DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
The instant application is a 371 filing of PCT/KR2019/09238 filed 7/25/2019 which claims priority to 62703578 filed 7/26/2018. Certified copy of priority documents have been received on 1/22/2021. The priority documents have not been filed in English and therefore applicant is notified, should intervening art be identified, an English copy of the Foreign document may be requested. See MPEP § 201 and 35USC §119(b)(1).
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04/29/2026 has been entered.
Response to Arguments
Applicant's arguments filed 04/29/2026 have been fully considered but they are not persuasive. The §103 rejection is maintained. Arguments are fully addressed at the end of this Office Action.
Election/Restrictions
Applicant’s election without traverse of various Species was previously withdrawn.
Accordingly, all claims 63-71 are under examination.
Withdrawal of Previously Allowed SEQ ID NO.
The indicated allowability of SEQ ID NO: 436 and similarly, SEQ ID NO: 427, 428, 436, 437, 443, 447, 449, 454, 458, 463, 464, 473, 474 of claims 63 and 66 (as indicated in the Non-Final OA dated 8/20/2025) as exhibiting unexpected activity and thus being free of the prior art of record, is withdrawn for reasons discussed below:
With respect to “Unexpected results” presented by Applicant, Examiners are required to evaluate all objective evidence as per MPEP 716.01(a)-(d) and MPEP 716.02. Briefly, such evaluation requires: Comparison to closest prior art (Ohmori, previously cited) and must be commensurate in scope with claims. In instant case, claims are not limited by delivery method and so include both plasmid delivery and protein delivery nor are they limited by number of gRNAs administered. The specification discloses the experimental set up to be: HEK293 and Jurkat human cell lines (cell counts: 2 x 105 cells) were transfected with 250 ng of an sgRNA expression vector cloned with each guide RNA sequence together with 750 ng of a Cas9 expression vector using Lipofectamine 2000. Approximately 2 to 3 days later genomic DNA was analysed for indels [0863]. Results show considerable variation in indel obtained. SEQ ID NO: 436 showed 62% indel. This is presented in [0874] Table 5, wherein the target for this guide is SEQ ID NO: 30.
Applicants contend that the present claims are supported by secondary indicia of nonobviousness, such as unexpected results, because SEQ ID NO: 436 of claim 63 used with SpCas9 exhibits a markedly high indel frequency of 61.2%.
Applicants argument is not persuasive because:
In reanalyzing these results, Examiner finds that
It was known and expected in the prior art that indel frequency varies with gRNA and/or target:
i. Kim et al, published online April 2, 2014 Genome Res., 2014,24, 6:1012–1019, test the indel rate for at least three target loci and under different experimental conditions. They find that when RNPs or plasmids that encode Cas9 and sgRNA are electroporated into K562 cell, variable indels % are obtained but indels of 66% to 100% are reached. The Cas9 must be SpCas9 since the PAM is NGG. See Fig. 5-6.
ii. Xie (Xie et al., Scientific Reports, 2017, 7: 2320, DOI:10.1038) also study indel rates with SpCas9 and use two gRNAs. Xie get up to 100% Insertion/Deletion (indel) rates with CRISPR-Cas9 in Human pluripotent stem cells (hPSCs) (abstract, Fig. 2-3).
Comparison with closest Prior Art
It is very important to note from a scientific viewpoint that instant gRNAs encompassed by the instant claims cannot be directly compared to the closest prior art ; i.e, Ohmori, in order to conclude that the results shown in the instant specification are unexpected, because:
i. Ohmori do not show in del rates and ii. the experimental designs between Ohmori and the instant specification are significantly different.
For instance, Ohmori's Cas9 protein is modified [0044] and of SaCas9 origin. Therefore, its PAM requirement is different from that of SpCas9. When the striking differences in experimental design between Ohmori and the instant application are taken into consideration, one of ordinary skill in the art would reasonably predict that if the same experimental steps as performed in the instant application (e.g., HEK293 and Jurkat human cell lines (cell counts: 2 x 105 cells) were transfected with 250 ng of an sgRNA expression vector cloned with each guide RNA sequence together with 750 ng of a Cas9 expression vector using Lipofectamine 2000. Approximately 2 to 3 days later genomic DNA was analysed for indels [0863], any differences in indel levels between Ohmori and instant would not be seen, because there is no teaching in Ohmori other than standard design rules for gRNA, i.e., designing the genomic region of 20 bases upstream of the NGG site to be complementary to the sequence of the crRNA portion, the Cas9 enzyme bound to sgRNA can cause genome cleavage in the target PAM [0040], and nothing in instant specification indicates otherwise. That is, one of ordinary skill in the art would have reasonably extrapolated, based on the results summarized in Fig. 6 of Ohmori, that the indel obtained by Ohmori is comparable to instant.
Taken together, the results shown in Table 5 of the instant specification are not "really unexpected" given the prior art’s teachings that indel formation can vary based on cell type, target and delivery mode, and that indel percentages of at least 62% are completely within the range of expected editing efficiencies by SpCas9/gRNA complexes, even though the results in the instant specification may differ in some degree from the closest prior art.
A new §103 rejection, addressing this sequence is made in this Office Action.
New Claim Rejection - 35 USC § 103
The below rejection refers to the species of gRNAs corresponding to SpCas9; i.e., previously withdrawn.
Claims 63 – 69 and 71 are rejected under 35 U.S.C. 103 as being unpatentable over Ohmori (WO 2018131551, IDS dated 1/22/2021, previously cited), as evidenced by its English translation, in view of GenBank (NM_000488.3, previously cited) and Qiu, (Qiu P., et al., 2004, BioTechniques, 36(4), 702–707, previously cited) for Claim 63.
Claim interpretation: The regions of the guide RNA recited in part iv) of claim 63 are being interpreted as per specification paragraphs [0109-0229] and shown as such in examiner’s annotations in the below rejection; SERPINC1 gene and AT gene are synonymous [0379].
Ohmori teaches a genome editing technology for treating hemophilia by editing the AT (antithrombin) gene in subjects, the method including introducing a composition comprising Cas9 protein and guide RNA into the subject (a method of treating hemophilia, comprising administering (introducing) a composition for gene manipulation to a treatment subject to treat hemophilia; abstract, [0010], [0050]). Ohmori teaches wherein the composition for AT gene editing includes:
i) a Cas protein, or a nucleic acid sequence encoding the same; and
ii) a guide RNA, or a nucleic acid sequence encoding the same (CRISPR/Cas9 composed of Cas9 protein and guide RNA gRNA), [0010]).
iii) A guide domain; and
iv) a first complementary domain, a second complementary domain, a linker domain, a proximal domain and a tail domain in the 5' to 3' direction, (Fig. 2A).
Ohmori further discloses the gRNA includes: a guide sequence capable of forming a complementary bond with a target sequence located in AT gene (abstract; Three types of sgRNA against Serpinc1 were designed, Table 1; and a sequence (sgRNA1 format) that efficiently cleaves Serpinc1 was selected (data not shown), [0010]; Fig. 6). Ohmori discloses that guide RNAs can easily be designed (CRISPR-Cas9 has a simpler structure, has a high degree of freedom in sequence design, has a good success rate for genome editing, and is low in cost, so its application is rapidly spreading, [0005]). Ohmori disclose the specifics of a single-stranded chimeric RNA, comprise a bacterial tracrRNA portion and a crRNA (also referred to as sgRNA) portion, wherein the crRNA is a polynucleotide of about 20 bases located at the 5' end of chimeric RNA, examples of PAM sequences include 5'-NGG. That is, by designing the genomic region of 20 bases upstream of the NGG site to be complementary to the sequence of the crRNA portion, the Cas9 enzyme bound to sgRNA can cause genome cleavage in the target PAM [0040]. See Fig. 2A reproduced below with examiner’s annotations:
PNG
media_image1.png
477
833
media_image1.png
Greyscale
Ohmori further teach wherein Cas9-mediated genomic cleavage in the liver of treated mice was confirmed using the Surveyor® nuclease assay (Fig. 1A, 2C, 6B, [0110]). As evidenced by Qiu, Surveyor® Nuclease Assay is used to detect indels (insertion/deletions up to at least 12 nucleotides, abstract).
Regarding claim 64, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein introducing the composition is performed in vivo ([0010]).
Regarding claim 65, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein the introducing the composition is performed by vectors ([0010]).
Regarding claim 66, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein when the Cas protein is a Streptococcus pyogenes-derived Cas9 protein, and the guide sequence can easily be designed as discussed for claim 63.
Regarding claim 67, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein the composition for AT gene manipulation includes a form of ribonucleoprotein which is a complex combined the guide RNA and the Cas protein ([0011b]).
Regarding claim 68, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein the nucleic acid sequence encoding the guide RNA and the nucleic acid sequence encoding the Cas protein are present in one vector ([0011#8a]).
Regarding claim 69, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein the vector is a viral vector ([0011#8a]).
Regarding claim 71, Ohmori teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, wherein the viral vector is a one or more viral vectors selected from the group consisting of a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus (AAV) ([0011#8a]).
Ohmori do not teach wherein the guide sequence is SEQ ID NO: 436 as recited in claims 63 and 66. All sequences have not been considered because they are recited as being optional i.e., one or more guide sequences.
However, before the effective filing date of instant invention, the sequence of the AT gene was available in GenBAnk.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have made a guide sequence like SEQ ID NO: 436 according to GenBank’s taught sequence within Ohmori’s composition and following Ohmori’s guidance because Ohmori teach the design rules for a gRNA.
As shown below in the annotated sequence of Serpinc1 mRNA transcript NM_000488, , location of all PAMs, NGG (in bold), there are 81 GGs.
>NM_000488.3 Homo sapiens serpin family C member 1 (SERPINC1), transcript variant 1, mRNA
TCTGCCCCACCCTGTCCTCTGGAACCTCTGCGAGATTTAGAGGAAAGAACCAGTTTTCAGGCGGATTGCC
TCAGATCACACTATCTCCACTTGCCCAGCCCTGTGGAAGATTAGCGGCCATGTATTCCAATGTGATAGGA
ACTGTAACCTCTGGAAAAAGGAAGGTTTATCTTTTGTCCTTGCTGCTCATTGGCTTCTGGGACTGCGTGA
CCTGTCACGGGAGCCCTGTGGACATCTGCACAGCCAAGCCGCGGGACATTCCCATGAATCCCATGTGCAT
TTACCGCTCCCCGGAGAAGAAGGCAACTGAGGATGAGGGCTCAGAACAGAAGATCCCGGAGGCCACCAAC
CGGCGTGTCTGGGAACTGTCCAAGGCCAATTCCCGCTTTGCTACCACTTTCTATCAGCACCTGGCAGATT
CCAAGAATGACAATGATAACATTTTCCTGTCACCCCTGAGTATCTCCACGGCTTTTGCTATGACCAAGCT
GGGTGCCTGTAATGACACCCTCCAGCAACTGATGGAGGTATTTAAGTTTGACACCATATCTGAGAAAACA
TCTGATCAGATCCACTTCTTCTTTGCCAAACTGAACTGCCGACTCTATCGAAAAGCCAACAAATCCTCCA
AGTTAGTATCAGCCAATCGCCTTTTTGGAGACAAATCCCTTACCTTCAATGAGACCTACCAGGACATCAG
TGAGTTGGTATATGGAGCCAAGCTCCAGCCCCTGGACTTCAAGGAAAATGCAGAGCAATCCAGAGCGGCC
ATCAACAAATGGGTGTCCAATAAGACCGAAGGCCGAATCACCGATGTCATTCCCTCGGAAGCCATCAATG
AGCTCACTGTTCTGGTGCTGGTTAACACCATTTACTTCAAGGGCCTGTGGAAGTCAAAGTTCAGCCCTGA
GAACACAAGGAAGGAACTGTTCTACAAGGCTGATGGAGAGTCGTGTTCAGCATCTATGATGTACCAGGAA
GGCAAGTTCCGTTATCGGCGCGTGGCTGAAGGCACCCAGGTGCTTGAGTTGCCCTTCAAAGGTGATGACA
TCACCATGGTCCTCATCTTGCCCAAGCCTGAGAAGAGCCTGGCCAAGGTAGAGAAGGAACTCACCCCAGA
GGTGCTGCAAGAGTGGCTGGATGAATTGGAGGAGATGATGCTGGTGGTCCACATGCCCCGCTTCCGCATT
GAGGACGGCTTCAGTTTGAAGGAGCAGCTGCAAGACATGGGCCTTGTCGATCTGTTCAGCCCTGAAAAGT
CCAAACTCCCAGGTATTGTTGCAGAAGGCCGAGATGACCTCTATGTCTCAGATGCATTCCATAAGGCATT
TCTTGAGGTAAATGAAGAAGGCAGTGAAGCAGCTGCAAGTACCGCTGTTGTGATTGCTGGCCGTTCGCTA
AACCCCAACAGGGTGACTTTCAAGGCCAACAGGCCTTTCCTGGTTTTTATAAGAGAAGTTCCTCTGAACA
CTATTATCTTCATGGGCAGAGTAGCCAACCCTTGTGTTAAGTAAAATGTTCTTATTCTTTGCACCTCTTC
CTATTTTTGGTTTGTGAACAGAAGTAAAAATAAATACAAACTACTTCCATCTCACATTA
Thus, following Ohmori’s guidance on the design of guide RNAs, i.e., about 20 bases located at the 5' end of chimeric RNA and upstream of any one of the 81 identified PAM sequence NGG, is a possible gRNA. As such, there are finite number of identified solutions evidenced by the GenBank sequence when Ohmori’s rules are applied. The small finite number of possible solutions can easily be tested to determine the smaller number of gRNA with acceptable indel rates. The skilled artisan would have had a reasonable expectation of success in designing a gRNA by the taught method of Ohmori and using it within Ohmori’s composition could effectively guide Ohmori’s composition to the AT gene for further gene manipulation such as indel mutations because Ohmori’s gRNA sequences also are similarly designed and demonstrated to be efficacious. See MPEP 2144 II and 2143 I (E).
Claim 70 is rejected under 35 U.S.C. 103 as being unpatentable over Ohmori (WO 2018131551, IDS dated 1/22/2021), as evidenced by its English translation, in view of GenBank (NM_000488.3) as applied to claims 63-69 and 71 above, wherein claim 63 is evidenced by Qiu, Qiu P., et al. (2004, BioTechniques, 36(4), 702–707) and further in view of Givens (Givens, B.E. et al., AAPS J 20, 108 Pgs. 1-22, 2018).
Ohmori in view of GenBank teaches a genome editing technology for treating hemophilia with a composition comprising a Cas protein and guide RNA, comprising SEQ ID NO: 436 as discussed for claim 69 above; claim 70 depends from claim 69.
Ohmori in view of Genbank do not teach wherein the nucleic acid sequence encoding the guide RNA and the nucleic acid sequence encoding the Cas protein are present in a non-viral vector, wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) as recited in claim 70.
However, Givens teaches a method wherein the composition for gene manipulation may be present in a non-viral vector, wherein the non-viral vector is a nanoparticle (NP), lipid shell, liposome, or lipid-nanoparticle (LNP) (Givens, Fig. 2). Givens further teaches NPs have emerged as an attractive option for delivering CRISPR/Cas9-based therapies for several advantages they offer, such as: they can be engineered to bind preferentially to specific types of cells or tissues, providing efficient disease-targeting capabilities; can provide protection of the loaded cargo from degradation until they reach the site of delivery; capable of delivering large-sized cargos such as plasmids and large proteins, such as CRISPR/Cas9 components. Fourth, many of the materials used for NP manufacture have very acceptable safety profiles, and they are not expected to elicit mutagenicity per se, as opposed to viral vectors; NP manufacture generally has a very good scale-up potential, which, when added to their improved safety profiles, can facilitate their clinical translation (1st paragraph, left column, Pg. 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the viral vector of Ohmori with a non-viral vector wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) because Givens teaches several advantages of doing so. Thus, it would have been prima facie obvious to a person of ordinary skill in the art at the time before the effective filing date to substitute the viral vector of Ohmori with the non-viral vector to use in the method for manipulating AT gene in a human cell, namely to arrive at the claimed invention. A person of ordinary skill in the art would consider the viral vector and non-viral vector as functionally equivalent with respect to delivering a gene manipulating composition to a cell. It would be a simple substitution for one of ordinary skill in the art to do so. See MPEP 2143 I.(B).
Maintained Claim Rejection - 35 USC § 103
The below rejection refers to the species of gRNAs corresponding to CjCas9.
Claim(s) 63 - 69 and 71 remain rejected under 35 U.S.C. 103 as being unpatentable over Kim (Kim et al., NATURE COMMUNICATIONS | 8:14500, 2017), in view of Hinkle (US 20170240892, of record) and GenBank (NM_000488.3, of record).
Kim teaches a genome editing technology for treating diseases in humans by editing the rouge gene in subjects, the method including infecting cells with a composition comprising CjCas9 protein and sgRNA into cells (Figure 4: AAV-mediated mutagenesis in vitro and in vivo.). Kim teaches first packaging nucleic acid sequence encoding CjCas9 and sgRNA specific for the target to be edited into AAV (an AAV9 vector encoding CjCas9 … a U6 promoter-driven sgRNA specific to the Vegfa or Hif1a gene, pg. 7, first para). The sequences may be in one vector as seen in Fig. 5, also shown below:
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Following packaging, the target cells are infected or injected with the packaged sequences (composition). See Fig. 6 for in vivo method, also below:
PNG
media_image3.png
200
400
media_image3.png
Greyscale
Kim further discloses the sgRNA is a sequence capable of forming a complementary bond with a target sequence (Fig. 1, Fig. 5 a). Kim discloses that sgRNAs can easily be designed (See para on Optimization of CjCas9 sgRNA length, pg. 2, right col.). Kim disclose the length of the sgRNA is 19 - 22 bases were able to induce indels at frequencies that ranged from 1.0 to 64% (21±5%, on average). The optimal PAM is 5’-NNNNACAC-3’ in human cells, with 5’-NNNNGCAC-3’ PAMs, 5’-NNNNGTAC-3’ PAMs, and 5’-NNNNATAC-3’ PAMs albeit less efficiently (10±3%, 10±4%, and 16±5%, respectively).
The CjCas9 sgRNA is part of a larger RNA sequence with the following structure (Fig. 1a):
PNG
media_image4.png
200
400
media_image4.png
Greyscale
Thus, Kim’s teachings read on instant composition:
i) a CjCas9 protein; and
ii) a guide RNA, wherein the gRNA includes:
iii) A guide domain; and
iv) a first complementary domain, a second complementary domain, a linker domain, a proximal domain and a tail domain in the 5' to 3' direction, (Kim Fig.2B reproduced above).
Thus, Kim teaches, by designing the genomic region of 20 bases upstream of the NNNVRYM site to be complementary to the sequence of the spacer RNA portion, the CjCas9 enzyme bound to gRNA can cause genome cleavage in the target at a site adjacent to the PAM.
Regarding claim 64, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein introducing the composition is performed in vitro or vivo (pg.7 left col, last para). See also Fig. 4 below for in vitro and in vivo method:
PNG
media_image5.png
200
400
media_image5.png
Greyscale
Regarding claim 65, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the introducing the composition is performed by AAV vectors; e.g., Fig. 4.
Regarding claim 66, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein when the CjCas9 protein is a C. jejuni-derived Cas9 protein (title, abstract), and the guide sequence can easily be designed as discussed for claim 63.
Regarding claim 67, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the composition includes a form of ribonucleoprotein which is a complex combined the sgRNA and the CjCas9 protein (pg.2 left col, first para).
Regarding claim 68 – 69 and 71, Kim teaches a genome editing technology for treating a disease with a composition comprising a CjCas9 protein and sgRNA , wherein the nucleic acid sequence encoding the sgRNA and the nucleic acid sequence encoding the CjCas9 protein are present in one viral vector (All-in-one AAV vector for in vivo genome editing, pg.6 left col, last para).
Kim does not teach wherein the composition is specific for AT gene editing; i.e., Kim does not teach the gRNA sequences such as the SEQ ID Nos. 659, 665, 673, 676, and 678, as recited in instant claim.
However, Hinkle teaches polynucleotide agents targeting Serpinc1 (AT3) and methods of use thereof (title). One such polynucleotide taught by Hinkle is SEQ ID NO: 613 (Table 4) which binds its target, Serpinc1 mRNA transcript, given by GenBank (NM_000488; SEQ ID NO:1). SEQ ID NO: 613 of Hinkle would direct one of skill to the target region of the AT gene (of Serpinc1) that is unique to it with minimal off-target effects (effective target sequence, Pg. 18, column 16, 1st para). Hinkle teach that with minimal optimization disclosed sequences can result in better therapeutic sequences (the sequences identified, for example, in Tables 3 or 4 represent effective target sequences, it is contemplated that further optimization of antisense inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics; Pg. 18, column 16, 1st para).
All sequences have not been considered because they are recited as being optional i.e., one or more guide sequences.
One of Hinkle’s taught sequences are shown below that is a 100% match to instant SEQ ID NO: 659:
RESULT 1
US-15-499-981-914
(NOTE: this sequence has 3 duplicates in the database searched)
Sequence 914, US/15499981
Publication No. US20170240892A1
GENERAL INFORMATION
APPLICANT: ALNYLAM PHARMACEUTICALS, INC.
TITLE OF INVENTION: POLYNUCLEOTIDE AGENTS TARGETING SERPINC1 (AT3) AND
TITLE OF INVENTION: METHODS OF USE THEREOF
FILE REFERENCE: 121301-02702
CURRENT APPLICATION NUMBER: US/15/499,981
CURRENT FILING DATE: 2017-04-28
PRIOR APPLICATION NUMBER: PCT/US2015/057717
PRIOR FILING DATE: 2015-10-28
PRIOR APPLICATION NUMBER: 62/072,686
PRIOR FILING DATE: 2014-10-30
NUMBER OF SEQ ID NOS: 932
SEQ ID NO 914
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
NAME/KEY: source
OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide"
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCGUUCGCUAAACCCCAACA 20
||||||||||||||||||||
Db 1 CCGUUCGCUAAACCCCAACA 20
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have made a guide sequence out of Hinkle’s SEQ ID NO 914 and arrive at instant SEQ ID NO: 659. Hinkle show that their taught sequences are effective target sequences and a complementary oligonucleotide can bond with the AT target gene. Thus, Kim’s guidance on the design of sgRNA s, i.e., about 20 bases located at the 5' end of chimeric RNA and upstream of PAM sequence, is reduced down to one sequence as per the advantage disclosed by Hinkle of an effective target region. Combining the two teachings would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that combining Hinkle’s targeting region within Kim’s compositions could effectively guide Kim’s composition to the AT gene for further gene manipulation such as indel mutations. As discussed above, one of skill in the art would have expected, indels at frequencies that ranged from 1.0 to 64%. See MPEP 2144 II and 2143 I (A).
Claim(s) 70 remains rejected under 35 U.S.C. 103 as being unpatentable over Kim (Kim et al., NATURE COMMUNICATIONS | 8:14500, 2017), in view of Hinkle (US 20170240892, of record) and GenBank (NM_000488.3, of record) as applied to claims 63-69 and 71 above, and further in view of Givens (Givens, B.E. et al., AAPS J 20, 108 Pgs. 1-22, 2018, of record).
Kim in view of Hinkle teaches a genome editing technology for treating hemophilia with a composition comprising a CjCas9 protein and gRNA, comprising SEQ ID NO: 659 as discussed for claim 69 above; claim 70 depends from claim 69.
Kim in view of Hinkle do not teach wherein the nucleic acid sequence encoding the gRNA and the nucleic acid sequence encoding the Cas protein are present in a non-viral vector, wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) as recited in claim 70.
However, Givens teaches a method wherein the composition for gene manipulation may be present in a non-viral vector, wherein the non-viral vector is a nanoparticle (NP), lipid shell, liposome, or lipid-nanoparticle (LNP) (Givens, Fig. 2). Givens further teaches NPs have emerged as an attractive option for delivering CRISPR/Cas9-based therapies for several advantages they offer, such as: they can be engineered to bind preferentially to specific types of cells or tissues, providing efficient disease-targeting capabilities; can provide protection of the loaded cargo from degradation until they reach the site of delivery; capable of delivering large-sized cargos such as plasmids and large proteins, such as CRISPR/Cas9 components. Fourth, many of the materials used for NP manufacture have very acceptable safety profiles, and they are not expected to elicit mutagenicity per se, as opposed to viral vectors; NP manufacture generally has a very good scale-up potential, which, when added to their improved safety profiles, can facilitate their clinical translation (1st paragraph, left column, Pg. 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the viral vector of Kim with a non-viral vector wherein the non-viral vector is a nanoparticle, lipid shell, liposome, or lipid-nanoparticle (LNP) because Givens teaches several advantages of doing so. Thus, it would have been prima facie obvious to a person of ordinary skill in the art at the time before the effective filing date to substitute the viral vector of Kim with the non-viral vector to use in the method for manipulating AT gene in a human cell, namely to arrive at the claimed invention. A person of ordinary skill in the art would consider the viral vector and non-viral vector as functionally equivalent with respect to delivering a gene manipulating composition to a cell. It would be a simple substitution for one of ordinary skill in the art to do so. See MPEP 2143 I.(B).
Response to Arguments:
Applicant's arguments (Remarks) filed 4-29-2026 to claim 63 - 71 rejections under 35 USC § 103 have been fully considered but they are not fully persuasive for the reasons discussed below.
It is noted that the remarks were made in reference to the Office Action wherein the OA examined gRNA sequences for Cj Cas9; i.e., SEQ ID NO: 622 to 678.
On Pg. 5 of the Remarks, the response summarizes the Final Office Action of 2/05/2026: Claims 63-69 and 71 stand rejected under 35 U.S.C. § 103 as being unpatentable over Kim (NATURE COMMUNICATIONS | 8:14500, 2017), in view of Hinkle (US 2017/0240892) and GenBank (NM_000488.3).
Then, Applicant traverses on the ground that the results of claim 63 are unexpected and provide a table that clarifies the SEQ ID Nos of guide sequences shown in Table 7 of specification. Specifically, Table 7 shows in del efficiency for 30 different gRNAs used with CjCas9 from 0 to 24.6%.
In the Office Action, Examiner cited Kim as teaching efficiency of in dels with CjCas9 up to 69% can be expected when designing gRNAs following their “rules”.
Applicants argue, that their recited gRNAS show unexpected activity as discussed below:
End of pg. 5, “the Office's assertion does not reflect the common general knowledge in the field of genome editing. In fact, it is well established that gene editing efficiency, including indel frequency, can vary significantly depending on numerous experimental factors, including but not limited to cell type, target gene, concentration of gene editing components, delivery method, and incubation time. Therefore, it is unreasonable to define a rigid threshold for "unexpected activity" based solely on the maximum indel frequency described in Kim under Kim's specific experimental conditions.”
Top of pg. 6, “Thus, Kim's 64% indel frequency represents merely the upper limit observed under Kim's specific experimental conditions and does not provide a general benchmark applicable to different experimental results, such as those of the present Specification.”.
Then Applicants provide the ref of Yamada. "Yamada emphasizes that:
Our data revealed that like CdCas9, CjCas9 cleaves the target dsDNA less efficiently, compared with SpCas9 (Figure S6). These results support the notion that the type Il-C Cas9 enzymes, such as CdCas9 and CiCas9, have not been harnessed for genome editing at least partly because of their relatively poor activities. Thus, it is possible that an engineered CjCas9 variant with improved dsDNA cleavage activity could be used for eukaryotic genome editing. Although CjCas9 and CdCas9 commonly exhibit relatively weak dsDNA cleavage activities, they may have distinct specificities for their cognate RNA guides." (Yamada, p. 1119, emphasis added.)
End of pg. 6, “The recited SEQ ID NOs: 659, 665, and 676 in claim 63 exhibit the highest indel frequencies among the 30 tested guide RNAs and demonstrate unexpected activity in the technical context of CjCas9. However, there is no indication in the cited references that any of the recited SEQ ID NOs would exhibit such a high indel frequency in the context of CjCas9. Accordingly, the results of claim 63 are unexpected in view of the cited references.”.
This is not persuasive.
Regarding experimental conditions, I., it is well-known that optimizing experimental conditions is not a guarantor of a patent. A matter of routine optimization that is within the scope of one of ordinary skill in the art is not considered inventive. See MPEP 2143 I A. Example 6. In instant case, as in example 6, the prior art had taught experimental conditions that can vary to determine efficacy of gene editing. In fact, CRISPR-Cas gene editing, being a mature technology as of the filing date of instant application, has a vast knowledge base of experimental conditions and methods of arriving at optimal gRNAs. Even in the absence of Kim’s paper, one of skill could have designed gRNAs to use with Cj Cas 9, and further tested each of the gRNAs for in del efficiency, and then proceed to pursue those gRNAs that show the best in del efficiency. Optimizing and testing are considered routine and within the scope of the ordinarily skilled artisan. Further, instant claims are not limited by cell type or delivery mode of Cas9/gRNA machinery. Therefore “Kim's specific experimental conditions” are encompassed by instant claim except for specific gRNA sequence.
Regarding the proffered paper of Yamada, Yamada indicates that Cj Cas9 has lower indel efficacy than other Cas9 yet has some value in its ability to use distinct gRNAs (pg. 1119 bridging columns left and right).
The CRISPR-Cas gene editing knowledge base indicates that there is a PAM requirement for gRNAs for Cj Cas9. Applicants have identified gRNAs within the known rules for gRNA design. All have been tested. The results show some gRNAs have better in del activity than others. As per MPEP 2144.05 II A, results of routine designing and testing are not inventive.
III. As discussed in previous Office actions, to be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014). So as not to rely on one particular art; i.e., Kim et al as cited in prior OA, Applicants may look at: L Schmidheini, L., Mathis, N., Marquart, K.F. et al. Continuous directed evolution of a compact CjCas9 variant with broad PAM compatibility. Nat Chem Biol 20, 333–343 (2024). Schmidheini also study indel rates with Cj Cas9. See purple blocks in Fig. 3b. A variation is seen in indel frequency differing with chosen PAM.
Therefore, Applicants SEQ ID Nos corresponding to CjCas9, must exhibit greater indel efficacy than that is expected from any other sequence with the same PAM. Applicants have not provided any evidence of such comparison nor can Examiner find any such evidence indicating that Applicants gRNA sequences have unexpectedly higher indel efficacies.
Applicants arguments are not dispositive. The §103 rejection is maintained.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/Examiner, Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635
Prosecution Insights