Prosecution Insights
Last updated: April 19, 2026
Application No. 17/196,631

METHODS AND COMPOSITIONS FOR DETECTION OF HPV DNA AND DIAGNOSIS AND MONITORING OF HPV-ASSOCIATED CANCERS

Non-Final OA §103
Filed
Mar 09, 2021
Examiner
HANEY, AMANDA MARIE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Memorial Sloan Kettering Cancer Center
OA Round
3 (Non-Final)
36%
Grant Probability
At Risk
3-4
OA Rounds
3y 7m
To Grant
80%
With Interview

Examiner Intelligence

Grants only 36% of cases
36%
Career Allow Rate
256 granted / 702 resolved
-23.5% vs TC avg
Strong +44% interview lift
Without
With
+44.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
57 currently pending
Career history
759
Total Applications
across all art units

Statute-Specific Performance

§101
22.8%
-17.2% vs TC avg
§103
23.5%
-16.5% vs TC avg
§102
12.1%
-27.9% vs TC avg
§112
31.6%
-8.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 702 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on February 23, 2026 has been entered. Applicant’s remarks and amendments have been fully and carefully considered but are not found to be sufficient to put the application in condition for allowance. Any rejections or objections not reiterated herein have been withdrawn. Applicant’s election of the species of HPV16 and the primer pair of SEQ ID NO: 1 and 2 is reiterated for the record. Claims 1, 5, 9-10, 12-13, 15-18 are currently pending. Claims 10, 12-13, and 15-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected subject matter, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on November 14, 2024. Claim Rejections - 35 USC § 103 3. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 5, and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Jeannot (The Journal of Pathology: Clinical Research Oct 2016 2:201-209) in view of Brown (WO 94/26934 Pub 11/24/1994), Gordon (WO 97/18334 Pub 5/22/1997), and Flores-Munguia (Journal of Molecular Diagnostics Vol 6 No 2 May 2004). The rejection is further evidenced by GenBank Accession K02718 March 1994). Regarding Claim 1 Jeannot teaches that a series of 70 serum specimens, taken at the time of diagnosis, between 2002 and 2013, were retrospectively analyzed in patients with human papillomavirus-16 or human papillomavirus-18-associated carcinomas, composed of 47 cases from the uterine cervix, 15 from the anal canal and 8 from the oro-pharynx. As negative controls, 18 serum samples from women with human papillomavirus-16-associated high-grade cervical intraepithelial neoplasia were also analyzed. Serum samples were stored at -80ºC (27 cases) or at -20ºC (43cases). DNA was isolated from 200 ml of serum or plasma and droplet digital PCR was performed using human papillomavirus-16 E7 and human papillomavirus-18 E7 specific primers. Jeannot teaches that circulating human papillomavirus DNA was detected in 61/70 (87%) serum samples from patients with carcinoma and in no serum from patients with cervical intraepithelial neoplasia. The positivity rate increased to 93% when using only serum stored at -80ºC. Importantly, the two patients with microinvasive carcinomas in this series were positive. Quantitative evaluation showed that circulating viral DNA levels in cervical cancer patients were related to the clinical stage and tumour size, ranging from 55±85 copies/ml (stage I) to 1774±3676 copies/ml (stage IV). Jeannot teaches that circulating human papillomavirus DNA is present in patients with human papillomavirus-associated invasive cancers even at sub-clinical stages and its level is related to tumour dynamics. Droplet digital PCR is a promising method for circulating human papillomavirus DNA detection and quantification. No positivity was found in patients with human papillomavirus-associated high grade cervical intraepithelial neoplasia (abstract). Thus Jeannot teaches a method of detecting HPV16 circulating tumor DNA in a plasma sample from a subject. Jeannot teaches performing a droplet digital polymerase chain reaction comprising contacting a plasma sample obtained from a subject with a primer pair consisting of a forward primer and a reverse primer and determining the presence of a specific amplified PCR product generated in the polymerase chain reaction, wherein if a specific amplified PCR product is detected, the plasma sample contains HPV16 circulating tumor DNA. Regarding Claim 5 Jeannot teaches samples were obtained from 47 patients with different stages of cervical cancer; from 15 patients with anal cancer (14 females, 1 male); from 6 patients with tonsillar cancer (3 females and 3 males); and 2 patients with oro-pharyngeal cancer (2 males) (page 203, col 1). Jeannot teaches that histologically, the cervical cancer cases were mostly identified as squamous cell carcinomas (36 cases). Anal and head and neck cancers were identified as squamous cell carcinomas (page 203, col 2). Thus Jeannot teaches a method wherein the HPV16 circulating tumor DNA is from a squamous cell carcinoma of the head and neck, oropharynx, cervix, or anal canal. Regarding Claim 9 Jeannot teaches samples were obtained from 15 patients with anal cancer (14 females, 1 male) and 2 patients with oro-pharyngeal cancer (2 males) (page 203, col 1). Jeannot teaches that the anal and head and neck cancers were identified as squamous cell carcinomas (page 203, col 2). Thus Jeannot teaches a method wherein the subject has a squamous cell carcinoma of the oropharynx or of the anal canal. Jeannot does not teach a method wherein the forward primer comprises SEQ ID NO: 1 and the reverse primer comprises SEQ ID NO: 2 (clm 1). However Brown discloses primers for amplifying HPV16. The primer of SEQ ID NO: 13 comprises the full length sequence of SEQ ID NO: 1 from the instant specification. SEQ ID NO: 1 1 TATGCACAGAGCTGCAAACA 20 |||||||||||||||||||| SEQ ID NO: 13 1GTTATGCACAGAGCTGCAAACAA 23 Additionally Gordon discloses primers for amplifying HPV16. The primer of SEQ ID NO: 29 comprises nucleotides 3-22 of SEQ ID NO: 2 from the instant specification. SEQ ID NO: 2 1 GCAAAGTCATATACCTCACGTC 22 |||||||||||||||||||| SEQ ID NO: 29 1 AAAGTCATATACCTCACGTCGC 22 Further Flores-Munguia provides guidance on how to design primers and probes for HPV detection. Flores-Munguia teaches that the E6/E7 regions of HPV types 16 (nt 65–857), 18 (nt 87–907), 31 (nt 39–856), 39 (nt 44–921), 45 (nt 75–906), 51 (nt 88–865), 52 (nt 93–852), and 58 (nt 77–869) were obtained from Los Alamos HPV database (http://hpv-web.lanl.gov/stdgen/virus/hpv/). The nucleotide sequence for each type was aligned to identify highly heterologous regions and used to design type-specific probes and primers by the software Primer Express (Applied Biosystems). Primers and probes spanning a targeted region <200bp were selected according to the specifications in the software manual. Type specificity was determined by no-predicted cross-hybridization with other HPV types using the NCBI database BLAST search (page 116, col 2). Shown below is an alignment of Brown’s and Gordons primers (in bold) with an HPV16, complete genome sequence (GenBank Accession K02718). SEQ ID NO: 1 and 2 are underlined. 1 actacaataa ttcatgtata aaactaaggg cgtaaccgaa atcggttgaa ccgaaaccgg 61 ttagtataaa agcagacatt ttatgcacca aaagagaact gcaatgtttc aggacccaca 121 ggagcgaccc agaaagttac cacagttatg cacagagctg caaacaacta tacatgatat 181 aatattagaa tgtgtgtact gcaagcaaca gttactgcga cgtgaggtat atgactttgc 241 ttttcgggat ttatgcatag tatatagaga tgggaatcca tatgctgtat gtgataaatg 301 tttaaagttt tattctaaaa ttagtgagta tagacattat tgttatagtt tgtatggaac 361 aacattagaa cagcaataca acaaaccgtt gtgtgatttg ttaattaggt gtattaactg 421 tcaaaagcca ctgtgtcctg aagaaaagca aagacatctg gacaaaaagc aaagattcca 481 taatataagg ggtcggtgga ccggtcgatg tatgtcttgt tgcagatcat caagaacacg 541 tagagaaacc cagctgtaat catgcatgga gatacaccta cattgcatga atatatgtta 601 gatttgcaac cagagacaac tgatctctac tgttatgagc aattaaatga cagctcagag 661 gaggaggatg aaatagatgg tccagctgga caagcagaac cggacagagc ccattacaat 721 attgtaacct tttgttgcaa gtgtgactct acgcttcggt tgtgcgtaca aagcacacac 781 gtagacattc gtactttgga agacctgtta atgggcacac taggaattgt gtgccccatc 841 tgttctcaga aaccataatc taccatggct gatcctgcag gtaccaatgg ggaagagggt 901 acgggatgta atggatggtt ttatgtagag gctgtagtgg aaaaaaaaac aggggatgct 961 atatcagatg acgagaacga aaatgacagt gatacaggtg aagatttggt agattttata 1021 gtaaatgata atgattattt aacacaggca gaaacagaga cagcacatgc gttgtttact 1081 gcacaggaag caaaacaaca tagagatgca gtacaggttc taaaacgaaa gtatttggta While the prior art does not teach a forward primer consisting of SEQ ID NO: 1 and a reverse primer comprising SEQ ID NO: 2, it was well known in the art at the time of the invention how to design primers for amplifying HPV16 nucleic acid sequences. Designing primers which are equivalents to those recited by the claims is considered routine experimentation especially since the full length sequence of HPV16 was already known. Further the parameters and objectives involved in the selection of primers were known. Thus the prior art is replete with guidance and information necessary to permit the ordinary artisan to design primers for amplifying the E6 region of HPV16. Further, based on the known alignment tools (i.e., BLAST) and primer design software (i.e., Primer Express) an ordinary artisan would have had more than a reasonable expectation of success of making a primer pair for amplifying the HPV16 E6 DNA. A skilled artisan having knowledge of the sequence of HPV16 would have found it “obvious to try” the primers recited in the claims because the artisan would have had a finite number of identified, predictable sequence options for these primers, and the artisan would have had good reason to pursue these known options, which were within the artisans technical grasp. Thus, for the reasons provided above, a method using a forward primer consisting of SEQ ID NO: 1 and a reverse primer comprising 2 would have been obvious to one of ordinary skill in the art. Response To Arguments 4. In the response the Applicants traversed the rejections made under 35 USC 103. The Applicants argue that the pending claims have been amended herein such that they now recite or require the specific HPV16 primer pair wherein the forward primer consists of SEQ ID NO. 1 and the reverse primer consists of SEQ ID NO. 2 and also now recite or require performing a droplet digital polymerase chain reaction ("ddPCR"). As such, the scope of the claims as amended herein is now consistent with the scope of the data from the application as filed that was relied upon in Applicant's prior argument of unexpected results. The amendments have been fully considered. The claims are now limited to a ddPCR reaction, wherein the forward primer consists of SEQ ID NO. 1 and the reverse primer comprises of SEQ ID NO. 2. The claims as amended are still not commensurate in scope with the specific teachings in the specification that are being relied upon to show unexpected results. In view of the “comprising” language the claims encompass primers that comprise the full length of SEQ ID NO: 2, with or without additional nucleotides at either or both ends. However the specification teaches that droplet digital PCR was performed with SEQ ID NOs: 1 and 2. The primers used in the examples are limited to the sequence of nucleotides as specified by SEQ ID NOs: 1 and 2, and nothing more or less. Thus Applicants showing of unexpected results is still not commensurate in scope with the invention as claimed. The Applicants state that as described at pages 39-40 of the application as-filed, of 97 stage I-IVB HPV+ OPSCC patients, HPV16 ctDNA was detected in 90 patients, demonstrating a sensitivity of 92.8%. 20 samples were tested from normal subjects without cancer and 7 samples from patients with HPV negative head and neck cancers and no PCR products were detected in these 27 cases, demonstrating 100% specificity for detection of tumor-derived HPV16 DNA. These results demonstrate that HPV 16 ctDNA can be effectively used with very high sensitivity and specificity for detection of tumors, demonstrating clinical utility for screening and treatment response monitoring (see pages 43-44 of the present application as filed). Applicants argue that it could not have been predicted that performing ddPCR using the specific primer pair recited in the present claims would permit highly sensitive and specific detection of HPV circulating tumor DNA, as opposed to non-tumor HPV viral DNA, in plasma. These unexpected results provide important practical advantages as they mean that the claimed methods can be used for tumor diagnosis without confounding false positives caused by detection of HPV virus infection in the absence of malignancy. Accordingly, in view of these unexpected results, Applicant respectfully submits that the present claims, as amended herein, are not rendered obvious by the art cited in the present Office Action. These arguments have been fully considered but are not persuasive. Evidence of unexpected results is frequently in the form of a direct comparison of the claimed invention with the closest prior art. Herein, Jeannot is the closest subject matter that exists in the prior art. Jeannot teaches that a series of 70 serum specimens, were retrospectively analyzed in patients with human papillomavirus-16 or human papillomavirus-18-associated carcinomas, composed of 47 cases from the uterine cervix, 15 from the anal canal and 8 from the oro-pharynx. As negative controls, 18 serum samples from women with human papillomavirus-16-associated high-grade cervical intraepithelial neoplasia were also analyzed. DNA was isolated from 200 ml of serum or plasma and droplet digital PCR was performed using human papillomavirus-16 E7 and human papillomavirus-18 E7 specific primers. Jeannot teaches that circulating human papillomavirus DNA was detected in 61/70 (87%) serum samples from patients with carcinoma and in no serum from patients with cervical intraepithelial neoplasia (abstract). Jeannot teaches than none of the 18 serum specimens used as negative controls in women diagnosed with high grade CIN3, were found to be positive, demonstrating the specificity of the approach for detecting invasive cancers (page 205, col 1). Jeannot further teaches the detection rate of c-HPV DNA using ddPCR and qPCR in patients diagnosed with HPV associated invasive carcinoma (Table 1). PNG media_image1.png 392 1034 media_image1.png Greyscale Jeannot teaches a sensitivity of 83% for uterine cervix, 93% for anal cancer, 100% for head and neck cancer and 87% for these cancers combined. The instant specification teaches 92.8% specificity for OPSCC. Thus Jeannot also teaches a ddPCR assay with a very high sensitivity. Jeannot and the specification both teach ddPCR assays for HPV16 with a specificity of 100%. Thus the fact that the inventors were able to detect only tumor-derived HPV, and not HPV DNA present as a result of HPV infection or HPV associated in situ lesions in the absence of malignancy is NOT unexpected because this was taught in the prior art. For these reasons, the Applicants have not met the burden of establishing that the results obtained using the claimed primers are in fact unexpected, unobvious, and of statistical and practical significance. 5. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached Monday-Friday, 8:15am-4:45pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached on 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA HANEY/Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Mar 09, 2021
Application Filed
Feb 03, 2025
Non-Final Rejection — §103
Aug 06, 2025
Response Filed
Aug 19, 2025
Final Rejection — §103
Feb 23, 2026
Request for Continued Examination
Feb 26, 2026
Response after Non-Final Action
Mar 02, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577612
DEVICES AND METHOD FOR DETECTING AN AMPLIFICATION EVENT
2y 5m to grant Granted Mar 17, 2026
Patent 12546786
CIRCULATORY BIOMARKERS FOR PLACENTAL OR FETAL HEALTH
2y 5m to grant Granted Feb 10, 2026
Patent 12545957
METHOD OF DETERMINING ENDOMETRIAL RECEPTIVITY AND APPLICATION THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12516390
Methods and Systems for Predicting Whether a Subject Has a Cervical Intraepithelial Neoplasia (CIN) Lesion from a Suspension Sample of Cervical Cells
2y 5m to grant Granted Jan 06, 2026
Patent 12503733
METHODS OF IDENTIFYING AND TREATING A PERSON HAVING A PREDISPOSITION TO OR AFFLICTED WITH A CARDIOMETABOLIC DISEASE
2y 5m to grant Granted Dec 23, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
36%
Grant Probability
80%
With Interview (+44.0%)
3y 7m
Median Time to Grant
High
PTA Risk
Based on 702 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month