DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s remarks and amendments to the claims filed November 24, 2025 are acknowledged. Claims 1-5 were amended. Claims 1-8, and 10-20 are pending.
Restriction/Election
Claims 11-20 remain withdrawn as being drawn to a nonelected invention. Claims 1-8, and 10 are under examination herein.
Withdrawn Rejections
Applicant’s amendments to exclude the SEQ ID NOs relied upon in the prior art rejections of the previous action (i.e., SEQ ID NOs: 16 and 18) are sufficient to overcome the § 103 rejections raised over Elbashir in view of Fellmann and GenBank, and the aforementioned in further view of Yoo and Kawai. These rejections are withdrawn, accordingly.
Applicant’s remarks and amendments have been thoroughly considered but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any other rejection or objection not reiterated herein has been overcome by amendment.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
SEQ ID NOs: 11-15, 17, 19-20, 22, 24-27, 29, 31, 33, 35, and 42 are designated with the type “DNA” in field <212>. However, the SEQ ID NOs either contain a mixture of “u” and “t” nucleotides or contain only the RNA nucleotide “u” and no “t” nucleotides (SEQ ID NO: 27). SEQ ID NOs: 11-15, 17, 19-20, 22, 24-27, 29, 31, 33, 35, and 42 contain both DNA and RNA fragments. The SEQ ID NOs designate the sequences as “Homo sapiens” in field <213>. Given that these sequences are DNA/RNA mixtures, they have been altered from a “Homo sapiens” “DNA” sequence and should be designated as “Artificial Sequence” in field <213>. Applicant should further comply with the requirements of paragraph 30 related to “Artificial Sequence[s].”
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Response to Remarks – Nucleotide and/or Amino Acid Sequence Disclosures
Examiner has reviewed Applicant’s remarks regarding the Sequence Listing deficiencies identified in the prior action, and the references cited therein. The remarks are the same as those addressed in the prior action. As stated in the prior action, Examiner acknowledges that uracil can be found in DNA in some instances, e.g., due to action of AID/APOBEC family proteins, spontaneous deamination, and misincorporation of dUMP. Examiner consulted the Sequence Help Desk regarding the Listing in this application. The Sequence Help Desk advised that because the sequences are mixtures of DNA and RNA nucleotides, rather than a “DNA” sequence of “Homo sapiens,” each SEQ ID NO should be designated as an “Artificial Sequence.” Applicant is encouraged to contact Yizhu Zhang at the Sequence Help Desk (direct line: 571-270-3794) with whom these requirements were discussed.
CLAIM INTERPRETATION
The recited SEQ ID NOs are identical to their supposed target RNAs, not complementary thereto. The ordinarily skilled artisan would understand that a sequence complementary to the SEQ ID NO (and therefore, complementary to the target RNA) is required to use the claimed oligonucleotides as described in the specification. Furthermore, WIPO Standard ST.25 paragraph 8 states that “a nucleotide sequence shall be presented only by a single strand, in the 5’-end to 3’-end direction” (see pg. 3.25.5). Hereinafter, each SEQ ID NO is interpreted as reading on the recited SEQ ID NO itself, and its complement.
Claim 1 recites “A formulation comprising an oligonucleotide selected from a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity….” The phrase “selected from a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity,” does not impose any apparent structural limitations on the claimed oligonucleotide or formulation, because the oligonucleotide is fully structurally defined by the claim, i.e., “wherein the oligonucleotide comprises at least 70% identity to one of” the recited SEQ ID NOs, and because the group of isolated oligonucleotides have no structural requirements. The phrase “to treat anesthesia-induced neurotoxicity,” while reciting an intended use for the group of isolated oligonucleotides from which the oligonucleotide is selected, also does not impose any apparent limitations on the claimed oligonucleotide or formulation, because as stated directly above, the claim fully structurally defines the oligonucleotide in the formulation. This phrase is interpreted as reciting a non-limiting intended use.
Accordingly, the remaining rejections in this action are directed to the interpretation that the claims encompass formulations comprising an oligonucleotide comprising at least 70% identity to the nucleotide sequence of and/or complement of one of SEQ ID NOs: 1-3, 5-10, 23, 28, 30, 32, 34, 36, and 38-41.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-6, and 8 are rejected under 35 U.S.C. § 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to a formulation comprising an oligonucleotide. As outlined below, the judicial exception is not integrated into a practical application and does not include additional elements that are sufficient to amount to significantly more than the judicial exception. This rejection is maintained with modification necessitated by Applicant’s amendments to the claims.
Subject Matter Eligibility Test for Products and Processes – Claim 1
Step 1 – Is the Claim to a Process, Machine, Manufacture, or Composition of Matter? YES
Claim 1 is directed to a formulation comprising an oligonucleotide. The claim is a composition of matter, which is a statutory category (STEP 1: YES).
Step 2A, Prong One – Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. MPEP 2106.04(c) outlines the markedly different characteristics analysis.
The term “formulation” is interpreted as a mixture comprising the oligonucleotide and at least one additional element (see specification [0041], which states that the terms “formulation” or “composition” refer to their “generally accepted meaning in the art”). The oligonucleotide is “selected from a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity,” a phrase which, for the reasons described in paragraph 7 above, does not impose any apparent limitation on the recited oligonucleotide. The oligonucleotide in the formulation must have at least 70% identity to one of the recited SEQ ID NOs. As evidenced by a blastn search, SEQ ID NOs: 1-3, 5-10 (100%), 34 (23/25, 92%), and 40-41 (22/25, 88%) are 88%-100% identical to portions of human AKT mRNA, and SEQ ID NOs: 23 and 28 (15/25, 60%), and 30 are 60%-100% identical to human DDIT3 mRNA (see alignment with Homo sapiens RefSeq RNA sequences; of record). SEQ ID NOs: 32, 36, and 38-39 share the highest levels of identity with human CALCR mRNA (SEQ ID NO: 32), AFF2 mRNA (SEQ ID NO: 36), and STEAP1 mRNA (SEQ ID NO: 38-39). See alignments of record.
Human mRNA is naturally present in a “formulation,” i.e., the human cell, which contains aqueous solution, i.e., the cytosol. Accordingly, the closest natural counterpart to the instant formulation is a human cell comprising the portions of the human mRNAs to which the recited SEQ ID NOs comprise greater than 70% identity. Thus, claim 1 recites a product of nature judicial exception (STEP 2A, Prong One: YES).
Step 2A, Prong Two – Does the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception.
Each of the claim’s structural elements are found in the closest naturally-occurring counterpart, i.e., a human cell comprising the portions of the human mRNAs to which the recited SEQ ID NOs comprise greater than 70% identity. As stated above, the claim also recites that the oligonucleotide is “selected from a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity.” This phrase does not impose any apparent limitation on the recited oligonucleotide for the reasons described in paragraph 7 above. The formulation is not structurally limited or transformed by this phrase, and the formulation remains essentially an oligonucleotide comprising at least 70% identity to one of the recited SEQ ID NOs and one additional element, e.g., aqueous solution. There are no additional elements that integrate the natural product into a practical application (STEP 2A, Prong Two: NO).
Step 2B – Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim. See MPEP 2106.05.
As described above, each of the claim’s structural elements are found in the closest naturally-occurring counterpart, i.e., a human cell comprising the portions of the human mRNAs to which the recited SEQ ID NOs comprise greater than 70% identity. The phrase “selected from a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity,” does not structurally limit or transform the claimed formulation. Thus, claim 1 does not recite any additional elements that amount to significantly more than the judicial exception (STEP 2B: NO).
Dependent Claims
Claims 2-5 recite that the oligonucleotide in the formulation of claim 1 comprises at least 75% (claim 2), 85% (claim 3), 95% (claim 4) sequence identity to one of, or has one of (claim 5), the recited SEQ ID NOs. As stated above, portions of AKT mRNA and DDIT3 mRNA have 100% identity to recited SEQ ID NOs. The claims do not recite any additional elements to those addressed above. Therefore, claims 2-5 are still not markedly different from their naturally occurring counterparts, and recite judicial exceptions without additional elements which integrate the judicial exception into a practical application, or amount to significantly more than the judicial exception.
Claims 6 and 8 recite that the oligonucleotide is “incorporated into a carrier system” (claim 6), wherein the carrier system comprises a biodegradable polymer, hydrogel, or cyclodextrin (claim 8).
The naturally occurring counterpart to a formulation comprising the oligonucleotide incorporated into a generic carrier system comprising a biodegradable polymer, is the human cell comprising the portions of the human mRNAs to which the recited SEQ ID NOs comprise greater than 75% identity. The cytosol comprises “biodegradable polymer[s],” e.g., proteins, oligosaccharides, etc. Thus, claims 6 and 8 are still not markedly different from their naturally-occurring counterpart, and recite judicial exceptions without additional elements which integrate the judicial exception into a practical application, or amount to significantly more than the judicial exception.
Claims 7 and 10 are not included in this rejection. The incorporation of the formulation into a liposome- or virosome-based carrier system transforms the formulation such that it is capable of performing a different function, i.e., delivering the oligonucleotide to a cell. The additional elements recited in claims 7 and 10 integrate the judicial exception into a practical application, and thus, the claims are eligible (STEP 2A, Prong Two: YES).
Response to Remarks – 35 USC § 101
Applicant’s remarks with respect to the prior action’s § 101 rejections have been considered. The remarks are the same as those addressed in the prior action. Applicant’s remarks cite USPTO guidance, and direct analysis of the subject matter eligibility of the instant claims towards MPEP § 2106.04(d). MPEP § 2106.04(d) states that “Implementing a judicial exception with, or using a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim” may integrate the judicial exception into a practical application. Applicant submits that because the claims allegedly “require “a group of isolated oligonucleotides to treat anesthesia-induced neurotoxicity”” (emphasis maintained from remarks), an ordinarily skilled artisan would understand that the instant claims are “a manufacture.” Applicant provides that “The “formulation” “is given a new form, quality, property, or combination through man-made or artificial means,”” because the claimed oligonucleotide, by virtue of the term “isolated,” is “one which is altered… from the natural state.”
First, while claim 1 recites that the oligonucleotide is “selected from a group of isolated oligonucleotides to teat anesthesia-induced neurotoxicity,” as described in paragraph 7 above, this phrase does not impose any apparent limitations on the oligonucleotide or formulation, which is fully structurally defined by the claim (“A formulation comprising an oligonucleotide… wherein the oligonucleotide comprises at least 70% identity to one of” the recited SEQ ID NOs).
As to Applicant’s arguments that the instant claims are directed to a “manufacture,” as stated in the previous actions, MPEP § 2106.03(I) states that a manufacture is “a tangible article that is given a new form, quality, property, or combination through man-made or artificial means.” MPEP § 2106.03(I) provides examples of inventions which “satisfy[] the manufacture category” including: a bicycle which is “produced from raw materials such as aluminum ore and liquid rubber by giving them a new form (thus satisfying the manufacture category),” and a genetically modified bacterium which is “genetically modified by humans to have new properties such as the ability to digest multiple types of hydrocarbons (thus satisfying the manufacture category).” Thus, based on the guidance in MPEP § 2106.03(I), an invention satisfies the manufacture category when a tangible article (e.g., raw metals, a bacterium) has been given some new form, quality, property, or combination through man-made or artificial means.
Applicant appears to assert that “isolat[ing]” oligonucleotides provides “a new form, quality, property, or combination” to the formulation. However, as described above, the claimed oligonucleotides have the same structure as naturally-occurring mRNAs, and it is not apparent based on the disclosure, or the remarks that any such “new form, quality, property, or combination” has been introduced by merely “isolating” the oligonucleotide. Furthermore, it is not apparent based on the disclosure or remarks, that the oligonucleotide’s presence in a formulation, e.g., in aqueous solution, gives the oligonucleotide any new form, quality, property, or combination through man-made or artificial means. Indeed, as stated above, in their natural state inside the human cell, human mRNAs are in a “formulation.” Thus, it is not evident based on the specification, Applicant’s remarks, or the “generally accepted meaning [of a formulation] in the art” ([0041]), that the instantly claimed invention represents a manufacture.
MPEP 2106.04(b)(II) states that “the key to the eligibility of all non-naturally occurring products is whether they possess markedly different characteristics from any naturally occurring counterpart.” The analyses in the prior actions, and above, relied on the markedly different characteristics analysis. The instant invention is a formulation comprising an oligonucleotide, wherein the oligonucleotide comprises a nucleotide sequence with at least 70% identity to one of the recited SEQ ID NOs. The recited SEQ ID NOs have identity to naturally-occurring human mRNAs. Regarding the term “isolated,” which is emphasized in Applicant’s remarks, the term is not sufficient by itself to differentiate the invention from its naturally-occurring counterpart. Indeed, MPEP 2106.04(b)(II) explicitly states
“the isolated DNA of Myriad and the primers of Ambry Genetics were described as products of nature by the courts… product of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart. See, e.g.,Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244 (“Contrary to Myriad's argument, it makes no difference that the identified gene sequences are synthetically replicated. As the Supreme Court made clear, neither naturally occurring compositions of matter, nor synthetically created compositions that are structurally identical to the naturally occurring compositions, are patent eligible.”)” (emphasis added).
For the reasons detailed above, the claimed formulation is not markedly different from its naturally occurring counterpart – a human cell comprising the portions of the human mRNAs with identity to each of the recited SEQ ID NOs. The claimed formulation does not require any element which is not present in the naturally-occurring counterpart to the claimed invention. Taken together, Applicant’s amendments and remarks are insufficient to overcome the § 101 rejection, and the claims remain ineligible.
Claim Rejections - 35 USC § 102 – Dong Lu
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-6 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Dong Lu (Dong Lu et al., 21 April 2015, World J Gastroenterol, 21(15): 4564-4573). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Regarding claims 1-5, Dong Lu teaches a formulation comprising an oligonucleotide comprising SEQ ID NO: 5 (“The siRNA was synthesized by Invitrogen, and the siRNA sequences used were as follows: AKT siRNA, 5’-UUCAGGUACUCA AACUCGUUCAUGG-3’ and 5’-CCAUGAACGAGUUUGAGUACCUGAA-3’… Transfection was done using Lipofectamine 2000 reagent” pg. 4566, left col.). See Fig. A below.
FIGURE A
CCAUGAACGAGUUUGAGUACCUGAA SEQ ID NO: 5
CCAUGAACGAGUUUGAGUACCUGAA Dong Lu “AKT siRNA”
Regarding claim 6, the term “carrier system” is interpreted as an element which can be used to carry the oligonucleotide, e.g., a cationic lipid, liposome, nanoparticle, etc. ([0038]). The formulation of Dong Lu comprises the oligonucleotide comprising SEQ ID NO: 5 and Lipofectamine 2000, which is used to carry the oligonucleotide. Thus, Dong Lu teaches a formulation wherein the oligonucleotide is “incorporated into a carrier system.”
Claim Rejections - 35 USC § 103 – Dong Lu in view of Gondi
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Dong Lu (Dong Lu et al., 21 April 2015, World J Gastroenterol, 21(15): 4564-4573) as applied to claims 1-6 above, in further view of Gondi (Gondi and Rao, 2009, Cellular Physiology, pg. 285-291). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Dong Lu are described above and applied as to claims 1-6 therein.
Dong Lu does not teach incorporating the oligonucleotide into a carrier system comprising a liposome.
Gondi teaches that liposomes have been used successfully to delivery RNA oligonucleotides to cells (“Significant and repeated success with liposome-mediated delivery has been reported in vivo,” pg. 288, right col.). Gondi teaches that liposomes have “stable physicochemical characteristics” which makes them “suitable drug delivery vehicles” (pg. 288, right col.). Gondi teaches that Dong Lu’s carrier system, i.e., Lipofectamine 2000, forms lipoplexes which “tend to be structurally more heterogeneous and unstable, aggregating over time in solution,” and necessitating that formulations “be prepared immediately before use” (pg. 288, right col.). Gondi teaches these are “major disadvantages from the standpoint of reproducibility, manufacturing, and drug administration” (pg. 288, right col.).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the carrier system taught by Dong Lu with a liposome-based carrier system taught by Gondi. It would have amounted to a simple substitution of two known carrier systems by known means to yield predictable results. Because Dong Lu teaches incorporating the oligonucleotide into a carrier system for the purposes of RNA delivery to cells, and Gondi teaches that liposomes have been used successfully to deliver RNA oligonucleotides to cells, a skilled artisan would have had a reasonable expectation that substituting the carrier systems would produce a formulation suitable for RNA delivery. A skilled artisan would have been motivated to substitute the elements because Gondi teaches that liposomes have advantages over Dong Lu’s carrier system owing to their “stable physicochemical characteristics.”
Claim Rejections - 35 USC § 103 – Dong Lu in view of Yoo and Kawai
Claims 8 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Dong Lu (Dong Lu et al., 21 April 2015, World J Gastroenterol, 21(15): 4564-4573) as applied to claims 1-6 above, in further view of Yoo (Yoo et al., 2011, Nature Reviews Drug Discovery, 10, pg. 521-535; of record) and Kawai (Kawai, 2005, Biodegradation of Polyethers (Polyethylene Glycol, Polypropylene Glycol, Polytetramethylene glycol, and Others). In Biopolymers Online, A. Steinbüchel (Ed.); of record). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Dong Lu are described above and applied as to claims 1-6 therein.
Dong Lu does not teach incorporating the oligonucleotide into a carrier system comprising a virosome, or a PEG-modified virosome (i.e., a carrier system comprising a biodegradable polymer).
Yoo teaches that virosomes are reconstituted virion-like phospholipid bilayers, that contain viral envelope proteins, and are devoid of viral capsid proteins and genetic material (pg. 526, left col.). Yoo teaches that virosomes have major advantages over other carrier systems for the purposes of drug and gene delivery because they are easy to produce and have low toxicity (pg. 526, left col.). Yoo teaches that unlike conventional liposomes, viral envelope proteins (“HA and NA”) provide virosomes with structural stability, and the ability to target and function inside cells (pg. 526, right col.). Yoo teaches that virosomes are able to load various exogenous cargos, including siRNA and nucleic acids (pg. 526). Yoo teaches that virosomes have been used successfully as carriers for RNA oligonucleotides (“siRNAs”, pg. 526, right col.). Yoo teaches that virosomes have been modified with polyethylene glycol (PEG), and that such modified virosomes have been used to deliver agents successfully to cells (pg. 526, right col.).
Yoo is silent as to whether PEG is a biodegradable polymer, however Kawai teaches that it is known that PEGs up to ~20,000 Da are biodegradable (section 4, “Biodegradation of PEG”, pgs. 4-12).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the carrier system taught by Dong Lu with a PEG-modified virosome-based carrier system taught by Yoo. It would have amounted to a simple substitution of two known carrier systems by known means to yield predictable results. Because Dong Lu teaches incorporating the oligonucleotide into a carrier system for the purposes of RNA delivery, and Yoo teaches that PEG-modified virosomes have been used to deliver RNA oligonucleotides to cells, a skilled artisan would have had a reasonable expectation that substituting the carrier systems would produce a formulation suitable for RNA delivery. A skilled artisan would have been motivated to substitute the elements because Yoo teaches that virosomes have advantages over other carrier systems because they are easy to produce, exhibit low toxicity, and their envelope proteins allow cellular targeting.
Response to Remarks – Prior Art
Applicant’s remarks with respect to the prior art rejections raised in the previous action have been reviewed. Applicant submits that the references cited in the prior action are deficient because none of the references teach the instantly claimed oligonucleotides. Indeed, the SEQ ID NOs relied upon in the rejections are no longer recited in the amended claims, and the prior art rejections have been withdrawn, accordingly. Applicant’s arguments do not specifically challenge any teachings or matters raised in the prior action which are relevant to the new rejections above.
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600