DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 3/17/2026 has been entered.
Application Status
This action is written in response to applicant’s correspondence received on 3/17/2026. Claims 1, 4-5, 9-10, 12, 14, and 16 are pending. Claim 1 has been amended. Claims 2-3, 6-8, 11, 13, and 15 have been previously cancelled. Claim 16 is newly added. All pending claims are currently under examination.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 4-5, 9-10, 12, 14, and 16 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, claim 1 recites “an aqueous solution consisting of an aptamer,” (preamble). Claim 1 further recites “wherein a proportion of a monomer aptamer is not less than 80% after storage at 4oC for 3 months, wherein the proportion of the monomer aptamer is a value,” (see final four lines of claim 1). Thus, claim 1 recites both “an aptamer” and “a monomer aptamer,” and further recites “the monomer aptamer.” Thus, claim 1 recites multiple “aptamers,” and it is unclear if “the monomer aptamer” is meant to be in reference to the aptamer recited in the preamble and line 6 (i.e., SEQ ID NO: 13) or if “a monomer aptamer” is meant to be in reference to a separate aptamer not previously recited in the claims.. Recitation of “the monomer aptamer” therefore lacks proper antecedent basis. It is recommended that the claim language be changed so that the proportion of monomer aptamer is more clearly associated with the aptamer previously recited in the claim (i.e., SEQ ID NO: 13).
Claims 4-5, 9-10, 12, 14, and 16 depend from claim 1 and do not resolve this 112(b) issue and are therefore also rejected.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 16 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding claim 16, claim 16 depends from claim 1. Claim 1 recites that the aqueous solution consists of “an aptamer or salt thereof, that binds to fibroblast growth factor 2 (FGF2), water, and a non-electrolytic osmoregulatory,” (preamble of claim). Thus, claim 1 is already limited to an aqueous solution, wherein the liquid does not contain an electrolyte other than the aforementioned aptamer or a salt thereof, as recited in claim 16, as the solution in claim 1 is recited with the closed langue “consisting of.” Claim 16 therefore does not further limit claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103 – Updated in Response to Amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 4-5, 9-10, 12, 14, and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Jin (WO 2015/147017 A1) in view of Gilbert (US 2009/0203766 A1, published 8/13/2009). The rejection is further evidenced by Farb (WO 97/18834, published 5/29/1997).
Regarding claim 1, Jin teaches an aqueous liquid comprising an aptamer that binds to FGF2 (see claim 1 of Jin and paragraph 73). Furthermore, the specification recites that mannitol is an example of a non-electrolytic osmoregulatory which can be part of aptamer formulations (paragraph 70). Jin teaches that aptamers which bind to FGF2 can be formulated in pharmaceutically acceptable carriers, including mannitol (paragraph 70). Jin teaches
“an aptamer that binds to FGF2, which comprises a nucleotide sequence represented by the following formula (1) (wherein 5 uracil is optionally thymine), and which is the following (a) or (b): N1GGAN2ACUAGGGCN3UUUAAN4GUN5ACCAGUGUN6 (formula 1) N1 and N6 are each independently any 0 to several bases, N2, N3, N4 and N5 are independently any one base, (a) an aptamer wherein, in the nucleotides contained in the aptamer, (i) the 2'-position of the ribose of each pyrimidine nucleotide is a fluorine atom, (ii) the 2'-position of the ribose of each purine nucleotide is a hydroxy group; (b) the aptamer of (a), wherein (i) the fluorine atom at the 2'-position of the ribose of each pyrimidine nucleotide is independently unsubstituted, or substituted by an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and a methoxy group, (ii) the hydroxy group at the 2'-position of the ribose of each purine nucleotide is independently unsubstituted, or substituted by an atom or group selected from the group consisting of a hydrogen atom, a methoxy group and a fluorine
atom,” (claim 1 of Jin).
Jin therefore teaches the aptamer recited in claim 1 (claim 1 of Jin, i.e., SEQ ID NO: 13). Furthermore, Jin teaches that the aptamer is suitable to be used in intravenous administration, subcutaneous administration, intramuscular administration, topical administration, intraperitoneal administration, intranasal administration, pulmonary administration and the like, and furthermore that such administrations should be used with the aptamer in aqueous or non-aqueous injectable isotonic solutions (page 32, third paragraph).
Additionally, Jin teaches that the aptamer can be formulated in a solution which is only water (“The medicament of the present invention can be one
formulated with a pharmaceutically acceptable carrier…diluents such as water,” paragraph 70). Thus, Jin teaches a solution comprising instant SEQ ID NO: 13 in an aqueous solution consisting of water and the aptamer (claim 1 of Jin and paragraph 70), where furthermore Jin also teaches that mannitol can be in the solution (paragraph 70).
Jin, while teaching aptamer concentrations to be used in isotonic solutions as injectable aqueous solutions, does not explicitly teach the aptamer concentration is 1-60 mg/ml and/or that the mannitol is at a concentration of 2-7.5% w/v. Jin also does not explicitly teach that the solution consists only of the aptamer, water, and mannitol.
Gilbert is a patent document that specifically focuses on aptamer preparations (Title, Abstract, and throughout). Gilbert and Jin therefor directly overlap in subject matter and field of endeavor. Gilbert teaches that aptamer formulations typically comprise the aptamer at concentrations of 1-50 mg/ml, where the aptamer is in a pharmaceutically acceptable carrier for intravenous administration and/or subcutaneous administration (paragraph 34). Gilbert therefore teaches that it was known in the art that aptamers are preferably administered at the concentrations presently recited.
Furthermore, regarding aptamer formulations, Gilbert teaches that:
“The formulations of the invention only require a vWF aptamer or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable solvent,” (paragraph 132). Thus, Gilbert, like Jin, also teaches that aptamers can be formulated in a pharmaceutically acceptable carrier (water, per Jin), where no other components are in the solution aside from water and the aptamer (paragraph 132 of Gilbert, paragraph 70 of Jin). Gilbert further teaches that there are other agents which can be added to the solution. For instance, Gilbert teaches:
“In some embodiments, the formulations may further comprise a tonicity agent. Tonicity agents are used to adjust the osmolality of the formulations in order to bring them closer to the osmotic pressure of body fluids, such as blood or plasma. Examples of tonicity agents include, but are not limited to, anhydrous or hydrous forms of sodium chloride, dextrose, sucrose, xylitol, fructose, glycerol, sorbitol, mannitol,” (paragraph 135).
Thus, Gilbert teaches that aptamers can be formulated in a solvent alone, but can also comprise a beneficial tonicity agent, which Gilbert teaches in an advantageous addition to the solvent because it renders physiologically relevant characteristics to medical formulations of aptamers, where one such tonicity agent is mannitol (paragraph 135). Thus, Gilbert teaches a motivational teaching to add mannitol to aptamer solutions which consist of only a solvent and the aptamer, so that the formulations are closer to the osmotic pressure of body fluids.
With regards to the limitation of “2 – 7.5% w/v” as recited for the osmoregulator concentration (i.e., mannitol), as discussed above, Jin teaches isotonic solutions to be used for administration of their aptamers (page 32, third paragraph), while Gilbert also teaches the benefits of such tonicity agents (paragraph 135 of Gilbert). As evidenced by Farb, mannitol at 5% w/v is approximately isotonic at physiological conditions (page 30, third paragraph). The Applicant is therefore reciting a w/v percentage range which includes mannitol at isotonic concentrations. Jin, by teaching isotonicity and mannitol as an osmoregulator, therefore inherently teaches a w/v% of mannitol which yields an isotonic solution (page 30, third paragraph of Farb and page 32, third paragraph of Jin).
It would have been obvious to a person of ordinary skill in the art before the time of the effective filing date to modify the aptamer concentrations of Jin with the 1-50 mg/ml teaching of Gilbert because Gilbert teaches that such concentrations are working concentrations of the same routes of administration (i.e., intravenous, subcutaneous) of Jin. The practitioner would therefore be motivated to use such concentrations, as it was known in the art that such concentrations are preferred for the administration of aptamers, as taught by Gilbert. Furthermore, Jin and Gilbert both teach mannitol as a tonicity agent, where Jin teaches its use at an isotonic concentration. Given that 5% w/v mannitol is physiologically isotonic, as taught by Farb, Jin inherently teaches a 5% w/v concentration of mannitol. Furthermore, even if it were viewed that Jin does not inherently teach this concentration, Jin teaches that the solution should be isotonic; a practitioner would therefor arrive at the invention given the teachings of Farb, who teaches 5% w/v for isotonic solutions of mannitol.
Furthermore MPEP 2144.05, IIA states that:
“generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation."
In the present case, the general conditions of the claimed invention of claim 1 are disclosed in the prior art because osmoregulators such as mannitol as well as aptamers have been taught to be used in pharmaceutical compositions at the recited concentrations of the claims (i.e., it is known that 5% w/v is an isotonic solution of mannitol, and furthermore Gilbert teaches aptamer concentrations at 1-50 mg/ml).
Regarding the limitations in claim 1 which state:
“wherein a proportion of a monomer aptamer is not less than 80% after storage at 4°C for 3 months, wherein the proportion of the monomer aptamer is a value obtained by separating and detecting monomers and multimers by size-exclusion chromatography, and calculating: (peak area of monomers)/(total peak area of monomers and multimers)x 100(%),” (final four lines of claim 1)
these claim limitations are not sufficient to render the claim non-obvious. As an initial matter, claim 1 is not drawn to a method of storage, but rather, an aqueous formulation. Thus, the limitations in the final four lines of claim 1 are drawn only to inherent properties of the solution already rendered obvious by the combination of Jin and Gilbert, where Gilbert already teaches motivational teachings to add mannitol to aptamer solutions consisting of only water and the aptamer. Given that Jin teaches SEQ ID NO: 13 stored only in a solvent/diluent such as water, where furthermore Gilbert also teaches that such solutions as aptamers in water/solvents alone are known, and that it is advantageous to add mannitol, a practitioner is already motivated to add mannitol at physiologically relevant concentrations per the teachings of Gilbert. Additional advantageous features which flow naturally from suggestions in the art can not be the basis of patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985).
Regarding claim 4, the aptamer sequence recited in claim 4 is identical to the aptamer structure recited in claim 3 of Jin (claim 3). See “formula 3” in claim 3 of Jin (claim 3). An alignment of “formula 3” from claim 3 of Jin to the sequence recited in claim 4 is given below:
N1-GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUC-N62 (sequence in claim 4)
N1-GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUC-N62 (formula 3, claim 3 of Jin)
Regarding claim 5, SEQ ID NO: 3 is given below in comparison with SEQ ID NO: 3 of Jin:
GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC – (SEQ ID NO: 3, present app.)
GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC – (SEQ ID NO: 3, Jin)
The FGF2-binding aptamer of SEQ ID NO: 3 of Jin therefore comprises SEQ ID NO: 3 of the present application because the sequences are identical (see page 1 of “Sequence Listing” section of Jin, attached at the bottom of Jin).
Regarding claim 9, as discussed above, both the aptamer concentration and mannitol concentrations are rendered obvious by the combination of Jin and Gilbert. Given that Jin teaches isotonic solutions comprising mannitol and Farb further teaches that the mannitol concentration is 5% w/v for isotonicity, and that Gilbert teaches the aptamer concentrations between 1-50 mg/ml for the same applications as Jin, a practitioner could reasonably arrive at the presently recited concentrations through routine optimization and experimentation as they are simply in known concentration ranges. Furthermore MPEP 2144.05, IIA states that:
“generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation."
In the present case, the general conditions of the claimed invention of claim 9 are disclosed in the prior art because osmoregulators such as mannitol as well as aptamers have been taught to be used in pharmaceutical compositions at the recited concentrations of the claims.
Regarding claim 10, Gilbert teaches that liquid aptamer formulations are routinely stored in the refrigerator (i.e., 4 degrees Celsius, paragraph 181).
Regarding claim 12, Jin teaches that the liquid is an injection (paragraph 73).
Regarding claim14, Jin teaches that the aptamer can be used in a method for inhibition of angiogenesis (Example 7 of Jin). Jin furthermore teaches that the aptamer can be used in treatments related to diseases associated with angiogenesis, which reasonably includes “pain,” as such diseases accompanied by angiogenesis are reasonably associated with pain (page 58, final paragraph).
Regarding claim 16, claim 16 recites the same limitations as claim 1. The limitations of claim 16 are therefore addressed in the rejection of claim 1, above.
Regarding the present subject matter, the aptamer is taught by Jin, where Jin furthermore teaches that the aptamer can be in water. Furthermore, Gilbert also teaches that aptamers can be stored in dilution buffers alone and gives motivational teachings to add mannitol to such aptamer preparation solutions (see 103 rejection, above). Thus, the present composition does not appear to be free of the art. Regarding the claim limitations incorporated into claim 1 regarding the storage of the aptamer, these claim limitations are simply directed to natural properties of the aptamer, where no storage of the aptamer is required for the solution of claim 1. It is noted that such storage conditions and resulting stability of the aptamer could potentially contain novel, unexpected subject matter, and could be potentially patentable limitations as a method of storage rather than as a composition.
Response to Arguments
The Remarks filed 3/17/2026 have been considered but are not persuasive. The Applicant argues that Jin and Gilbert do not teach the aqueous solution as claimed, consisting of the aptamer, water, and mannitol. This argument is not persuasive because Jin teaches the aptamer SEQ ID NO: 13, where such an aptamer can be a solution consisting of water (paragraph 70 of Jin, claim 1 of Jin which teaches the aptamer sequence). Thus, as a primary reference, Jin teaches SEQ ID NO: 13 in a solution of water. Gilbert also teaches that aptamer formulations can consist only of the aptamer or salt thereof in a solvent (e.g., a diluent such as water, per Jin). Gilbert then teaches a motivational teaching to add mannitol to the solution, as such addition of mannitol has beneficial properties of rendering physiologically relevant osmotic properties to a drug formulation comprising an aptamer (see paragraphs 132 and 135 of Gilbert). Thus, beginning with the aptamer in water solution taught by Jin, a practitioner would be motivated to add mannitol for the reasons taught by Gilbert (paragraph 135 of Gilbert). Thus, claim 1 is rendered obvious by the combination of Jin and Gilbert, where furthermore the results are predictable because Jin also teaches aptamers and mannitol, which are reagents taught by Gilbert.
The Applicant argues that unexpected stabilizing effects were observed in the present aptamer formulations, where stability limitations are added in claim 1. The additional limitations recited in claim 1 can not be considered as rendering the claims patentable. The fact that the inventor has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985). In the present case, a practitioner would already be motivated to add mannitol to the water/aptamer solution already taught by Jin. Claim 1 is therefore reciting inherent properties of a solution which is rendered obvious by the combination of Jin and Gilbert, where a practitioner would be motivated to add mannitol to the water/aptamer solutions already taught by Jin because of the known beneficial tonicity effects of mannitol in aptamer medicament preparations.
Double Patenting – Withdrawn
The double patenting rejection regarding copending application 17/797,369 is hereby withdrawn because application ‘369 has been abandoned.
Claim Rejections - 35 USC § 112 – Enablement, Reinstated
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 14 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating or preventing pain associated specifically with angiogenesis, does not reasonably provide enablement for treating or preventing any other disease or pain. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Factors to be considered in determining whether a disclosure meets the enablement requirement of 35 U.S.C. 112, first paragraph, have been described by the court in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988). Wands states, on page 1404:
Factors to be considered in determining whether a disclosure would require undue experimentation have been summarized by the board in Ex parte Forman. They include (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of these in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims.
Nature of the Invention/Breadth of Claims
The Applicant is claiming both the treatment and prevention diseases such as age-related macular degeneration, osteoporosis, rheumatoid arthritis, osteoarthritis, bone fracture, chondrodysplasia, or pain. Thus, the Applicant is claiming a broad genus of diseases to be treated (essentially any disease, because the recited diseases are diseases which cause “pain”). Claim 14 is problematic for several reasons. Firstly, the art teaches that actual treatments and preventive action using aptamers is highly unpredictable, as discussed further below. Secondly, claim 14 is broadly encompassing the prevention and treatment of “pain,” which reasonably includes diseases which cause pain. The genus of disease which could cause “pain” is incredibly broad, encompasses essentially all diseases, and it is unknown what role an aptamer which targets FGF2 would have in the treatment of any of these diseases, as discussed further below. And finally, the Applicant is claiming not only the treatment of diseases but also their prevention, which are not equivalent.
Guidance in the Specification
The Applicant has provided six examples in the specification beginning on page 28. Examples 1-3 relate to structural analysis of aptamers in different solutions (pages 28-30). Example 4 relates to an evaluation of the correlation between monomer content percentage and the binding activity of an aptamer (page 30). Example 5 measures the stability of aptamer preparations, and finally Example 6 explores a handful of other aptamers and their chemical properties (page 33). The Applicant has not provided studies on treating diseases using their aptamers or preventing any diseases using the aptamers in the present application. The Applicant has not tested any in vivo models or shown that the aptamer would be effective at treating any disease.
Unpredictability in the State of the Art
With regards to the present state of the art, the use of aptamers to prevent diseases is highly unpredictable. For instance, Lakhin (Lakhin AV et al. Acta Naturae. 2013 Oct;5(4):34-43, of record) is a review article which teaches the application of aptamers to treat disease (Title, Abstract, and throughout). Lakhin teaches that “multiple attempts to use aptamers in practice, although sometimes successful, have been generally much less efficient than had been expected initially,” (Abstract). Lakhin further teaches that:
“aptamers have not been commonly used thus far. The aptamer generation
protocol SELEX was developed over 20 years ago, but only one aptamer, Macugen (or Pegaptanib), has been approved for therapeutic application,” (Conclusion, first paragraph).
Thus, the use of aptamers as a treatment is rare, and furthermore multiple attempts have been made to use them as therapeutics which have failed (Abstract, Conclusion). The Applicant therefore has a higher burden to demonstrate that the recited aptamer could in fact be used to treat any disease. However, the Applicant has not demonstrated that the aptamer recited in claim 1 (and by extension claim 14) can be used in an in vivo model to treat any disease, let alone ‘prevent” a disease.
Furthermore, mere administration of such a therapeutic as claimed in claim 14 at best might ameliorate some of the symptoms of one of the diseased recited, but there is no evidence provided that such administration would prevent a disease. In addition, the skill of those in the relative art is high, but still, given the state and unpredictability of the art, undue experimentation would be required to determine if a disease could be prevented by the administration of the aptamer, or rather just treated by administration of the claimed aptamers. Given that aptamers are known to have low efficacious potential, their use in the prevention of a disease is unpredictable and low, as taught by Lakhin. Furthermore, the prevention of some of the disease recited in claim 14 by the administration of the aptamer is highly unlikely. For instance, claim 14 broadly encompasses the prevention of “bone fracture” by administration of an aptamer of claim 1. It is unlikely and not demonstrated in the specification that the administration of short nucleic acid could prevent a bone from fracturing, nor is a mechanism established or identified for how such a nucleic acid would prevent a bone from fracturing under, for instance, extreme mechanical stress which would break a bone.
Regarding predictability in the state of the art, Jin (WO 2015/147017 A1, of record) teaches that the recited aptamer was tested in a mouse model to inhibit angiogenesis (Example 7, see 103 rejection, above). Thus, the art teaches that the aptamer recited in claim 1 has been administered to treat pain specifically associated with angiogenesis (see Example 7 of Jin). However, given the unpredictability of the art as a whole, the Applicant has not demonstrated or reduced to practice the treatment or prevention of any other such disease such as those recited in claim 14.
Furthermore, recitation of “pain” broadly includes pain caused by any disease. It is unknown and unpredictable what role an anti-FGF2 aptamer might play in treating pain associated with, for instance, pneumonia or migraines, or any of the other vast array of conditions which could lead to pain, or how such an aptamer would prevent such pain.
Undue Experimentation
Regarding the undue experimental burden placed on a practitioner, a practitioner would be burdened with testing and developing effective means to treat and prevent the recited diseases using the aptamer recited in claim 1. Development of such prevention and treatment methods constitutes undue experimental burden, as the art (e.g., Lakhin, above) teaches that it is known that aptamers are difficult to implement in practice, where the expectations of their success has fallen short of projected applications despite the fact that aptamer technology has been around for decades (Abstract). Given that the Applicant has provided no experiment data or in vivo models, the practitioner is burdened with testing, developing, and identifying effective administrative methods to implement the recited aptamers in effective treatments of disease, where Lakhin teaches that it is known that the efficacy of aptamers is unpredictable and low.
Response to Original Arguments of the Enablement Rejection
The present 112(a) enablement rejection has been reinstated upon further consideration of the claims. As such, the original arguments presented in the remarks filed 9/4/2024 shall be addressed. In the Remarks filed 9/4/2024, the Applicant argues that the recited diseases are known to be associated with FGF2, as FGF2 is a known/major angiogenesis factor (pages 9-12 of remarks filed 9/4/2024). For instance, the Applicant argued that FGF2 is known to be associated with age-related macular degeneration and angiogenesis associated with AMD (page 10, remarks filed 9/4/2024), where blockage of FGF2 can be effective against ocular angiogenesis (page 10, remarks filed 9/4/2024). This argument is not persuasive because the mere identification of FGF2 as a target in age-related macular degeneration does not indicate that the present anti-FGF2 aptamer would be effective in treating or preventing AMD ,as no such testing has been performed to demonstrate such treatment/prevention of AMD. The prior art (e.g., Lakhin) teaches that implementing aptamers and reducing them to practice is not predictable, where actual reduction of practice of aptamers is unreliable despite original predictions that they would be useful (see Lakhin, example Abstract and Conclusion). Thus, the mere identification and association of FGF21 as a target in AMD and an aptamer which binds to FGF2 by the Applicant is not sufficient to show that the aptamer can be used effectively to treat or prevent AMD. The Applicant makes similar arguments, where associations are drawn between the recited diseases osteoporosis, rheumatoid arthritis, osteoarthritis, bone fractures, chondrodysplasia, and pain, and their relationship to FGF2. However, correlating FGF2 and a disease does not reliably predict that the recited aptamer will be effective at preventing or treating such a disease, as it is known in the art that such aptamers have unpredictable efficacy (per Lakhin).
The Applicant argues that they have developed an aptamer which obtained results almost similar to Macugen, and have tested the structure and stability of the aptamer. This argument is not found to be persuasive because the recited aptamer has not been tested in an in vivo model. The fact that other aptamers such as Macugen are effective does not reliably confer predictability on the present aptamers, which were untested in the Application in any disease treatment model. Given the unpredictability an low efficacy of aptamers reduced to practice as taught in the art, the specification is not enabling for what is presently claimed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights