Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04/14/2025 has been entered.
Application Status
This action is written in response to applicant’s correspondence received 04/14/2025 Claims 3-5 and 27 are currently pending and examined herein.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 3-4 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wang (Wang et al. MiR-142-5p Suppresses Tumorigenesis by Targeting PIK3CA in Non-Small Cell Lung Cancer. Cellular Physiology and Biochemistry 18 December 2017; 43 (6): 2505–2515.).
Claim interpretation: Claim 3 is drawn to a method of inhibiting (i.e., arresting or slowing its development, as defined by the applicant; see p. 11 line 15) an age-related disease, condition or cancer in a subject in need thereof. The broadest reasonable interpretation of age-related diseases, conditions or cancers encompasses any disease or condition which is associated with age in any way, including diseases which may occur at any age but for which the risk rises with increasing age, as well as all forms of cancer.
Additionally, the wherein clauses are not given patentable weight because they describe functional limitations and, absent evidence to the contrary, describe latent, inherent biological features of any product that inhibits FOXO1/ETV6.
Regarding claim 3, Wang teaches administering to a subject a therapeutically effective amount of a miR-142 mimic to inhibit non-small cell lung cancer (NSCLC) (p. 2509 3rd full para):
For the duration of the treatment with miR-142-5p mimic or miR-142-5p inhibitor for 5 weeks, tumor volume curves revealed a significant decrease in growth rates at the 3rd, 4th and 5th week after treatment with miR-142-5p mimic and a significant increase in growth rates at the 4th and 5th week after treatment with miR-142-5p inhibitor
Regarding claim 4, Wang teaches wherein the condition is cancer (see above).
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 3-5 and 27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of inhibiting dysregulation of splicing factor expression and/or dysregulation of cellular senescence, the method comprising administration of a composition comprising one or more of the recited RNAs, does not reasonably provide enablement for a method of inhibiting the full scope of all age-related disease or condition or cancer in any subject in vivo. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention
The invention is the class of invention that the CAFC has characterized as “the
unpredictable arts such as chemistry and biology.” Mycogen Plant Sci., Inc. v. Monsanto
Co., 243 F.3d 1316, 1330 (Fed. Cir. 2001).
Breadth of the Claims
The claims are directed to a method of inhibiting an age-related disease or condition or cancer. Applicant regards “inhibiting” as meaning, “arresting or slowing its development”(pg 11 ln 15). Age-related conditions encompass any condition for which age is a risk and/or causative factor. Therefore, the claims encompass any method of inhibiting any such conditions.
Per Jaul & Barron (Age-Related Diseases and Clinical and Public Health Implications for the 85 Years Old and Over Population. Front Public Health. 2017 Dec 11;5:335.), age-related diseases include but are not limited to sensory changes (hearing loss, loss of visual acuity, etc.); a decline in immune function; cardiovascular disease (ischemic heart disease, congestive heart failure, hypertension, etc.); cancer, osteoarthritis, diabetes, dementia, and osteoporosis.
The claims are further directed to a method of inhibiting many of those diseases, including Alzheimer’s disease, cardiovascular disease, hypertension, osteoporosis, type 2 diabetes, cancer, Parkinson’s disease, cognitive dysfunction, frailty or progeroid syndromes.
These conditions vary in their underlying causes, risk factors and pathologies, including those unrelated to age. For example, cancer is a highly heterogeneous disease for which no one size treatment fits all patients, as evidenced by Krzyszczyk (The general defining feature of cancer is accumulated cell mutation, which manifests as tumors with uncontrolled growth. However, cancer is a complex, extremely heterogeneous condition. There are over 100 types of cancers, located in different organs and subtissues and originating from different cell types…Over the past decade it has become increasingly clear that no two patients’ cancers are exactly the same, and hence, may have variable responses to generic treatments such as chemotherapy and radiation; pg 79-80; Krzyszczyk et al., 2019; of record).
Guidance of the Specification
The specification does not provide an explicit, limiting definition of age-related condition. The specification does provide examples of age-related conditions including those listed above. However, the specification does not show any working examples of methods of inhibiting any of those conditions in vivo or in any cell or tissue type other than human fibroblasts. The specification also does not show administration of any of the recited miRNAs. The specification only shows that administration of two antisense morpholinos (SEQ ID NOs: 1 and 2) and two siRNAs reduced senescent cell loads. However, it is unclear what siRNAs were used, because Table 5 does not provide SEQ ID NOs: for the siRNAs. Therefore, the specification does not contemplate administration of miRNAs at all, only two antisense morpholinos.
The specification also does not disclose the recited miRNAs in any context but as targets of FOXO1/ETV6 (Table 3), not inhibitors. Claim 3 appears to indicate that the condition is derived in part from increased expression of FOXO1 and/or ETV6, and that therefore the mechanism of the method is reduced expression of these genes via administration of miRNAs or miRNA mimics. This reading of the claim is supported by the specification, which states, “The expression modulator of FOXO1 and/or ETV6 may comprise one or more intermediate non-coding RNA regulators” (p. 5 ln 14-15), and lists the recited miRNAs in lines 19-22 on page 5 and in lines 1-2 on page 6. However, the specification does not show any working examples of these miRNAs regulating the expression of FOXO1 and/or ETV6. It is unclear from the instant disclosure whether those miRNAs would even function in that capacity.
The specification discloses the following fact pattern: senescent cell load contributes to organismal aging (pg 1 ln 16); that dysregulated splicing factor expression has been implicated in cellular senescence (pg 2 ln 21-22); that ERK and AKT pathways influence splicing factor expression (pg 23 ln 20-21); that the Aop and Foxo genes in invertebrates are involved in ERK and AKT signaling and lifespan (pg 45 ln 11-12); and show working examples of FOXO1 or ETV6 knockdown via introduction of morpholinos (pg 45 ln 15-17) or siRNAs (pg 46 ln 1) targeting those genes in human fibroblasts. While the claims generically encompass any composition that has a non-coding RNA regulator, the specification exemplifies (e.g., Table 5) only the use of two specific morpholinos in the alteration of target gene expression. The specification does not disclose the use of any miRNA mimics or antagomiRs.
The specification further discloses that said in vitro knockdown of FOXO1 or ETV6 was associated with reduced senescent cell load (Figures 7-8). Similarly, knockdown of FOXO1 or ETV6 was associated with changes in splicing factor expression (Figures 7A, 8A).
State of the Art
The instant specification discloses that dysregulation of splicing factor expression is related to cell senescence and aging. However, many other factors are at play in cell senescence and aging; the roles of these factors in aging, both individually and collectively, are not well understood; and there exists no known treatment which can prevent, slow, or cause regression of aging, as evidenced by Keshavarz (it is not currently clear to what extent any of these putative aging regulators is in fact broadly linked to organismal aging rate. As outlined above, available data, in contrast, suggest that even interventions commonly claimed to “slow aging” in fact have little effect on most age-dependent phenotypic change; pg 250, Keshavarz et al., 2023; of record).
Additionally, the breadth of the conditions recited by the claims encompasses conditions which may be unrelated to dysregulation of splicing factor expression or for which said dysregulation is not a sole underlying factor but one of many. For example, while the causes of Alzheimer’s disease are not well understood, it is associated with many risk factors, comprising age, genetics, head injury, infection, vascular disease, and exposure to heavy metals (Armstrong 2013; pg 169-170; of record). Given the many possible risk factors and causes of Alzheimer’s and the evidence that the pathology is multifactorial, one having ordinary skill would not predict that correction of splicing factor dysregulation alone would treat Alzheimer’s disease. Furthermore, while therapies exist to treat the symptoms of Alzheimer’s disease, prior to the filing date of the instant invention there were no known therapies to prevent or regress the disease, as evidenced by Bhushan (there is no known cure for Alzheimer’s disease…the death of brain cells in the dementia cannot be halted or reversed… There are no disease-modifying drugs available for Alzheimer’s disease but some options may reduce its symptoms and help improve quality of life; Bhushan et al., 2018, abstract; of record). Similarly, cancer is a highly heterogeneous disease for which no one size treatment fits all patients, as evidenced by Krzyszczyk (The general defining feature of cancer is accumulated cell mutation, which manifests as tumors with uncontrolled growth. However, cancer is a complex, extremely heterogeneous condition. There are over 100 types of cancers, located in different organs and subtissues and originating from different cell types…Over the past decade it has become increasingly clear that no two patients’ cancers are exactly the same, and hence, may have variable responses to generic treatments such as chemotherapy and radiation; pg 79-80; Krzyszczyk et al., 2019). Thus, there is wide variation and a lack of predictability in regards to the causes and treatments of the claimed breadth of conditions such that the ordinary artisan would not expect that merely inhibiting cell senescence would treat the full genus of claimed conditions.
Regarding the extrapolation of in vitro reduction of cellular senescence to in vivo models in particular, post-filing literature reveals that successful use of RNAi to reduce senescence in vitro does not necessarily translate to in vivo, in part due to the fact that the genes involved in senescence and targeted by these therapies also play essential roles in other processes (Treatment of late passage human endothelial cells with a miR-361-5p mimic caused a 14 % decrease in the senescent load of the culture. RNAi gene knockdown of conserved miR-361-5p target genes in a C. elegans model however resulted in adverse effects on healthspan and/or lifespan…Although miR-361-5p may attenuate aspects of the senescence phenotype in human primary endothelial cells, many of its validated target genes also play essential roles in the regulation or formation of the cytoskeletal network, or its interaction with the extracellular matrix. These processes are essential for cell survival and cell function.; Manni et al., 2023, abstract). While the pathways targeted in this reference and in the instant application are not necessarily the same, the finding that genes implicated in senescence have wide-ranging roles, and that silencing of those genes may have unpredictable results in vivo, is relevant to both.
There is also an element of unpredictability in the role and regulation of particular transcription factors such as FOXO1. FOXO1 plays a role in regulating many biological activities, including metabolism and cancer development, as evidenced by Ma (FOXOs play an important role in regulating a plethora of biological activities ranging from development, cell signaling, and tumorigenesis to cell metabolism.; Ma et al., 2018; abstract; of record). FOXO genes as a class also play a paradoxical role in carcinogenesis, sometimes acting as tumor suppressors (high expression or activation of FOXOs in cells is associated with antiproliferation and apoptosis; pg 35) and sometimes enhancing tumorigenicity (FOXOs are also involved in driving or sustaining tumor cell growth or leading tumor cells to drug resistance; pg 35). Thus, the role of FOXO1 is varied and difficult to predict, which renders the consequences of modulating expression of FOXO1 difficult to predict.
Experimentation Required
In order to practice the claimed invention, an undue amount of experimentation would be required. For example, it would be necessary for one of ordinary skill in the art to test all of the claimed miRNAs in the claimed method and composition in the full scope of all encompassed diseases, which effectively includes any disease which may occur with age, including diseases which are not directly caused by age but for which the risks go up with age (i.e., cancer). In the case of cancer especially, it would be necessary to test the claimed method for the full scope of all cancers, in all tissues, with all possible genetic backgrounds. It would also be necessary to test the claimed method in depth to determine long-term toxicity and efficacy, because many age-related conditions occur towards the end of life and outcomes cannot be determined except by administration and monitoring throughout the lifespan. The suppression of FOXO1 and ETV6 may also have unpredictable negative outcomes in vivo due to their complex roles in metabolism and carcinogenesis, and thus must be given higher scrutiny as drug targets. For example, if FOXO1 operates as a tumor suppressor for a given cancer, it would not be expected that inhibition of FOXO1 would inhibit that cancer at all.
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue amount experimentation would be required to make and use the invention as claimed.
35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 3-5 and 27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
The claims are drawn to a composition comprising one or more of the recited miRNAs. The breadth of the encompassed structures is large, encompassing miRNAs with different nucleotide sequences and different targets/seed sequences. The claims require the function of inhibiting any age-related disease or condition via administration of those miRNAs.
As discussed above, the guidance in the specification regarding the correlation between the structure of these miRNAs and their function of inhibiting any of the claimed conditions and/or inhibiting FOXO1/ETV6 expression is minimal. The miRNAs are disclosed as putative modulators of FOXO1/ETV6 expression, but this function is not reduced to practice. The only structures which are disclosed to have that function are SEQ ID NOs: 1 and 2, the antisense morpholinos. Aligning SEQ ID NO: 1 against the nucleotide sequence precursor RNA sequence of human miR-142 (NCBI Reference Sequence NR_029683.1, 12/2018) shows no significant core, shared structure which may be associated with binding of FOXO1/ETV6 and subsequent modulation of those genes, as shown below:
SEQ ID NO: 1:
RESULT 1
MIR142
Query Match 22.4%; Score 5.6; DB 1; Length 87;
Best Local Similarity 55.0%;
Matches 11; Conservative 0; Mismatches 9; Indels 0; Gaps 0;
Qy 1 TCCCCCAGCCGCAGGAGAGC 20
|| |||| || |||
Db 11 TCACCCATAAAGTAGAAAGC 30
RESULT 2
MIR142/c
Query Match 21.6%; Score 5.4; DB 1; Length 87;
Best Local Similarity 85.7%;
Matches 6; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 2 CCCCCAG 8
|| ||||
Db 50 CCTCCAG 44
SEQ ID NO: 2:
RESULT 1
MIR142
Query Match 28.8%; Score 7.2; DB 1; Length 87;
Best Local Similarity 60.0%;
Matches 12; Conservative 0; Mismatches 8; Indels 0; Gaps 0;
Qy 1 CATGTCTCACAGCGAGAGAG 20
|| || ||||| |||
Db 30 CACTACTAACAGCACTGGAG 49
RESULT 2
MIR142/c
Query Match 22.4%; Score 5.6; DB 1; Length 87;
Best Local Similarity 66.7%;
Matches 8; Conservative 0; Mismatches 4; Indels 0; Gaps 0;
Qy 2 ATGTCTCACAGC 13
||| | || ||
Db 18 ATGGGTGACTGC 7
A similar alignment was done against the precursor RNA sequence of human miR-3124,with similar results:
SEQ ID NO: 1:
RESULT 1
MIR3124/c
Query Match 27.2%; Score 6.8; DB 1; Length 67;
Best Local Similarity 80.0%;
Matches 8; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 13 AGGAGAGCCA 22
|||| || ||
Db 49 AGGAAAGTCA 40
RESULT 2
MIR3124
Query Match 23.2%; Score 5.8; DB 1; Length 67;
Best Local Similarity 77.8%;
Matches 7; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 10 CGCAGGAGA 18
||| || ||
Db 9 CGCGGGCGA 17
SEQ ID NO: 2:
RESULT 1
MIR3124
Query Match 24.0%; Score 6; DB 1; Length 67;
Best Local Similarity 64.3%;
Matches 9; Conservative 0; Mismatches 5; Indels 0; Gaps 0;
Qy 2 ATGTCTCACAGCGA 15
|| || | || ||
Db 29 ATTTCCAAAAGTGA 42
RESULT 2
MIR3124/c
Query Match 24.0%; Score 6; DB 1; Length 67;
Best Local Similarity 64.3%;
Matches 9; Conservative 0; Mismatches 5; Indels 0; Gaps 0;
Qy 11 AGCGAGAGAGATCA 24
|| ||| | |||
Db 53 AGTGAGGAAAGTCA 40
Therefore, the specification does not disclose a common structure shared among the exemplified morpholino sequences and the claimed miRNAs which correlates with a shared function of inhibiting age-related diseases and modulating FOXO1/ETV6 expression. The specification also does not reduce to practice administration of the recited miRNAs to achieve the claimed functional outcomes, either in vitro or in vivo. The specification does not appear to provide support for the even the reduction of cell senescence using those miRNAs. While the specification teaches a particular exemplification of morpholino antisense oligos, such a teaching does not disclose a correlation between structure and function or relevant, identifying functional characteristics that would show that the inventors had possession of the full scope of the miRNAs capable of inhibiting FOXO1/ETV6 and/or the full scope of diseases as claimed.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.M.Z./Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636