DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/10/2025 has been entered.
Election/Restrictions
Claims 13-22, 23 are pending and are examined here. Prior action noted that species election requirement for SEQ ID NOs, 3’ terminal dTdT and UU and inside the pore and outer surface of porous silica particle were withdrawn.
Claims 1-12 are canceled.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
As noted in the Remarks of 09/10/2025, the Applicant filed a translation of the certified copy of ‘628 on 07/29/2025 in ‘628. Thus claims 13-23 enjoy the benefit of the ‘628 filing of 08/03/2018.
Claim Rejections - 35 USC § 112
35 U.S.C. 112(a):
Rejection of claims 13-22 under 112(a) under enablement is withdrawn, as the claim specifically is amended to local administration.
35 U.S.C. 112(b):
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 13–23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The indefinite claim language is “wherein the porous particles are characterized in that t, at which an absorbance ratio in the following Equation 1 becomes ½, is 24 or more.” The language is a functional limitation/characteristic, using a degradation value at a point t. The recited functional characteristic does not follow from (is not an inherent property of) the structure recited in the claim, a composition comprising porous silica particle carrying nucleic acid molecules, so it is unclear whether the claim requires some other structure/chemical/physical features to be added to the composition to provide the functional characteristic.
In the previous action, it was noted that the prior art reference Won met the structural limitation of claims 1 and 15 (the species were within the range recited in claim 15, avg. diameter is 200 nm, BET surface area is 388 m2/g, and pour volume is 1/47 ml/g), the Remarks insisted that the MSN did not meet the inherent property. Further a Declaration submitted demonstrated that Won MSN’s degradation value (at ratio of absorbance of Eq. 1 to be ½) was less than 24 hr., while that of the claimed subject matter was greater than 24 hr. If it is the nucleic acid (also a hydrophilic functional group) that affects the degradation value, then it would be obvious based on the art of the record.
The Remarks further added that there are many factors (pore size, surface area, compactness, substituents on the surface, etc. . . ) that can influence the degradation value. There is some other structure/physical/chemical feature that provides the functional limitation noted in claim 1. Thus, it is unclear what range of the structural/physical/chemical feature that provides the porous particle a degradation value (at ratio of absorbance of Eq. 1 to be ½) of 24 hr. or more. All the dependent claims are also rejected since they do not overcome the indefiniteness.
Claim Rejections - 35 USC § 103
Rejection of claims 13-22 is maintained and new claim 23 is rejected, as noted below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 13-23 are rejected under 35 U.S.C. 103 as being unpatentable over Won, (US20170172923, pub. 06/22/2017, applies under 102(a)(1) since it is outside the one year exception, referred as Won ‘923) in view of Lemonex (KR20170057194, pub. 05/24/2017, in IDS, although a GoogleTM machine translation is provided, applies under 102(a)(1) since it is outside the one year exception, referred as Lemonex) and Moller et al. (2017, Chem. Mater., 29, 371-388).
For the purpose of 103 rejection, it is interpreted that if the prior art discloses the elements of cl. 15, 20, and 21, then they possess the inherent properties of instant claimed subject matter.
Won discloses a composition for delivery of bioactive material by the use of a mesoporous silica nanoparticle (MSN) containing pores (abstract), and bioactive material can include nucleic acid (par. 107, par. 5); discloses a method for delivering the bioactive material to be applied for various diseases, including atopic disease and atopic dermatitis (par. 125, 144; relevant to instant cl. 22); figure 1 discloses MSN of 200 nm and Table 3 provides mean pore size as 28 nm, while BET surface area as 388 m2/g and Pore volume of 1.47 ml/g of a prepared MSN with nickel moiety (MSNPN); nickel’s [Ni2+] inherent property is a hydrophilic functional group (par. 152, 61 relevant to instant claim 15, 21)); thus mean pore size of 28 nm, BET surface are as 388 m2/g and pore volume of 1.47 ml/g are species of range noted in and read on instant cl. 15; discloses a functional group can bind to an inner or outer surface of the pore of MSN and provides a surface a negative or positive charge (par. 127); following addition of Ni2+ to the MSN, the MSNPN was dispersed in water and stored, thus water being neutral pH, the particle was positively charged at neutral pH (par. 59, 148; relevant to cl. Instant 20). Won discloses one advantage of using MSN to deliver nucleic acid is to avoid chemically modifying the main chain of nucleic acid due to high cost and a labor intensive process (par. 6).
Won does not disclose a nucleic acid molecule complementary to TSLP, nor siRNA, nor siRNA comprising SEQ ID NO: 1 and its complementary antisense RNA sequence SEQ ID NO: 47, nor with sequences ending with UU at 3’ terminals of both RNA sequences.
Lemonex discloses siRNA targeting TSLP for the treatment of atopic dermatitis, resulting from increased secretion of TSLP cytokine from skin epithelial cells and is associated with atopic dermatitis (pg. 1, referencing GoogleTM translated version); and discloses siRNA, dsRNA targeting TSLP mRNA (pg. 5-6); discloses in Example 2 of screening various siRNAs and dsRNAs in vitro on HaCaT cells, a human skin keratinocyte cells, and notes transfection by use of Lipofectamine 2000 and “porous particles” (pg. 7), based on the untranslated document chart of par. 102 (pg. 14 of KR20170057194, in IDS, relevant to instant cl. 16); discloses a target sequence 1 with the sequence GCAGCCUAUCUCAGUACUA, at position 140 of the gene sequence, and its corresponding antisense strand sequence is UAG UAC UGA GAU AGG CUG CUU, while its sense strand is GCAGCCUAUCUCAGUACUAUU (pg. 5, relevant to instant cl. 16, 17); and each sequence has a UU at its 3’ terminal (relevant to instant cl. 16, 18); discloses preferred sequence for the 3’ overhang consists of TT, where T is deoxythymidine) (pg. 3, relevant to instant cl. 19); discloses that sequence 1 inhibition rate is ~89%, which provides that the target site is accessible for complementary strand binding to inhibit the expression of TSLP; further it should be noted that Table 1 of Lemonex discloses all the sequences, siRNA, dsRNA and antisense strand of instant claim 17, the majority of the sequences which provide for an inhibition of mRNA expression.
Although neither Won nor Lemonex disclose the absorbance characteristics as recited in claim 13, the limitation is an inherent property of a porous silica particle absent evidence to the contrary, and in any event would have been an obvious outcome of optimization of the MSN of Won. Under MPEP 2112 (II-IV) an inherent feature need not be recognized at the relevant time, but requires a rationale or evidence to show inherency. It is known in the art that porous silica particles are degradable, specifically, the mesoporous silica particles with pores allow degradation of MSNs, and MSNs with larger pores particles degrade faster when pore size from 2.8 to 13 nm were tested in simulated bodily fluid (Moller et al., 2017, 29, 371-388, pg. 377). Similarly, here, the porous particles would inherently degrade over time, and the time of degradation can be adjusted, e.g. by adjusting the pore size (relevant to instant claim 13).
Regarding claim 14, MPEP 2113(I) provides that the patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process.
Here, the process of preparation do not add any further structural limitation to the product of claim 13, thus as long as the structural limitation is met, then the product is obvious over the prior art, as disclosed in Won. Further, treating MSN with swelling agents to adjust pore sizes is known (e.g., see Fig. 3 of Moller “Pore-size expansion by using swelling agents”, pg. 375) and calcination of MSN is known in the art to remove template and notes using high temperature of 550oC (Moller, pg. 373).
Further, here the species of BET and pore size data noted in Won is within the range of instant claims thus they anticipate the range, under MPEP 2131.03.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have combined the mesoporous silica particle of Won with the siRNA of Lemonex and arrive at the claimed invention with a reasonable expectation of success. Here, based on ability to use MSN to deliver therapeutic molecule of Won and Lemonex’s siRNA to inhibit expression of TSLP for pharmaceutical purposes, a skilled artisan would have been motivated to combine the use of MSN of Won with siRNA targeting TSLP of Lemonex to deliver the siRNA to the keratinocytes and reduce the expression of TSLP and thereby treat atopic dermatitis. Thus the claims 13-22 are obvious.
Regarding instant cl. 23, Lemonex discloses that preferred embodiment of the present invention, the siRNA oligonucleotide, dsRNA oligonucleotide, and antisense RNA oligonucleotide of the present invention specifically inhibit the expression of TSLP, thereby achieving excellent atopic skin inflammation improvement effect (pg. 3). Further Lemonex discloses that siRNAs have excellent anti-inflammatory effect and improve atopic dermatitis but are also stable at high concentration without irritation when using porous nanoparticle when applied to the skin with “the effect of penetrating” (pg. 2). Lemonex discloses preferred embodiment of formulation as ointment, cream, lotion (pg. 3).
Thus, due to increased stability of siRNAs at high concentration without irritation when combined with porous nanoparticle as noted by Lemonex, a skilled artisan would reasonably expect success combining the MSN of Won with siRNAs targeting TSLP of Lemonex for a method of treating atopic dermatitis by applying to the skin an ointment of Lemonex with the ointment formulation comprising MSN of Won and siRNAs targeting TSLP of Lemonex to treat atopic dermatitis since the MSN-siRNA has reduced irritation when used at high concentration. Thus, cl. 23 is obvious.
Response to Arguments
Applicant's arguments filed 09/10/2025 (“the Remarks”) have been fully considered but they are not persuasive.
The local administration of instant cl. 23 is addressed in the rejection above.
Second, the Declaration of 02/26/25 notes, on pg. 1, that the particles “were prepared in the same manner as in Example 1(1) of the specification of the present application (paragraphs [0205]-[0213] of the publication of the present application.” Paragraphs 205-213 of the publication discloses nucleic acid molecules and does not discuss “Example 1(1)”; may be the Remarks mean par. 305-313. Thus, a clarification will be required.
The Remarks focus on the improper use of the presumptive inherency principle and optimization rationale for the obviousness rejection (pg. 10-18). The Remarks insist that the products of Won and instant claimed subject matter are not substantially identical (pg. 16); Won does not disclose calcination step and with a strong acid treatment, thus creating a different product (pg. 16-17). The Remarks insist optimization is speculative (pg. 12), Moller’s reference solely adjusting one property parameter, i.e. the pore size, cannot cure the deficiency (pg. 12). The Remarks note that “[w]hile the claims do not expressly recite wall thickness, condensation, or functionalization, the detailed scientific literature . . . makes clear that ‘t’ is a composite result of multiple, interrelated synthesis parameters” (pg. 11). The Remarks provide various exhibits, point to the specification (pg. 15, lines 12-14) to point out other structural/physical characteristics and method of synthesis that can affect degradation value (e.g. see pg. 13: surface area, pore diameter, compactness, substituents, and even methods for controlling these physical and chemical properties (e.g. high temperature calcination, absence of acid treatment)).
Then, the Remarks point to the submitted Declaration displaying the difference in degradation between instant claimed invention and the product of Won (pg. 15 and Declaration 02/26/2025).
The argument is not persuasive.
Essentially, the invention is a moving target when analyzed in terms of the degradation value, i.e. absorbance ration at time “t”, a functional limitation that, as noted above, is affected by many parameters. The Remarks do not address the rejection of cl. 14, 15, 20, and 21. Cl. 14 is the product-by-process claim, and the use of swelling agent, use of acid, and calcination is disclosed in Moller. The species of claimed structural/physical properties range of cl. 15 is disclosed in Won. The physical/chemical properties of cl. 20 and 21 are also disclosed by Won. Thus, the examiner has met the burden required under MPEP 2113(I) demonstrating that the product of prior art is substantially identical and that the degradation of MSN can be optimized by fine-tuning one or more parameters to modulate the degradation value.
Regarding other parameters that affect degradation of MSNs, Sere et al. (2018, J. of Nanomaterials, 2018, pg. 1-9) disclose that modifying synthesis process of TEOS-based MSNPs (aka MSNs) affect degradation and conclude that “the biodegradation rate of the MSNPs can be tuned, by varying synthesis parameters such as temperature, base concentration, and surface func-tionalization of the MSNPs” (pg. 2). Fig. 8 discloses different amounts of a triethanolamine (TEA) used in synthesis of MSN (pg. 2) affecting the degradation of MSN (see below of Fig. 7-10 showing various factors affecting degradation, pg. 7). Fig. 8 illustrates that normalized degradation NP (au) is affected by TEA: the higher the amount of TEA, the slower nanoparticles degraded (0.8g of TEA shows ½ AU at ~24 hrs.). Thus, controlling the TEA along with another parameter during synthesis can increase the degradation value to be greater than 24 hrs. Sere et al. disclose that a steady increase in particle size was observed when TEA was used in the reaction mixture or when the reaction temperatures were elevated (pg. 4). Thus, noting how a modification of synthesis material affect the structure/physical property of the MSN.
PNG
media_image1.png
612
710
media_image1.png
Greyscale
Declaration has been addressed in prior action, but again, it is known in the art that properties of MSN can be fine-tuned by various methods. Thus, the rejection of examined claims is maintained.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600