Prosecution Insights
Last updated: April 19, 2026
Application No. 17/235,153

OLIGONUCLEOTIDES FOR MSH3 MODULATION

Final Rejection §103
Filed
Apr 20, 2021
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF MASSACHUSETTS
OA Round
4 (Final)
52%
Grant Probability
Moderate
5-6
OA Rounds
3y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
32 granted / 61 resolved
-7.5% vs TC avg
Strong +60% interview lift
Without
With
+60.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
49 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
7.3%
-32.7% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.5%
-17.5% vs TC avg
§112
28.4%
-11.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 87, 97, 157, 158, 162, 166, 167, 176, 198-199, 202-206, 208, 210-215, 216-228 are pending and are examined here along with elected species of SEQ ID NO: 2. Priority Acknowledgement of the claim to domestic benefit of U.S. Provisional Application 63/012,603, filed on 04/20/2020, is noted. All the examined claims enjoy the benefit of ‘603 filing date. Information Disclosure Statement The information disclosure statement (IDS) submitted on 11/03/2025 was filed before the mailing date of the instant Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Rejections - 35 USC § 103 The rejection of claims 87, 97, 157, 158, 162, 166, 167, 176, 198-199, 202-206, 208-215 is maintained and new claims 216-228 are also rejected as noted below. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 87, 97, 157, 158, 162, 166, 167, 176, 198-199, 202-206, 208-228 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (WO2017132669, pub. 08/03/2017, referred as Khvorova; although the applicant is the same as the instant application, the publication date is a year prior of the effective filing date (EFD) of the instant application, in IDS) in view of Bermingham et al. (WO2020117703, pub. date 06/11/2020 with EFD 12/3/2018, thus a 102(a)(2) reference, referred as Bermingham, of record) and Hough et al., (Nature Biotechnology, 21, 731-732, of record, referred as Hough) and Foster et al. (2018, Molecular Therapy, 26, pg. 708-717, referred as Foster). Regarding instant cl. 87, 97, 176, 198, 199, 213, and 216-219, the elected species SEQ ID NO: 2 has the following 45 nt. target sequence: auaaggugggaguugugaagcaaacugaaacugcagcauuaaagg, and SEQ ID NO: 14 is caaacugaaa cugca, a 15 nt. subsequence within instant SEQ ID NO: 2 (bolded/italicized). SEQ ID NO: 8 (UGCAGUUUCAGUUUGCUUCA, a 20 nt. sequence) of instant claim 97 is the antisense strand complementary to the underlined portion of elected SEQ ID NO:2. Khvorova discloses a branched oligonucleotide compound comprising two or more nucleic acids (NA), wherein the NA are connected to one another by one or more moieties selected from a linker, a spacer and a branching point (claim 1); discloses nucleic acid as double-stranded comprising sense and antisense strands (claim 7, relevant to instant cl. 87), each comprising a 5’ end and a 3’ end (see Fig. 1 below); and antisense strand comprises at least 16-20 contiguous nucleotides and has complementarity to a target (claim 13, relevant to instant cl. 87); discloses a double-stranded RNA sequence containing at least one uracil, thus disclosing a RNA compound (claim 23); therapeutic nucleic acid is defined as NA that has complementarity to a disease-associated target mRNA (par. 146). A composite figure of Fig. 1 and 9 (see below, Fig. 1 (bottom) and Fig. 9 (top)) illustrates a branched RNA compound comprising an ethylene glycol chain linker that conjugates the sense strands of the two asymmetric dsRNA molecule with the Fig. 9 dsRNA of antisense strand of 20 nt. and sense strand of 15 nt. (relevant to instant cl. 87, 199, 213, 219). Although figures below discloses dsRNAs that have every nt. modified, Khvorova also recognizes that either strand can be composed of unmodified nucleotides (i.e. A, U, G, C, see par. 18), thus antisense strand has nt. that are not modified, i.e. are not 2OMe, at position 5 and pos. 2, 14 (rel. for ins. Cl. 87, 218). Khvorova Fig. 14 demonstrates wide distribution and efficacy of silencing a target mRNA expression throughout the spinal cord following bolus intrathecal injection of di-hsiRNA (di-hsiRNA illustrated in Fig. 1, bottom structure below) (par. 47, see Fig. 14). PNG media_image1.png 736 667 media_image1.png Greyscale Khvorova does not disclose MSH3 mRNA as the target mRNA, nor an antisense sequence complementary to portion of SEQ ID NO: 2 or an antisense strand comprising SEQ ID NO: 8 that has no more than 3 mismatches or fully complementary to with a MSH3 nucleic acid sequence of SEQ ID NO: 14. Bermingham discloses an invention of antisense oligonucleotides (ASO) complementary to MSH3 transcript, with one 20 nt. antisense oligonucleotide sequence, SEQ ID NO: 491 with the sequence GCAGTTTCAGTTTGCTTCAC (Table 2, pg. 74) and discloses that oligonucleotides can comprise RNA nucleosides (pg. 37, lines 30). SEQ ID NO: 491 is complementary to portion of instant SEQ ID NO: 2 and is complementary to 14/15 nt. of instant SEQ ID NO: 14 (caaacugaaacugca, relevant to instant cl. 87, 198), and reads on a portion of instant SEQ ID NO: 8 (the bolded portion of sequence: UGCAGUUUCAGUUUGCUUCA, relevant to instant cl. 97). Bermingham discloses a SEQ ID NO: 492 (ATGCTGCAGTTTCAGTTTGC) which is fully complementary to instant SEQ ID NO: 14 (caaacugaaacugca) (Table 2, pg. 74, relevant to instant cl. 217). Bermingham discloses the SEQ ID NO: 491 as a therapeutic oligonucleotide targeting MSH3 mRNA to treat trinucleotide repeat expansion disorder, including Huntington’s disease (HD) (pg. 1). Bermingham SEQ ID NOs: 491 and 492 results in approximately 80% of inhibition with 2 nM of SEQ ID NOs: 491 and 492 (see below, excerpt from Table 2, pg. 74). PNG media_image2.png 139 1168 media_image2.png Greyscale Bermingham discloses the application of a pharmaceutical composition comprising one or more oligonucleotides and a pharmaceutically acceptable carrier (pg. 6, line 32-34, relevant to instant cl. 176). Although Bermingham does not disclose a double-stranded RNA molecule, Khvorova points out therapeutic oligonucleotides are simple and effective tools for inhibition of gene function (par. 4) including both single-stranded oligomers, including gapmers, and double-stranded siRNAs (par. 4, 87, 152, 167). Further Khvorova, highlights that the preferred embodiment is a duplex with internally modified nucleotide (par. 201). Hough discloses that siRNA and antisense oligonucleotides generally have similar potency targeting similar region of the transcript and both have “similar hit-rate (percentage of compounds that effectively inhibit the target (Fig. 1) and potency (pg. 731-732). Comparing the two types of compounds, Hough note that siRNA is preferred because siRNA is highly effective without any chemical modifications compared to traditional antisense compounds and note that “an unexpected observation that the duration of inhibition of endogenous targets after a single dosing of siRNA is longer than that obtained with the chemically stabilized antisense compounds used in this study. The longer duration of inhibition coupled with the reduced toxicity of siRNA enables the evaluation of gene function in complex and long-term phenotypic assays” (pg. 732). Similar to Khvorova pointing out the preference for a dsRNA/siRNA compound over the antisense oligonucleotide, Hough also notes the preference of dsRNA siRNA molecule due to prolonged activity with reduced toxicity. Further, Khvorova discloses preferential embodiments of a sense strand of dsRNA with alternating 2OMe and 2F nt. modifications (see composite figure above, or Structure of Formula (III), par. 112). Thus, the sense strand has ~50% 2OMe nt. modifications. Foster demonstrates substantial efficacy improvements by further refining siRNA chemistry by optimizing the positioning of 2OMe and 2F modifications across both strands of dsRNA siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). Foster teaches in Fig. 2B that 2OMe content of sense strand ranging from 43% (parent) to 90% (DV11), thus the instant claimed range of 65% to 70% lies inside the disclosed range and therefore is prima facie obvious (relevant to instant cl. 87). Foster teaches that the antisense strand prefers 2F at pos. 2, 5 and 14 (Fig. 1A, relevant to instant cl. 87, 218). Foster teaches that pos. 11 (from 3’ end) of sense strand is not 2OMe (see 1B) and designed all the sense strands with pos. 11 (from 3’ end) of sense strand with 2F nt. modification (see Fig. 1C, 2A-C, relevant to instant cl. 216). 2OMe is sterically more demanding modification and has a greater stabilizing effect compared to less bulky modification, such as 2F (pg. 708). With the goal of reducing 2F content (pg. 709), the 2OMe's positioning needs to be applied judiciously without substantially reducing RNAi activity (pg. 708). The screen identified two optimal siRNA duplex, labeled as DV18 and DV22, whose sense strand had 17 nt. modified with 2OMe and 4 nt. modified with 2F (~80%; see Fig. 2C, pg. 711; Fig. 3, pg. 712, Fig. 4 demonstrate improved results both in vivo mouse and non-human primate, pg. 713). Thus Foster indicates improving the efficacy of a fully modified 2OMe and 2F siRNA by optimizing the positioning of 2OMe and 2F nt. modifications across both strands of dsRNA. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the branched oligonucleotide targeting mRNA of Khvorova in view of Bermingham, Hough, and Foster and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the branched dsRNA oligonucleotide of Khvorova with a specific, required oligonucleotide sequence to inhibit MSH3 expression to treat HD as taught by Bermingham, based on the specific SEQ ID NO: 491/492 being successful in inhibiting the expression of MSH3, and Hough disclosing that siRNAs improved inhibitory profile than antisense oligonucleotides, and Khvorova disclosing the improved distribution and efficacy in silencing the target protein in vivo in the CNS. Further, a skilled artisan would also try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA. Foster recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Further a skilled artisan would expect reasonable success increasing 2OMe content in an siRNA since both of the improved Foster in vivo siRNAs had ~80% 2OMe content. Also, the following KSR rationales may apply here: rationale (a) combining prior art elements by introducing the specific MSH3 sequence into dsRNA product of Khvorova, (b) simple substitution of one known element for another (i.e. dsRNA for ssRNA to inhibit MSH3 expression); and (e) obvious to try finite number of identified, predictable solutions. Thus cl. 87, 97, 176, 198, 199, 213, 216-219 are rejected under 35 U.S.C. 103. Regarding instant claims 157, 158, 162, 202-206, 211, 214, and 220-223, Khvorova discloses in claim 18 a compound of formula (I): L-(N)n, with L selected from various groups, including ethylene glycol chain, and N is an RNA duplex comprising a sense and AS strands with each strand independently comprising one or more chemical modifications and n is 2-8; Fig. 1 illustrates a branched dsRNA molecule (n=2) with antisense strand of 20 nt. and sense strand of 15 nt. (see composite figure of Khvorova Figs. 1 and 9 above, relevant to instant cl. 157, 214). In structure of Formula (VII), Khvorova discloses a duplex with both strands of 20 nt. (par. 122), thus for sense strand, Khvorova discloses a range of 15 – 20 nt., and there is sufficient overlap with instant range of 16 to 21 nt. for prima facie obviousness (relevant to instant c. 223). Khvorova discloses the formula I-1, which is the elected N-L-N, (claim 19, relevant to instant cl. 158) and formula with L1 structure (claim 27, relevant to instant cl. 162). PNG media_image3.png 88 471 media_image3.png Greyscale Khvorova, in claim 20, discloses antisense strand comprising a 5’ terminal group R selected from the group consisting of structures enumerated as R1 to R8, which are the same 8 structures as R1 to R8 of instant claim 202 , including the structure R3 enumerated in instant claim 205. Khvorova, in claim 21, discloses having the structure of formula (II) (see below) and is same as instant enumerated structure of cl. 203: PNG media_image4.png 101 411 media_image4.png Greyscale . Khvorova, in claim 24, teaches the formula V, which reads on the structure enumerated in instant claim 204. PNG media_image5.png 293 448 media_image5.png Greyscale The designation for X, Y, -, = and, ---- as noted above are same for both, a base-pairing interaction (relevant for instant cl. 203 and 204). Khvorova cl. 29 discloses a L2 linker structure, which is same as instant structure L2 (structure below, relevant to instant cl. 206). PNG media_image6.png 86 460 media_image6.png Greyscale Regarding instant cl. 211, Khvorova discloses B is a triol (e.g. glycerol) or tetrol (e.g. ribose) (par. 105). Khvorova Fig. 14 demonstrates wide distribution and efficacy of silencing a target mRNA expression throughout the spinal cord following bolus intrathecal injection of di-hsiRNA (di-hsiRNA illustrated in Fig. 1, bottom structure below) (par. 47, see Fig. 14). Khvorova does not disclose MSH3 mRNA as the target mRNA, nor an antisense sequence complementary to portion of SEQ ID NO: 2 or an antisense strand comprising SEQ ID NO: 8 that has no more than 3 mismatches with a MSH3 nucleic acid sequence of SEQ ID NO: 14. Bermingham discloses an invention of antisense oligonucleotides (ASO) complementary to MSH3 transcript, with one 20 nt. antisense oligonucleotide sequence, SEQ ID NO: 491 with the sequence GCAGTTTCAGTTTGCTTCAC (Table 2, pg. 74) and discloses that oligonucleotides can comprise RNA nucleosides (pg. 37, lines 30). SEQ ID NO: 491 is complementary to portion of instant SEQ ID NO: 2 and is complementary to 14/15 nt. of instant SEQ ID NO: 14 (caaacugaaacugca, relevant to instant cl. 157), and reads on a portion of instant SEQ ID NO: 8 (the bolded portion of sequence: UGCAGUUUCAGUUUGCUUCA). Bermingham also discloses a SEQ ID NO: 492 (ATGCTGCAGTTTCAGTTTGC) which is fully complementary to instant SEQ ID NO: 14 (caaacugaaacugca) (Table 2, pg. 74, relevant to instant cl. 157, 221). Bermingham discloses the SEQ ID NO: 491 as a therapeutic oligonucleotide targeting MSH3 mRNA to treat trinucleotide repeat expansion disorder, including Huntington’s disease (HD) (pg. 1). Bermingham SEQ ID NOs: 491 and 492 results in approximately 80% of inhibition with 2 nM of SEQ ID NOs: 491 and 492 (see below, excerpt from Table 2, pg. 74). PNG media_image2.png 139 1168 media_image2.png Greyscale Although Bermingham does not disclose a double-stranded RNA molecule, Khvorova points out therapeutic oligonucleotides are simple and effective tools for inhibition of gene function (par. 4) including both single-stranded oligomers, including gapmers, and double-stranded siRNAs (par. 4, 87, 152, 167). Further Khvorova, highlights that the preferred embodiment is a duplex with internally modified nucleotide (par. 201). Hough discloses that siRNA and antisense oligonucleotides generally have similar potency targeting similar region of the transcript and both have “similar hit-rate (percentage of compounds that effectively inhibit the target (Fig. 1) and potency (pg. 731-732). Comparing the two types of compounds, Hough note that siRNA is preferred because siRNA is highly effective without any chemical modifications compared to traditional antisense compounds and note that “an unexpected observation that the duration of inhibition of endogenous targets after a single dosing of siRNA is longer than that obtained with the chemically stabilized antisense compounds used in this study. The longer duration of inhibition coupled with the reduced toxicity of siRNA enables the evaluation of gene function in complex and long-term phenotypic assays” (pg. 732). Similar to Khvorova pointing out the preference for a dsRNA/siRNA compound over the antisense oligonucleotide, Hough also note the preference of dsRNA siRNA molecule due to prolonged activity with reduced toxicity. Further, Khvorova discloses preferential embodiments of a sense strand of dsRNA with alternating 2OMe and 2F nt. modifications (see composite figure above, or Structure of Formula (III), par. 112). Thus, the sense strand has ~50% 2OMe nt. modifications. Foster demonstrates substantial efficacy improvements by further refining siRNA chemistry by optimizing the positioning of 2OMe and 2F modifications across both strands of dsRNA siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). Foster teaches in Fig. 2B that 2OMe content of sense strand ranging from 43% (parent) to 90% (DV11), thus the instant claimed range of 65% to 70% lies inside the disclosed range and therefore is prima facie obvious (relevant to instant cl. 157). Foster teaches that the antisense strand prefers 2F at pos. 2, 5 and 14 (Fig. 1A, relevant to instant cl. 157, 222). Foster teaches that pos. 11 (from 3’ end) of sense strand is not 2OMe (see 1B) and designed all the sense strands with pos. 11 (from 3’ end) of sense strand with 2F nt. modification (see Fig. 1C, 2A-C, relevant to instant cl. 220). 2OMe is sterically more demanding modification and has a greater stabilizing effect compared to less bulky modification, such as 2F (pg. 708). With the goal of reducing 2F content (pg. 709), the 2OMe's positioning needs to be applied judiciously without substantially reducing RNAi activity (708). The screen identified two optimal siRNA duplex, labeled as DV18 and DV22, whose sense strand had 17 nt. modified with 2OMe and 4 nt. modified with 2F (see Fig. 2C, pg. 711; Fig. 3, pg. 712, Fig. 4, improved results both in vivo mouse and non-human primate). Thus Foster indicate improving the efficacy of a fully modified 2OMe and 2F siRNA by testing out optimizing the positioning of 2OMe and 2F nt. modifications across both strands of dsRNA. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the branched oligonucleotide targeting mRNA of Khvorova in view of Bermingham, Hough, and Foster and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the branched dsRNA oligonucleotide of Khvorova with a specific, required oligonucleotide sequence to inhibit MSH3 expression to treat HD as taught by Bermingham, based on the specific SEQ ID NO: 491/492 being successful in inhibiting the expression of MSH3, and further based on Hough disclosing that siRNAs improved inhibitory profile than antisense oligonucleotides. Further, a skilled artisan would also try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA. Further Foster also recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Further a skilled artisan would expect reasonable success in attempts to increase the 2OMe content since both of the improved siRNAs had ~80% 2OMe content. Also, the following KSR rationales may apply here: rationale (a) combining prior art elements by introducing the specific MSH3 sequence into dsRNA product of Khvorova, (b) simple substitution of one known element for another (i.e. dsRNA for ssRNA to inhibit MSH3 expression); and (e) obvious to try finite number of identified, predictable solutions. Thus instant claims 157, 158, 162, 202-206, 211, 214, and 220-223 are rejected under 35 U.S.C. 103. Regarding instant claims 166, 167, 208, 210, 212, 215, and 224-228, Khvorova discloses in claim 31 a delivery system for therapeutic NA having the structure of Formula VIII, which is L-(cNA)n, with L is selected from various groups, including ethylene glycol chain, and each cNA is a carrier NA comprising one or more chemical modifications with n having a value from 2-8; Fig. 1 illustrates a branched dsRNA molecule (n=2) with antisense strand, i.e. NA strand, of 20 nt. and cNA strand of 15 nt. with 5’ and 3’ ends (see composite figure of Khvorova Figs. 1 and 9 above, relevant to instant cl. 166). Khvorova discloses in claim 32 having structures with formulas VIII-1 through VIII-9, which are the same structures enumerated as formulas VI-1 through VI-9 of instant claim 167, and comprises formula VIII-8 comprises at least one B, which includes B as a polyvalent organic species, and one S moiety, which includes S as an ethylene glycol chain (relevant to instant cl. 167, 208). In structure of Formula (VII), Khvorova discloses a duplex with both strands of 20 nt. (par. 122), thus for sense strand, Khvorova discloses a range of 15 – 20 nt., and there is sufficient overlap with instant range of 16 to 21 nt. for prima facie obviousness (relevant to instant c. 227). Khvorova discloses in claim 35 wherein each NA is hybridized to least one cNA and, claim 38 discloses each NA comprises an unpaired overhang of at least 2 nt. Khvorova discloses the delivery system further comprises n therapeutic nucleic acids (NA), wherein each NA is hybridized to at least one cNA (par. 135). Composite figure of Figures 1 and 9, noted above, illustrates typical embodiments of hybridized NA and cNA with unpaired overhang of at least 2 nt. and n=2 (relevant to instant cl. 210, 215). Khvorova Formula V (see above) discloses that the overhangs comprises phosphorothioate INL (see above, relevant instant cl. 228). Khvorova discloses B is a triol (e.g. glycerol) or tetrol (e.g. ribose) (par. 105, relevant to instant cl. 212). Khvorova does not disclose MSH3 mRNA as the target mRNA, nor an antisense sequence complementary to portion of SEQ ID NO: 2 or an antisense strand comprising SEQ ID NO: 8 that has no more than 3 mismatches with a MSH3 nucleic acid sequence of SEQ ID NO: 14. Bermingham discloses an invention of antisense oligonucleotides (ASO) complementary to MSH3 transcript, with one 20 nt. antisense oligonucleotide sequence, SEQ ID NO: 491 with the sequence GCAGTTTCAGTTTGCTTCAC (Table 2, pg. 74) and discloses that oligonucleotides can comprise RNA nucleosides (pg. 37, lines 30). SEQ ID NO: 491 is complementary to portion of instant SEQ ID NO: 2 and is complementary to 14/15 nt. of instant SEQ ID NO: 14 (caaacugaaacugca, relevant to instant cl. 166), and reads on a portion of instant SEQ ID NO: 8 (the bolded portion of sequence: UGCAGUUUCAGUUUGCUUCA, relevant to instant cl. 166). Bermingham also discloses a SEQ ID NO: 492 (ATGCTGCAGTTTCAGTTTGC) which is fully complementary to instant SEQ ID NO: 14 (caaacugaaacugca) (Table 2, pg. 74, relevant to instant cl. 166, 225). Bermingham discloses the SEQ ID NO: 491 as a therapeutic oligonucleotide targeting MSH3 mRNA to treat trinucleotide repeat expansion disorder, including Huntington’s disease (HD) (pg. 1). Bermingham SEQ ID NOs: 491 and 492 results in approximately 80% of inhibition with 2 nM of SEQ ID NOs: 491 and 492 (see below, excerpt from Table 2, pg. 74). PNG media_image2.png 139 1168 media_image2.png Greyscale Although Bermingham does not disclose a double-stranded RNA molecule, Khvorova points out therapeutic oligonucleotides are simple and effective tools for inhibition of gene function (par. 4) including both single-stranded oligomers, including gapmers, and double-stranded siRNAs (par. 4, 87, 152, 167). Further Khvorova, highlights that the preferred embodiment is a duplex with internally modified nucleotide (par. 201). Hough discloses that siRNA and antisense oligonucleotides generally have similar potency targeting similar region of the transcript and both have “similar hit-rate (percentage of compounds that effectively inhibit the target (Fig. 1) and potency (pg. 731-732). Comparing the two types of compounds, Hough note that siRNA is preferred because siRNA is highly effective without any chemical modifications compared to traditional antisense compounds and note that “an unexpected observation that the duration of inhibition of endogenous targets after a single dosing of siRNA is longer than that obtained with the chemically stabilized antisense compounds used in this study. The longer duration of inhibition coupled with the reduced toxicity of siRNA enables the evaluation of gene function in complex and long-term phenotypic assays” (pg. 732). Similar to Khvorova pointing out the preference for a dsRNA/siRNA compound over the antisense oligonucleotide, Hough also note the preference of dsRNA siRNA molecule due to prolonged activity with reduced toxicity. Further, Khvorova discloses preferential embodiments of a sense strand of dsRNA with alternating 2OMe and 2F nt. modifications (see composite figure above, or Structure of Formula (III), par. 112). Thus, the sense strand has ~50% 2OMe nt. modifications. Foster demonstrates substantial efficacy improvements by further refining siRNA chemistry by optimizing the positioning of 2OMe and 2F modifications across both strands of dsRNA siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). Foster teaches in Fig. 2B that 2OMe content of sense strand ranging from 43% (parent) to 90% (DV11), thus the instant claimed range of 65% to 70% lies inside the disclosed range and therefore is prima facie obvious (relevant to instant cl. 166). Foster teaches that the antisense strand (NA here) prefers 2F at pos. 2, 5 and 14 (Fig. 1A, relevant to instant cl. 166, 226). Foster teaches that pos. 11 (from 3’ end) of sense strand (cNA here) is not 2OMe (see 1B) and designed all the sense strands with pos. 11 (from 3’ end) of sense strand with 2F nt. modification (see Fig. 1C, 2A-C, relevant to instant cl. 224). 2OMe is sterically more demanding modification and has a greater stabilizing effect compared to less bulky modification, such as 2F (pg. 708). With the goal of reducing 2F content (pg. 709), the 2OMe's positioning needs to be applied judiciously without substantially reducing RNAi activity (708). The screen identified two optimal siRNA duplex, labeled as DV18 and DV22, whose sense strand had 17 nt. modified with 2OMe and 4 nt. modified with 2F (see Fig. 2C, pg. 711; Fig. 3, pg. 712, Fig. 4, improved results both in vivo mouse and non-human primate). Thus Foster indicate improving the efficacy of a fully modified 2OMe and 2F siRNA by testing out optimizing the positioning of 2OMe and 2F nt. modifications across both strands of dsRNA. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the branched oligonucleotide targeting mRNA of Khvorova in view of Bermingham, Hough, and Foster and arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the delivery system L-(cNA)n of Khvorova with a specific, required oligonucleotide sequence to inhibit MSH3 expression to treat HD as taught by Bermingham, based on the specific SEQ ID NO: 491/492 being successful in inhibiting the expression of MSH3, and further Hough disclosing that siRNAs, i.e. instant therapeutic NA (NA), improved inhibitory profile than antisense oligonucleotides. Further, a skilled artisan would also try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA. Further Foster also recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Further a skilled artisan would expect reasonable success in attempts to increase the 2OMe content since both of the improved siRNAs had ~80% 2OMe content. Also, the following KSR rationales may apply here: rationale (a) combining prior art elements by introducing the specific MSH3 sequence into dsRNA product of Khvorova, (b) simple substitution of one known element for another (i.e. dsRNA for ssRNA to inhibit MSH3 expression); and (e) obvious to try finite number of identified, predictable solutions. Thus instant claims 166,167, 208-210, 212, 215 and 224-228 are rejected under 35 U.S.C. 103. Response to Arguments Applicant's arguments filed 11/26/2025 (hereinafter referred as the Remarks) have been fully considered but they are not persuasive. The Remarks insist on the following: Office fails to provide “sufficient rationale” for selecting SEQ ID NOs: 491/492 of Bermingham from amongst the hundreds of Table 2, citing In re Wesslau (pg. 15). Then Remarks point to Table 2 of the Office Action, to note that the activity of noted ASOs “is reduced at higher concentration tested” and thus “do not exhibit requisite specificity for directing MSH3 silencing” (pg. 15). The Remarks further add a background on dual-dose studies to argue why SEQ ID NOs 491/492 would not be selected by a skilled artisan since there are other “promising candidates” (pg. 15-16). Then argue that claim amendments overcome the generalized design of Foster, i.e. of the 24 designs, all have 2OMe at pos. of AS strand (pg. 16-17), a deviation from instant claimed invention requiring antisense strand of pos. 5 to not be 2OMe. Further the Remarks add that Foster recognizes the complexity in optimizing 2OMe and 2F modification in a siRNA, “with discrepancies between modeling and experimental results” (pg. 17) and thus a skilled artisan would not modify the modification patterns of Khvorova (pg. 17). Then Remarks insist that because obvious to try rationale requires a limited (“relatively small number of choices”) choices and the outcome would not have been reasonably predictable nor reasonable expectation of success (pg. 17). Then Remarks proceed to summarize “routine optimization” case law noting that a presumption of obviousness does not extend to contexts involving complex choices and The Remarks add that a teaching away or unexpected results can be used to rebut prima facie obviousness (pg. 18), Bermingham and Foster express teachings “would have led the skilled artisan away from the claimed solution” (pg. 18). The Remarks point to unexpected results of MSH3_1000 and MSH3_1468, targeting SEQ ID NO: 2 and 3 of MSH3 sequence, respectively, “using an antisense strand complementary to a sense strand having a sequence of the claimed SEQ ID NO: 14 (samples MSH3_1000, see Table 5” and claimed SEQ ID: Ex. 1, Tables 4 & 5 The arguments are not persuasive. Addressing 1) that selection of SEQ ID NOs lacks sufficient rationale. Birmingham’s selected SEQ ID NOs note decrease in expression of the target MSH3 gene is sufficient rationale for a skilled artisan in expecting reasonable success. As the Remarks point out that the “Office must consider the prior art in its entirety,” MPEP 2123 notes similarly that patents are relevant as prior art for all they contain and that preferred embodiments do not constitute a teaching away from a nonpreferred embodiments. For the selected ~42 ASOs for which IC data is provided, there are some ASOs that have a similar response as SEQ ID NOs 491/492 (i.e. dose response of “the higher concentration results in detection of higher mRNA content” [Remarks pg. 15-16], see Table 2 of Bermingham, SEQ ID NO: 407, 441, and 545, etc. . . [e.g. SEQ ID NO: 545 has 2nM-8% remaining, while 20 nM-17% remaining]). A skilled artisan understands when screening ~480 ASOs not all ASOs will behave in an ideal manner, but the extent of the inhibition (~65%-85%) suggests there is inhibition, since the dose response are relatively close. Addressing 2) regarding the claim amendment reciting pos. 5 of antisense strand is not 2OMe, the claim is broad in scope, and cl. 87 can be interpreted that antisense strand is not modified. Further, reviewing the prior art as a whole, Foster Fig. 1A explicitly suggests that pos. 5 antisense strand has a preference for a 2F modification, i.e. not a 2OMe modification. Thus, due to the broad interpretation of the claimed subject matter, the arts (both Khvorova and Foster, as cited in this action) are not teaching away. Addressing 2 and 3), Foster reference addresses the “complexity of the design space even for two 2’ modifications (with 221 and 223 possible permutations for sense and antisense, respectively),” but notes that the results from the in silico analysis, i.e. Fig. 1A, were considered for further optimization (pg. 709, left col.). Thus, using the basis of the Fig. 1A and Foster’s additional studies, one can even further narrow down the number of permutation that are regularly tested within the nucleic acid inhibitory art. Also it should be noted that Khvorova’s reference prefers asymmetric siRNA (i.e. a shorter sense strand than the canonical 21 nt. sense strand). Thus, there are finite modification choices based on the results disclosed by Foster. Addressing 4), as pointed out above, neither Bermingham nor Foster teach away from the claimed solutions. Addressing 5), as noted in prior action, MPEP 716.02(d) requires that unexpected results are commensurate in scope with claimed invention. The claimed subject matter is broad in scope. The independent claims encompass asymmetric siRNAs (for which the results are provided) and canonical siRNAs (21 nt. in length antisense and sense strands). The independent claims encompass antisense strand with at least 3 mismatches between target MSH3 nucleic acid sequence of SEQ ID NO: 14 and, as noted in the earlier action, the antisense strand of SEQ ID NO: 8 is fully complementary to the target sequence. The claimed target sequence of SEQ ID NO: 2 is 45 nt. in length and is position 981-1025 of a MSH3 mRNA. A fully complementary antisense strand SEQ ID NO: 8, would only cover 20 nt. of the 45 nt. in length, pos. 996-1015. The Remarks notes “MSH3_993 failed to achieve sufficient silencing of MSH3 mRNA to warrant further development” (pg. 19). The target sequence of MSH3_993 nor the siRNAs targeting the region do not appear to be disclosed in the specification. Extrapolation based on the numbering of the MSH3 strands and SEQ ID NOs of Fig. 1 and Table 5, the MSH3_993 targeting sequence appears to be close to or, most likely, overlaps with SEQ ID NO: 2 target sequence. (MSH3_1000: sense sequence SEQ ID NO: 14: 1001-1015; MSH3_885: 886-900) Thus, attempts to inhibit at the 5’ end of SEQ ID NO: 2 (pos. 981-993) may not be successful based on the results of MSH3_993. Then, the results of Ex. 1 (of more than about 85%, pg. 19 of Remarks) is not of claimed branched compound or delivery system, which would be a bulkier compound than an asymmetric siRNA of Ex. 1. The inhibition levels noted (~85%) appear to be similar to inhibition results disclosed by Bermingham. Ex. 2, although tests modified siRNAs, do not appear to test nor show results of the claimed SEQ ID NOs (see Table 7, 8). The claimed subject matter can be interpreted to be broader than the modified pattern noted in Example 2; see below of modification pattern of siRNAs of Ex. 2, pg. 142: PNG media_image7.png 272 687 media_image7.png Greyscale Similar response applies to Ex. 4, Fig. 11, which shows results of a branched structure of apparently MSH3_1000 (see Fig. 10). Based on the results of prior art references, a skilled artisan would reasonably expect similar success by targeting the same region of MSH3 as SEQ ID NOs: 491/492 of Bermingham by using an asymmetric siRNA of Khvorova and the teaching of Foster. Regarding impermissible hindsight, in response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). The references cited have filing date before the filing of instant invention. Thus, the examiner has met the burden required under 103 and the rejection is maintained under 103 of the examined claims. Allowable Subject Matter No claims allowed. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Apr 20, 2021
Application Filed
Sep 28, 2021
Response after Non-Final Action
Jun 15, 2023
Non-Final Rejection — §103
Sep 28, 2023
Response Filed
Mar 20, 2024
Final Rejection — §103
Jul 03, 2024
Notice of Allowance
Oct 10, 2024
Response after Non-Final Action
Nov 01, 2024
Interview Requested
Nov 13, 2024
Response after Non-Final Action
Dec 03, 2024
Request for Continued Examination
Dec 06, 2024
Response after Non-Final Action
Jul 25, 2025
Non-Final Rejection — §103
Nov 26, 2025
Response Filed
Feb 19, 2026
Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
2y 5m to grant Granted Apr 14, 2026
Patent 12570974
OLIGONUCLEOTIDES FOR CONTROLLING TAU SPLICING, AND USES THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12516322
MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12509716
FUNCTIONAL LIGANDS TO TARGET MOLECULES
2y 5m to grant Granted Dec 30, 2025
Patent 12509681
COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+60.4%)
3y 8m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month