into a neuronal cell exhibiting the GABAergic phenotype; (ii) Zhu et al also disclosed at least a composition for re-programming glial cells into neurons, wherein the composition comprises a transducible material comprising at least an effector domain which is a transcription factor polypeptide that includes the combination of NeuroD1 and Dlx2; and demonstrated in an exemplification that the most prominent reprogramming effects were produced by double protein treatment vs single protein treatment (a motivation to use a combination of 2 transcription factors rather a single transcription factor alone for conversion of glial cells into neurons); and (iii) Chen et al (WO 2014/015261) already disclosed expression vectors comprising a glial cell-specific promoter that is operably linked to a nucleic acid encoding NeuroD1 for introducing NeuroD1 into a glial cell, particularly into a reactive astrocyte or NG2 cell, thereby “converting” the reactive glial cell into a functional neuron; wherein the promoter is a GFAP promoter or Aldh1L1 promoter, and wherein the expression vectors can be adeno-associated virus. Please also note that the primary Chen reference already demonstrated that NeuroD1-converted neurons in the Alzheimer’s disease (AD) brain were innervated by glutamatergic and GABAergic terminals and expression of exogenous Dlx2 in cultured human astrocytes changed astrocytes into GAD-positive GABAergic neurons, with some glutamatergic events being detected, suggesting that Dlx2 can convert human astrocytes into both GABAergic and glutamatergic neurons. Moreover, the primary Chen reference also stated clearly “In addition to one or more nucleic acids encoding NeuroD1, one or more nucleic acid sequences encoding additional proteins can be included in an expression vector” (paragraph [0082]).
Fifth, the modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) as set forth above is structurally indistinguishable from the composition of the present application that is formulated for direct injection to a striatum of a living mammal’s brain (an intended use). It is noted that the claimed composition that is formulated for direct injection of a striatum of a living mammal’s brain does not contain any additional structural component(s) or element(s) that is different from the modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261), particularly the composition of Chen et al is already at least suitable for direct injection into a brain of a mouse. Accordingly, with respect to the “wherein functional” limitation of “wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAeregic interneurons or GABAergic medium spiny neurons upon administration into the striatum” the modified composition would also necessarily possess a capability of converting astrocytes to GABAergic interneurons (e.g., parvalbumin-positive GABAergic neurons) or GABAergic medium spiny neurons (e.g., DARPP32-positive GABAergic neurons) upon administration into a striatum of a living mammal’s brain such as a mammal with Huntington’s disease (e.g., a Huntington’s disease with a reduced number of GABAergic medium spiny neurons or a reduced number of GABAergic interneurons in a striatum) when it is directly injected into the requisite striatal environment. Especially, Rubenstein et al already taught that greater than 95% of olfactory bulb and hippocampal GABAergic interneurons do not fully develop in Dlx1/Dlx2 double mutant transgenic mice, suggesting the roles of Dlx1/Dlx2 in the formation of GABAergic interneurons. Please note that the patentability of composition claims depends on the claimed structure and not on the use or purpose of the structure, and stating an intended use is not sufficient to structurally distinguish from the prior art. Please, also note that where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke. Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Sixth, an ordinary skill in the art would have a reasonable expectation of success to arrive at the modified composition resulting from the combined teachings Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261). Please also note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success.
B. Applicant also argued that given the highly unpredictable nature of biological and medical art, the lack of any in vivo testing or data collected using relevant composition (the combination of NeuroD1 and Dlx2), the lack of disclosure regarding the targeted tissue and cell types in the striatum, one of ordinary skill would have no motivation to modify the combined disclosure of the cited reference to arrive at a composition “formulated for direct injection to a striatum of a living mammal’s brain” at the first place, much less any basis to expect or predict that such modified composition to be “capable of converting astrocytes in the striatum into GAAergic interneurons or GABAergic medium spiny neurons upon administration into the striatum”. Applicant further argued that the present application demonstrates that identical transcription factors can yield distinct neuronal subtype outcomes depending on anatomical context. For example, while NeuroD1 and Dlx2 together reprogram striatal glial cells into a substantial proportion of DARPP32-positive medium spiny neurons (Speciation, at pages 27-28), cortical glial cells reprogrammed with the same factors predominantly yield other GABAergic subtypes, such as CCK8-positive or PV-positive neurons, with markedly fewer DARPP32-positive neurons (at pages 28-29). Thus, these findings underscore that the functional feature of the claimed composition is not an inevitable consequence of transcription factor expression but rather a biological process dependent on the claimed composition being “formulated for direct injection to a striatum of a living mammal’s brain” as recited in claim 2.
Once again, the instant claims are composition claims and not method claims. Accordingly, there is nothing that is unpredictable about a preparation of an AAV vector comprising a nucleic acid encoding a NeuroD1 polypeptide and a nucleic acid sequence encoding Dlx2 polypeptide, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence, wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAergic interneurons or GABAergic medium spiny neurons upon administration into the striatum. The modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) as set forth above is structurally indistinguishable from the composition of the present application that is formulated for direct injection to a striatum of a living mammal’s brain (an intended use). It is noted that the claimed composition that is formulated for direct injection of a striatum of a living mammal’s brain does not contain any additional structural component(s) or element(s) that is different from the modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261), particularly the composition of Chen et al is already at least suitable for direct injection into a brain of a mouse. Accordingly, with respect to the “wherein functional” limitation of “wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAeregic interneurons or GABAergic medium spiny neurons upon administration into the striatum” the modified composition would also necessarily possess a capability of converting astrocytes to GABAergic interneurons (e.g., parvalbumin-positive GABAergic neurons) or GABAergic medium spiny neurons (e.g., DARPP32-positive GABAergic neurons) upon administration into a striatum of a living mammal’s brain such as a mammal with Huntington’s disease (e.g., a Huntington’s disease with a reduced number of GABAergic medium spiny neurons or a reduced number of GABAergic interneurons in a striatum) when it is directly injected into the requisite striatal environment. Especially, Rubenstein et al already taught that greater than 95% of olfactory bulb and hippocampal GABAergic interneurons do not fully develop in Dlx1/Dlx2 double mutant transgenic mice, suggesting the roles of Dlx1/Dlx2 in the formation of GABAergic interneurons. Please note that the patentability of composition claims depends on the claimed structure and not on the use or purpose of the structure, and stating an intended use is not sufficient to structurally distinguish from the prior art.
Amended claims 37-39 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (US 2014/0024599; IDS) in view of Rubenstein et al (US 6,602,680; IDS), Zhu et al (US 2012/0301446; IDS) and Chen et al (WO 2014/015261; IDS) as applied to claims 2, 5-6, 13, 29-35 and 45-48 above, and further in view of Markakis et al (Molecular Therapy 18:588-593, 2010) and Foust et al (Nature Biotechnology 27:59-65, 2009; IDS).
The combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) were presented above. However, none of the cited references teach specifically using an adeno-associated serotype 5 viral vector (claim 39), a serotype 9 AAV vector (claim 37), or a serotype 2 AAV vector (claim 38).
Before the effective filing date of the present application (02/18/2016), Markakis et al already performed comparative transduction efficiency of AAV vector serotypes 1-6 in the Substantia Nigra and Striatum of a primate brain, and they found that AAV5 is the most efficient AAV vector, not only transducing significantly more cells than any other serotype, but also transducing both NeuN+ and glial-fibrillary-acidic protein positive (GFAP+) cells (see at least Abstract). Markakis et al also stated “This finding agrees with the results of previous studies in rodents: in mice and rats AAV5 led to a higher number of transduced cells and demonstrated the ability to infect glial cells stably and effectively, thus being superior to serotypes 1, 2, 6, 7, 8, and 9 (ref. 10-14). These findings indicate that using AAV5 as a vector for gene delivery instead of AAV2 could improve gene delivery in the human central nervous system considerably, especially when the transgene produces a protein normally manufactured in glial cells” (page 590, right column, bottom of first full paragraph), and “All vectors transduced neurons and glial cells, but to a different extent. Although AAV2 transduced more neurons than glial cells (65% of transduced cells that could be assigned a phenotype were NeuN+ neurons), AAV5 transduced neurons and glial cells with apparently equal efficiency (47% were GFAP+, 53% NeuN+)” (Sentences bridging left and right columns on page 590). However, Markakis also noted that AAV serotype 2 (AAV2) is the most widely used AAV vector in clinical trials based largely on its ability to transduce neural cells in the rodent and primate brain (Abstract); and that AAV5 may not be the most efficient vector at transducing neural cells across mammalian species, for example AAV2 and AAV8 have been found to be effective at neural transduction in the canine brain and AAV5 was found to be inefficient in transducing any cells in feline brain (page 591, left column, first full paragraph).
Additionally, Foust et al demonstrated that intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes (Abstract; and Figures 3 and 5). Foust et al also stated “Constructing AAV9-based vectors with neuronal or astrocyte-specific promoters may allow further specificity, given that AAV9 targets multiple nonneuronal tissues after intravenous delivery” (page 63, right column, first paragraph).
Accordingly, it would have been obvious for an ordinary skilled artisan to further modify the combined teachings of Chen et al, Rubenstein et al, Zhu et al and Chen et al (WO 2014/015261) by also selecting AAV5 vector as well as AAV2 and AAV9 vectors as viral carriers for a nucleic acid sequence encoding NeuroD1 and a nucleic acid sequence encoding Dlx2 in their composition used for converting glial cells such as astrocytes, reactive astrocytes, NG2 cells and/or reactive NG2 cells into functional neuronal cells (e.g., glutamatergic neurons and/or GABAergic neurons) in vitro and/or in vivo with a reasonable expectation of success, in light of the teachings of Markakis et al and Foust et al as set forth above.
An ordinary skilled artisan would have been motivated to carry out the above modifications because Markakis et al already demonstrated that AAV5 is the most efficient AAV vector, not only transducing significantly more cells than any other serotype, but also transducing both NeuN+ and glial-fibrillary-acidic protein positive (GFAP+) cells in the Substantia Nigra and Striatum of a primate brain, while AAV2 is the most widely used AAV vector in clinical trials and it is also capable of transducing neurons and glial cells. Additionally, Foust et al demonstrated successfully that intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes, and taught specifically for constructing AAV9-based vectors with neuronal or astrocyte-specific promoters for further cell targeting specificity.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Chen et al, Rubenstein et al, Zhu et al, Chen et al (WO 2014/015261), Markakis et al and Foust et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Chen et al, Rubenstein et al, Zhu et al, Chen et al (WO 2014/015261), Markakis et al and Foust et al as set forth above is indistinguishable and encompassed by a composition of the present application.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 12/31/2025 (pages 9-10) have been fully considered but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that both the Markakis reference and the Foust reference do not cure the deficiencies of the combined disclosure of Chen ‘599, Rubenstein, Zhu and Chen’261 for the reasons already discussed above. Accordingly, claims 37-39 are also patentable over the cited art.
Please refer to the Examiner’s same responses to Applicant’s arguments on the deficiencies of the combined teachings of Chen ‘599, Rubenstein, Zhu and Chen’261 above. The Markakis reference and the Foust reference were cited to supplement the combined teachings of Chen ‘599, Rubenstein, Zhu and Chen’261 for the limitations recited in dependent claims 37-39 for specific AAV vector serotypes.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Amended claims 2, 5-6, 31-33, 35 and 45-48 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6 and 8-11 of U.S. Patent No. 10,973,930. This is a modified rejection.
Although the claims at issue are not identical, they are not patentably distinct from each other because a method for forming GABAergic neurons in a striatum of a living mammal’s brain from astrocytes, wherein said method comprises administering a nucleic acid sequence encoding a NeuroD1 polypeptide and a nucleic acid encoding a Dlx2 polypeptide (e.g., wherein both nucleic acid sequences are located on the same viral vector, or the viral vector is an adeno-associated viral vector; dependent claims 6 and 5, respectively) to said astrocytes within said striatum, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte promoter sequence (e.g., a glial fibrillary acidic protein (GFAP) promoter sequence, dependent claim 11), wherein said NeuroD1 polypeptide and said Dlx2 polypeptide are expressed by said astrocytes (e.g., the nucleic acid sequence encoding said Dlx2 polypeptide is operably linked to a glial fibrillary acid protein promoter sequence, dependent claims 8-10), wherein said astrocytes form said GABAergic neurons within said striatum are DARPP32-positive and functionally integrated into said living mammal’s brain, and wherein said administration comprises a direct injection into said striatum of said living mammal’s brain in claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 encompasses a composition of the present application that comprises an AAV vector comprising a nucleic acid sequence encoding NeuroD1 polypeptide and a nucleic acid sequence encoding Dlx2 polypeptide, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte-specific promoter sequence, wherein said composition is formulated for direct injection to a striatum of a living mammal’s brain, and wherein said composition is capable of converting astrocytes in the striatum into GABAergic interneurons (e.g., parvalbumin-positive neurons; dependent claim 32) or GABAerginc medium spiny neurons (e.g., DRPP32-positive GABAergic neuron; dependent claim 31) upon administration into the striatum. Since the composition used in the method claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 is structurally identical from the composition of the present application, it would also possess a capability of converting astrocytes to GABAergic interneurons and/or GABAergic medium spiny neurons in a striatum of a living mammal’s brain such as a mammal with Huntington’s disease when it is directly injected into the requisite striatal environment.
Please note that the patentability of composition claims depends on the claimed structure and not on the use or purpose of the structure, and stating an intended use is not sufficient to structurally distinguish from the prior art. Please, also note that where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke. Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Amended claims 13, 29-30, 34 and 37-39 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 (IDS) as applied to claims 2, 5-6, 31-33, 35 and 45-48 above, and further in view of Markakis et al (Molecular Therapy 18:588-593, 2010), Foust et al (Nature Biotechnology 27:59-65, 2009; IDS), Chen et al (WO 2014/015261; IDS) and Rubenstein et al (US 6,602,680; IDS).
The instant claims of the present application differ from claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 in reciting specifically the encoded NeuroD1 polypeptide is a human NeuroD1 polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and the encoded Dlx2 polypeptide is a human Dlx2 peptide comprising the amino acid sequence of SEQ ID NO: 2 (claims 13 and 29-30 of the present application); and wherein the AAV vector is AAV5 (claim 37 of the present application), AAV2 (claim 38 of the present application), or AAV9 vector (claim 37 of the present application); and wherein the astrocyte-specific promoter sequence is Aldh1L1 promoter sequence (claim 34 of the present application).
Before the effective filing date of the present application (02/18/2016), Markakis et al already performed comparative transduction efficiency of AAV vector serotypes 1-6 in the Substantia Nigra and Striatum of a primate brain, and they found that AAV5 is the most efficient AAV vector, not only transducing significantly more cells than any other serotype, but also transducing both NeuN+ and glial-fibrillary-acidic protein positive (GFAP+) cells (see at least Abstract). Markakis et al also stated “This finding agrees with the results of previous studies in rodents: in mice and rats AAV5 led to a higher number of transduced cells and demonstrated the ability to infect glial cells stably and effectively, thus being superior to serotypes 1, 2, 6, 7, 8, and 9 (ref. 10-14). These findings indicate that using AAV5 as a vector for gene delivery instead of AAV2 could improve gene delivery in the human central nervous system considerably, especially when the transgene produces a protein normally manufactured in glial cells” (page 590, right column, bottom of first full paragraph), and “All vectors transduced neurons and glial cells, but to a different extent. Although AAV2 transduced more neurons than glial cells (65% of transduced cells that could be assigned a phenotype were NeuN+ neurons), AAV5 transduced neurons and glial cells with apparently equal efficiency (47% were GFAP+, 53% NeuN+)” (Sentences bridging left and right columns on page 590). However, Markakis also noted that AAV serotype 2 (AAV2) is the most widely used AAV vector in clinical trials based largely on its ability to transduce neural cells in the rodent and primate brain (Abstract); and that AAV5 may not be the most efficient vector at transducing neural cells across mammalian species, for example AAV2 and AAV8 have been found to be effective at neural transduction in the canine brain and AAV5 was found to be inefficient in transducing any cells in feline brain (page 591, left column, first full paragraph).
Additionally, Foust et al demonstrated that intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes (Abstract; and Figures 3 and 5). Foust et al also stated “Constructing AAV9-based vectors with neuronal or astrocyte-specific promoters may allow further specificity, given that AAV9 targets multiple nonneuronal tissues after intravenous delivery” (page 63, right column, first paragraph).
Moreover, Chen et al already disclosed expression vectors comprising a glial cell-specific promoter that is operably linked to a nucleic acid encoding NeuroD1 for introducing NeuroD1 into a glial cell, particularly into a reactive astrocyte or NG2 cell, thereby “converting” the reactive glial cell into a functional neuron; wherein the promoter is a GFAP promoter or Aldh1L1 promoter, and wherein the expression vectors can be adeno-associated virus (see at least Abstract; Summary of the Invention; particularly paragraphs [0006]-[0008], [0011], [0051] and [00209]-[00211]). Chen et al also disclosed the nucleic acid sequence of SEQ ID NO: 1 encoding NeuroD1 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 1 of the present application (paragraphs [00442]-[00443]). Chen et al also stated “Conversion of astrocytes, reactive astrocytes, NG2 cells and/or reactive NG2 cells to neurons in vitro, ex vivo and/or in vivo may be used to treat neurodegenerative disease and injury, replacing degenerated neurons and restoring neural function” (paragraph [00173]). Chen et al also demonstrated that NeuroD1 converts astrocytes and reactive astrocytes into functional glutamatergic neurons and converts NG2 cells and reactive NG2 cells into predominantly into functional GABAergic neurons along with a few functional glutamatergic neurons (Examples 17 and 21-22).
Furthermore, Rubenstein et al also disclosed at least using the nucleotide sequence of SEQ ID NO: 1 that encodes the human Dlx2 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 2 of the present application, for increasing Dlx activity which causes differentiation of an immature neuronal cell into a neuronal cell exhibiting the GABAergic phenotype (Abstract; Summary of the Invention; particularly col. 7, line 38 continues to line 27 on col. 8; Examples; issued claims 1-7; and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify a method for forming GABAergic neurons in a striatum of a living mammal’s brain from astrocytes in claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 by also utilizing a recombinant adeno-associated serotype 5, 2 or 9 viral vector comprising a nucleic acid sequence encoding a NeuroD1 polypeptide and a nucleic acid sequence encoding a Dlx2 polypeptide, including the encoded human NeuroD1 polypeptide comprising the amino acid sequence of SEQ ID NO: 2 disclosed by Chen et al, and the encoded human Dlx2 peptide comprising the amino acid sequence of SEQ ID NO: 2 taught by Rubenstein et al, as well as selecting an Aldh1L1 promoter as an astrocyte-specific promoter with a reasonable expectation of success.
An ordinary skilled artisan would have been motivated to carry out the above modifications because Markakis et al already demonstrated that AAV5 is the most efficient AAV vector, not only transducing significantly more cells than any other serotype, but also transducing both NeuN+ and glial-fibrillary-acidic protein positive (GFAP+) cells in the Substantia Nigra and Striatum of a primate brain, while AAV2 is the most widely used AAV vector in clinical trials and it is also capable of transducing neurons and glial cells. Additionally, Foust et al demonstrated successfully that intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes, and taught specifically for constructing AAV9-based vectors with neuronal or astrocyte-specific promoters for further cell targeting specificity. Moreover, Chen et al already disclosed expression vectors comprising a glial cell-specific promoter that is operably linked to a nucleic acid encoding NeuroD1 for introducing NeuroD1 into a glial cell, particularly into a reactive astrocyte or NG2 cell, thereby “converting” the reactive glial cell into a functional neuron; wherein the promoter is a GFAP promoter or Aldh1L1 promoter, and wherein the expression vectors can be adeno-associated virus; as well as the nucleic acid of SEQ ID NO: 1 encoding NeuroD1 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 1 of the present application. Finally, Rubenstein et al also disclosed using the nucleotide sequence of SEQ ID NO: 1 that encodes the human Dlx2 having SEQ ID NO: 2 that is 100% identical to SEQ ID NO: 2 of the present application, for increasing Dlx activity which causes differentiation of an immature neuronal cell into a neuronal cell exhibiting the GABAergic phenotype.
The resulting composition used in the modified method of U.S. Patent No. 10,973,930 along with the teachings of Markakis et al, Foust et al, Chen et al and Rubenstein et al as set forth above is indistinguishable and encompassed by the composition of the present application.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Please also note that the present application is a CON of U.S. Patent No. 10,973,930.
Response to Arguments
In the Amendment dated 12/31/2025 (page 10), Applicant simply requested that in light of currently amended claims the previously non-statutory double patenting rejections should be reconsidered and withdrawn. Additionally, Applicant argued that the rationale underlying the double patenting rejections are substantially similar to that of the rejections under 35 USC 103; and hence Applicant’s above remarks rebutting the obviousness rejections are similarly applicable to the double patenting rejections here.
Please refer to the above modified non-statutory double patenting rejections for details. Please also note that the rationale underlying the double patenting rejections are not substantially similar to the rejections under 35 USC 103; particularly claims 1-6 and 8-11 of U.S. Patent No. 10,973,930 are already drawn specifically to a method for forming GABAergic neurons in a striatum of a living mammal’s brain from astrocytes, wherein said method comprises administering a nucleic acid sequence encoding a NeuroD1 polypeptide and a nucleic acid encoding a Dlx2 polypeptide (e.g., wherein both nucleic acid sequences are located on the same viral vector, or the viral vector is an adeno-associated viral vector; dependent claims 6 and 5, respectively) to said astrocytes within said striatum, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to an astrocyte promoter sequence (e.g., a glial fibrillary acidic protein (GFAP) promoter sequence, dependent claim 11), wherein said NeuroD1 polypeptide and said Dlx2 polypeptide are expressed by said astrocytes (e.g., the nucleic acid sequence encoding said Dlx2 polypeptide is operably linked to a glial fibrillary acid protein promoter sequence, dependent claims 8-10), wherein said astrocytes form said GABAergic neurons within said striatum are DARPP32-positive and functionally integrated into said living mammal’s brain, and wherein said administration comprises a direct injection into said striatum of said living mammal’s brain.
Conclusions
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Patent No. 6602680
SEQ ID NO 1
Alignment Scores:
Length: 2091
Score: 1761.00 Matches: 328
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
DB: 15 Gaps: 0
US-17-178-972-2 (1-328) x US-09-900-527-1 (1-2091)
Qy 1 MetThrGlyValPheAspSerLeuValAlaAspMetHisSerThrGlnIleAlaAlaSer 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGACTGGAGTCTTTGACAGTCTAGTGGCTGATATGCACTCGACCCAGATCGCCGCCTCC 60
Qy 21 SerThrTyrHisGlnHisGlnGlnProProSerGlyGlyGlyAlaGlyProGlyGlyAsn 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AGCACGTACCACCAGCACCAGCAGCCCCCGAGCGGCGGCGGCGCCGGCCCGGGTGGCAAC 120
Qy 41 SerSerSerSerSerSerLeuHisLysProGlnGluSerProThrLeuProValSerThr 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 AGCAGCAGCAGCAGCAGCCTCCACAAGCCCCAGGAGTCGCCCACCCTTCCGGTGTCCACC 180
Qy 61 AlaThrAspSerSerTyrTyrThrAsnGlnGlnHisProAlaGlyGlyGlyGlyGlyGly 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GCCACCGACAGCAGCTACTACACCAACCAGCAGCACCCGGCGGGCGGCGGCGGCGGCGGG 240
Qy 81 GlySerProTyrAlaHisMetGlySerTyrGlnTyrGlnAlaSerGlyLeuAsnAsnVal 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GGCTCGCCCTACGCGCACATGGGTTCCTACCAGTACCAAGCCAGCGGCCTCAACAACGTC 300
Qy 101 ProTyrSerAlaLysSerSerTyrAspLeuGlyTyrThrAlaAlaTyrThrSerTyrAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 CCTTACTCCGCCAAGAGCAGCTATGACCTGGGCTACACCGCCGCCTACACCTCCTACGCT 360
Qy 121 ProTyrGlyThrSerSerSerProAlaAsnAsnGluProGluLysGluAspLeuGluPro 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CCCTATGGAACCAGTTCGTCCCCAGCCAACAACGAGCCTGAGAAGGAGGACCTTGAGCCT 420
Qy 141 GluIleArgIleValAsnGlyLysProLysLysValArgLysProArgThrIleTyrSer 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 GAAATTCGGATAGTGAACGGGAAGCCAAAGAAAGTCCGGAAACCCCGCACCATCTACTCC 480
Qy 161 SerPheGlnLeuAlaAlaLeuGlnArgArgPheGlnLysThrGlnTyrLeuAlaLeuPro 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 AGTTTCCAGCTGGCGGCTCTTCAGCGGCGTTTCCAAAAGACTCAGTACTTGGCCTTGCCG 540
Qy 181 GluArgAlaGluLeuAlaAlaSerLeuGlyLeuThrGlnThrGlnValLysIleTrpPhe 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 GAGCGAGCCGAGCTGGCGGCCTCTCTGGGCCTCACCCAGACTCAGGTCAAAATCTGGTTC 600
Qy 201 GlnAsnArgArgSerLysPheLysLysMetTrpLysSerGlyGluIleProSerGluGln 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 CAGAACCGCCGGTCCAAGTTCAAGAAGATGTGGAAAAGTGGTGAGATCCCCTCGGAGCAG 660
Qy 221 HisProGlyAlaSerAlaSerProProCysAlaSerProProValSerAlaProAlaSer 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 CACCCTGGGGCCAGCGCTTCTCCACCTTGTGCTTCGCCGCCAGTCTCAGCGCCGGCCTCC 720
Qy 241 TrpAspPheGlyValProGlnArgMetAlaGlyGlyGlyGlyProGlySerGlyGlySer 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 TGGGACTTTGGTGTGCCGCAGCGGATGGCGGGCGGCGGTGGTCCGGGCAGTGGCGGCAGC 780
Qy 261 GlyAlaGlySerSerGlySerSerProSerSerAlaAlaSerAlaPheLeuGlyAsnTyr 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 GGCGCCGGCAGCTCGGGCTCCAGCCCGAGCAGCGCGGCCTCGGCTTTTCTGGGCAACTAC 840
Qy 281 ProTrpTyrHisGlnThrSerGlySerAlaSerHisLeuGlnAlaThrAlaProLeuLeu 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 CCCTGGTACCACCAGACCTCGGGATCCGCCTCACACCTGCAGGCCACGGCGCCGCTGCTG 900
Qy 301 HisProThrGlnThrProGlnProHisHisHisHisHisHisHisGlyGlyGlyGlyAla 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 CACCCCACTCAGACCCCGCAGCCGCATCACCACCACCACCATCACGGCGGCGGGGGCGCC 960
Qy 321 ProValSerAlaGlyThrIlePhe 328
||||||||||||||||||||||||
Db 961 CCGGTGAGCGCGGGGACGATTTTC 984
Human NeuroD1 gene, SEQ ID 1.
US2014024599-A1.
Alignment Scores:
Length: 1071
Score: 1900.00 Matches: 356
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
DB: 48 Gaps: 0
US-17-178-972-1 (1-356) x BBB83508 (1-1071)
Qy 1 MetThrLysSerTyrSerGluSerGlyLeuMetGlyGluProGlnProGlnGlyProPro 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGACCAAATCGTACAGCGAGAGTGGGCTGATGGGCGAGCCTCAGCCCCAAGGTCCTCCA 60
Qy 21 SerTrpThrAspGluCysLeuSerSerGlnAspGluGluHisGluAlaAspLysLysGlu 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AGCTGGACAGACGAGTGTCTCAGTTCTCAGGACGAGGAGCACGAGGCAGACAAGAAGGAG 120
Qy 41 AspAspLeuGluAlaMetAsnAlaGluGluAspSerLeuArgAsnGlyGlyGluGluGlu 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GACGACCTCGAAGCCATGAACGCAGAGGAGGACTCACTGAGGAACGGGGGAGAGGAGGAG 180
Qy 61 AspGluAspGluAspLeuGluGluGluGluGluGluGluGluGluAspAspAspGlnLys 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GACGAAGATGAGGACCTGGAAGAGGAGGAAGAAGAGGAAGAGGAGGATGACGATCAAAAG 240
Qy 81 ProLysArgArgGlyProLysLysLysLysMetThrLysAlaArgLeuGluArgPheLys 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CCCAAGAGACGCGGCCCCAAAAAGAAGAAGATGACTAAGGCTCGCCTGGAGCGTTTTAAA 300
Qy 101 LeuArgArgMetLysAlaAsnAlaArgGluArgAsnArgMetHisGlyLeuAsnAlaAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 TTGAGACGCATGAAGGCTAACGCCCGGGAGCGGAACCGCATGCACGGACTGAACGCGGCG 360
Qy 121 LeuAspAsnLeuArgLysValValProCysTyrSerLysThrGlnLysLeuSerLysIle 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CTAGACAACCTGCGCAAGGTGGTGCCTTGCTATTCTAAGACGCAGAAGCTGTCCAAAATC 420
Qy 141 GluThrLeuArgLeuAlaLysAsnTyrIleTrpAlaLeuSerGluIleLeuArgSerGly 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 GAGACTCTGCGCTTGGCCAAGAACTACATCTGGGCTCTGTCGGAGATCCTGCGCTCAGGC 480
Qy 161 LysSerProAspLeuValSerPheValGlnThrLeuCysLysGlyLeuSerGlnProThr 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 AAAAGCCCAGACCTGGTCTCCTTCGTTCAGACGCTTTGCAAGGGCTTATCCCAACCCACC 540
Qy 181 ThrAsnLeuValAlaGlyCysLeuGlnLeuAsnProArgThrPheLeuProGluGlnAsn 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 ACCAACCTGGTTGCGGGCTGCCTGCAACTCAATCCTCGGACTTTTCTGCCTGAGCAGAAC 600
Qy 201 GlnAspMetProProHisLeuProThrAlaSerAlaSerPheProValHisProTyrSer 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 CAGGACATGCCCCCCCACCTGCCGACGGCCAGCGCTTCCTTCCCTGTACACCCCTACTCC 660
Qy 221 TyrGlnSerProGlyLeuProSerProProTyrGlyThrMetAspSerSerHisValPhe 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 TACCAGTCGCCTGGGCTGCCCAGTCCGCCTTACGGTACCATGGACAGCTCCCATGTCTTC 720
Qy 241 HisValLysProProProHisAlaTyrSerAlaAlaLeuGluProPhePheGluSerPro 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 CACGTTAAGCCTCCGCCGCACGCCTACAGCGCAGCGCTGGAGCCCTTCTTTGAAAGCCCT 780
Qy 261 LeuThrAspCysThrSerProSerPheAspGlyProLeuSerProProLeuSerIleAsn 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 CTGACTGATTGCACCAGCCCTTCCTTTGATGGACCCCTCAGCCCGCCGCTCAGCATCAAT 840
Qy 281 GlyAsnPheSerPheLysHisGluProSerAlaGluPheGluLysAsnTyrAlaPheThr 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 GGCAACTTCTCTTTCAAACACGAACCGTCCGCCGAGTTTGAGAAAAATTATGCCTTTACC 900
Qy 301 MetHisTyrProAlaAlaThrLeuAlaGlyAlaGlnSerHisGlySerIlePheSerGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 ATGCACTATCCTGCAGCGACACTGGCAGGGGCCCAAAGCCACGGATCAATCTTCTCAGGC 960
Qy 321 ThrAlaAlaProArgCysGluIleProIleAspAsnIleMetSerPheAspSerHisSer 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 ACCGCTGCCCCTCGCTGCGAGATCCCCATAGACAATATTATGTCCTTCGATAGCCATTCA 1020
Qy 341 HisHisGluArgValMetSerAlaGlnLeuAsnAlaIlePheHisAsp 356
||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 CATCATGAGCGAGTCATGAGTGCCCAGCTCAATGCCATATTTCATGAT 1068