DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
The instant application is a 371 filing of PCT/KR2019/09238 filed 7/25/2019 which claims priority to 62703578 filed 7/26/2018. Certified copy of priority documents have been received on 1/22/2021. The priority documents have not been filed in English and therefore applicant is notified, should intervening art be identified, an English copy of the Foreign document may be requested. See MPEP § 201 and 35USC §119(b)(1).
Election/Restrictions
Applicant’s election without traverse of various Species is withdrawn in view of allowability of formerly elected species, and Applicants request to do so in the Remarks filed 11/10/2025.
Accordingly, all claims 63-71 are under examination.
Amendments
This action is in response to papers filed 11-10-2025 in which claim 63 and 66 – 68 were amended, no claims were canceled, and no new claims were added. All of the amendments have been thoroughly reviewed and entered.
Any objection not reiterated herein has been overcome by amendment.
Applicant has amended claim 63 to overcome the 112a rejection. The 112a rejection has been overcome and is withdrawn.
Applicant's amendments deleting SEQ ID NO 486 from the choices of guide RNA sequences overcomes the §103 rejection over Ohmori in view of Hinkle and Genbank. However, a new §103 rejection, necessitated by the amendment is recited below. This Office Action is Final necessitated by amendment.
Applicant's remarks with respect to Double Patenting have been fully considered and are not persuasive for the reasons discussed in this office action. However, as a result of Applicants cancellation of species in co-pending reference application, previous rejections under Double Patenting are withdrawn.
Withdrawn Claim Rejections - 35 USC § 103
The rejection of claims 63 – 69 and 71 rejected under 35 U.S.C. 103 as being unpatentable over Ohmori (WO 2018131551, IDS dated 1/22/2021), as evidenced by its English translation, in view of Hinkle (US 10,344,278 B2) and GenBank (NM_000488.3) and evidenced by Pasi (Pasi, K. J. et al., The New England journal of medicine, 377(9), 819–828, 2017) and Qiu, (Qiu P., et al., 2004, BioTechniques, 36(4), 702–707) for Claim 63, is withdrawn.
The below rejection is written for the unelected species now being considered; i.e., the species corresponding to CjCas9.
Claim interpretation: SERPINC1 gene and AT gene are synonymous [0379].
Claim(s) 63 - 69 and 71 are rejected under 35 U.S.C. 103 as being unpatentable over Kim (Kim et al., NATURE COMMUNICATIONS | 8:14500, 2017), in view of Hinkle (US 20170240892, of record) and GenBank (NM_000488.3, of record). This is a new rejection necessitated by amendment.
Kim teaches a genome editing technology for treating diseases in humans by editing the rouge gene in subjects, the method including infecting cells with a composition comprising CjCas9 protein and sgRNA into cells (Figure 4: AAV-mediated mutagenesis in vitro and in vivo.). Kim teaches first packaging nucleic acid sequence encoding CjCas9 and sgRNA specific for the target to be edited into AAV (an AAV9 vector encoding CjCas9 … a U6 promoter-driven sgRNA specific to the Vegfa or Hif1a gene, pg. 7, first para). The sequences may be in one vector as seen in Fig. 5, also shown below:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Following packaging, the target cells are infected or injected with the packaged sequences (composition). See Fig. 6 for in vivo method, also below:
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Kim further discloses the sgRNA is a sequence capable of forming a complementary bond with a target sequence (Fig. 1, Fig. 5 a). Kim discloses that sgRNAs can easily be designed (See para on Optimization of CjCas9 sgRNA length, pg. 2, right col.). Kim disclose the length of the sgRNA is 19 - 22 bases were able to induce indels at frequencies that ranged from 1.0 to 64% (21±5%, on average). The optimal PAM is 5’-NNNNACAC-3’ in human cells, with 5’-NNNNGCAC-3’ PAMs, 5’-NNNNGTAC-3’ PAMs, and 5’-NNNNATAC-3’ PAMs albeit less efficiently (10±3%, 10±4%, and 16±5%, respectively).
The CjCas9 sgRNA is part of a larger RNA sequence with the following structure (Fig. 1a):
PNG
media_image3.png
200
400
media_image3.png
Greyscale
Thus, Kim’s teachings read on instant composition:
i) a CjCas9 protein; and
ii) a guide RNA, wherein the gRNA includes:
iii) A guide domain; and
iv) a first complementary domain, a second complementary domain, a linker domain, a proximal domain and a tail domain in the 5' to 3' direction, (Kim Fig.2B reproduced above).
Thus, Kim teaches, by designing the genomic region of 20 bases upstream of the NNNVRYM site to be complementary to the sequence of the spacer RNA portion, the CjCas9 enzyme bound to gRNA can cause genome cleavage in the target at a site adjacent to the PAM.
Regarding claim 64, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein introducing the composition is performed in vitro or vivo (pg.7 left col, last para). See also Fig. 4 below for in vitro and in vivo method:
PNG
media_image4.png
200
400
media_image4.png
Greyscale
Regarding claim 65, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the introducing the composition is performed by AAV vectors; e.g., Fig. 4.
Regarding claim 66, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein when the CjCas9 protein is a C. jejuni-derived Cas9 protein (title, abstract), and the guide sequence can easily be designed as discussed for claim 63.
Regarding claim 67, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the composition includes a form of ribonucleoprotein which is a complex combined the sgRNA and the CjCas9 protein (pg.2 left col, first para).
Regarding claim 68 – 69 and 71, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the nucleic acid sequence encoding the sgRNA and the nucleic acid sequence encoding the CjCas9 protein are present in one viral vector (All-in-one AAV vector for in vivo genome editing, pg.6 left col, last para).
Kim does not teach wherein the composition is specific for AT gene editing; i.e., Kim does not teach the gRNA sequences such as the SEQ ID Nos. 659, 665, 673, 676, and 678, as recited in instant claim.
However, Hinkle teaches polynucleotide agents targeting Serpinc1 (AT3) and methods of use thereof (title). One such polynucleotide taught by Hinkle is SEQ ID NO: 613 (Table 4) which binds its target, Serpinc1 mRNA transcript, given by GenBank (NM_000488; SEQ ID NO:1). SEQ ID NO: 613 of Hinkle would direct one of skill to the target region of the AT gene (of Serpinc1) that is unique to it with minimal off-target effects (effective target sequence, Pg. 18, column 16, 1st para). Hinkle teach that with minimal optimization disclosed sequences can result in better therapeutic sequences (the sequences identified, for example, in Tables 3 or 4 represent effective target sequences, it is contemplated that further optimization of antisense inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics; Pg. 18, column 16, 1st para).
All sequences have not been considered because they are recited as being optional i.e., one or more guide sequences.
One of Hinkle’s taught sequences are shown below that is a 100% match to instant SEQ ID NO: 659:
RESULT 1
US-15-499-981-914
(NOTE: this sequence has 3 duplicates in the database searched)
Sequence 914, US/15499981
Publication No. US20170240892A1
GENERAL INFORMATION
APPLICANT: ALNYLAM PHARMACEUTICALS, INC.
TITLE OF INVENTION: POLYNUCLEOTIDE AGENTS TARGETING SERPINC1 (AT3) AND
TITLE OF INVENTION: METHODS OF USE THEREOF
FILE REFERENCE: 121301-02702
CURRENT APPLICATION NUMBER: US/15/499,981
CURRENT FILING DATE: 2017-04-28
PRIOR APPLICATION NUMBER: PCT/US2015/057717
PRIOR FILING DATE: 2015-10-28
PRIOR APPLICATION NUMBER: 62/072,686
PRIOR FILING DATE: 2014-10-30
NUMBER OF SEQ ID NOS: 932
SEQ ID NO 914
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
NAME/KEY: source
OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide"
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCGUUCGCUAAACCCCAACA 20
||||||||||||||||||||
Db 1 CCGUUCGCUAAACCCCAACA 20
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have made a guide sequence out of Hinkle’s SEQ ID NO 914 and arrive at instant SEQ ID NO: 659. Hinkle show that their taught sequences are effective target sequences and a complementary oligonucleotide can bond with the AT target gene. Thus, Kim’s guidance on the design of sgRNA s, i.e., about 20 bases located at the 5' end of chimeric RNA and upstream of PAM sequence, is reduced down to one sequence as per the advantage disclosed by Hinkle of an effective target region. Combining the two teachings would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that combining Hinkle’s targeting region within Kim’s compositions could effectively guide Kim’s composition to the AT gene for further gene manipulation such as indel mutations. As discussed above, one of skill in the art would have expected, indels at frequencies that ranged from 1.0 to 64%. See MPEP 2144 II and 2143 I (A).
Claim(s) 70 is rejected under 35 U.S.C. 103 as being unpatentable over Kim (Kim et al., NATURE COMMUNICATIONS | 8:14500, 2017), in view of Hinkle (US 20170240892, of record) and GenBank (NM_000488.3, of record) as applied to claims 63-69 and 71 above, and further in view of Givens (Givens, B.E. et al., AAPS J 20, 108 Pgs. 1-22, 2018, of record). This is a new rejection necessitated by amendment.
Kim in view of Hinkle teaches a genome editing technology for treating hemophilia with a composition comprising a CjCas9 protein and gRNA, comprising SEQ ID NO: 659 as discussed for claim 69 above; claim 70 depends from claim 69.
Kim in view of Hinkle do not teach wherein the nucleic acid sequence encoding the gRNA and the nucleic acid sequence encoding the Cas protein are present in a non-viral vector, wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) as recited in claim 70.
However, Givens teaches a method wherein the composition for gene manipulation may be present in a non-viral vector, wherein the non-viral vector is a nanoparticle (NP), lipid shell, liposome, or lipid-nanoparticle (LNP) (Givens, Fig. 2). Givens further teaches NPs have emerged as an attractive option for delivering CRISPR/Cas9-based therapies for several advantages they offer, such as: they can be engineered to bind preferentially to specific types of cells or tissues, providing efficient disease-targeting capabilities; can provide protection of the loaded cargo from degradation until they reach the site of delivery; capable of delivering large-sized cargos such as plasmids and large proteins, such as CRISPR/Cas9 components. Fourth, many of the materials used for NP manufacture have very acceptable safety profiles, and they are not expected to elicit mutagenicity per se, as opposed to viral vectors; NP manufacture generally has a very good scale-up potential, which, when added to their improved safety profiles, can facilitate their clinical translation (1st paragraph, left column, Pg. 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the viral vector of Kim with a non-viral vector wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) because Givens teaches several advantages of doing so. Thus, it would have been prima facie obvious to a person of ordinary skill in the art at the time before the effective filing date to substitute the viral vector of Kim with the non-viral vector to use in the method for manipulating AT gene in a human cell, namely to arrive at the claimed invention. A person of ordinary skill in the art would consider the viral vector and non-viral vector as functionally equivalent with respect to delivering a gene manipulating composition to a cell. It would be a simple substitution for one of ordinary skill in the art to do so. See MPEP 2143 I.(B).
Response to Arguments:
Applicant's arguments (Remarks) filed 11-10-2025 to claim 63 - 71 rejections under 35 USC § 103 have been fully considered but they are not fully persuasive for the reasons discussed below.
On Pg. 6 of the Remarks, the response quotes the Non-Final Office Action of 8/20/2025: with respect to recited sequences corresponding to elected species that show unexpected activity:
“SEQ ID NO: 436 is free of the prior art of record.….”
Accordingly, Applicant respectfully request that the examination be extended to include the remaining species belonging to Cas proteins, namely, SaCas9 protein and CjCas9 protein, and their corresponding guide sequences.” A table from specification showing in del efficiency for SaCas9 and CjCas9 is then provided.
Accordingly, this Office Action is a result of examination of unelected species belonging to Cas proteins. As seen in this Office Action, Kim teaches efficiency of in dels with CjCas9 up to 69% can be expected when designing gRNAs following their “rules”.
As discussed in previous Office actions, to be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014). Therefore, if the unelected SEQ ID Nos corresponding to unelected species, CjCas9, exhibit greater than 69% indel efficiency, this can be considered unexpected activity.
Withdrawn Double Patenting
Response to Arguments:
Applicant argues that the '329 copending application has a later priority filing date and later US effective filing date than the instant Application, therefore a Patent issuing from the instant Application will not improperly extend the right to exclude and a double patenting rejection inappropriate (Remarks, Pg. 8).
Therefore, Applicant requests that double patenting rejections be withdrawn. This is not persuasive because NSDP rejection is not the only rejection remaining.
However, Applicants have cancelled the limitations in the claims of the '329 copending application that raised the issue of NSDP. Therefore, the NSDP rejection is withdrawn.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635