Prosecution Insights
Last updated: April 19, 2026
Application No. 17/267,251

OPTIMIZED CLN7 GENES AND EXPRESSION CASSETTES AND THEIR USE

Final Rejection §103
Filed
Feb 09, 2021
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The University of North Carolina at Chapel Hill
OA Round
4 (Final)
52%
Grant Probability
Moderate
5-6
OA Rounds
3y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
32 granted / 61 resolved
-7.5% vs TC avg
Strong +60% interview lift
Without
With
+60.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
49 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
7.3%
-32.7% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.5%
-17.5% vs TC avg
§112
28.4%
-11.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1, 3, 5, 6, 9, 16-18, 20-22, 24, 26, and 29, 31-34, 36 and 40 are pending and Group I is the elected group; claims 31-34 and 36 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 03/28/2024. Claims 1, 3, 5, 6, 9, 16-18, 20-22, 24, 26, 29 and 40 are examined here. Priority The benefit of U.S. Provisional 62/717,251, filed on 08/10/2018, via its 371 PCT/US2019/045911, filed on 08/09/2019, is recognized. All examined claims enjoy the benefit of the filing date of ‘251. Claim Rejections - 35 USC § 103 Rejection of claims 1, 3, 5, 6, 9, 16, 17, 18, 20-22, 24, 26, 29 is maintained, and cl. 40 is rejected under 103, as noted below. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29 are rejected under 35 U.S.C. 103 as being unpatentable over Sena-Esteves et al. (WO2016172155, pub. date 10/27/2016, referred as Sena-Esteves, of record) and Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) and Inouye et al. (2015, Protein Expression and Purification, 109, pg. 47-54). It should be noted that CLN7 is also designated MFSD8 (pg. 1, line 23-24). Sena-Esteves discloses rAAV vector comprises a transgene encoding a CNS disease associated gene, specifically for treatment of lysosomal storage disease (LSD), including MFSD8 (pg. 32, line 13, 29, relevant to instant cl. 3, 22, 24). Sena-Esteves in Fig. 1 (see below) discloses an exemplary rAAV vector schematic with a first ITR, a promoter (CBA), ORF (β-galactosidase), a SV40 pA signal, and a second AAV ITR (pg. 75 (or 1/74), relevant to instant cl. 3, 5, 6, 9, 17, 18). PNG media_image1.png 248 481 media_image1.png Greyscale Further, instant SEQ ID NO: 3 is in Sena-Esteves SEQ ID NO: 3 from pos. 2063-2185, see sequence alignment provided below and comprises a polyadenylation site (CA dinucleotide sequence is known as a poly A site, relevant to instant cl. 17). Sena-Esteves discloses a vector may express one or more genes necessary for AAV replication, AAV gene (pg. 42, line 21, vector def. pg. 22, and notes of introducing genetic element capable of replication, line 22-25; relevant to instant cl. 16). An embodiment of a mRNA encapsulated in a lipid nanoparticle (LNP) expressing an ORF was administered to mice, pigs and monkeys to illustrate expression of target protein (pg. 660, line 35 to 662, relevant to instant cl. 26). Sena-Esteves discloses the invention is preferably provided as a pharmaceutical composition (pg. 79, line 19-23; relevant to instant cl. 29). Sena-Esteves does not disclose the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence having at least 90% or 99% identity to SEQ ID NO: 1. Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) disclose expression of wild-type and mutant CLN7/MFSD8 constructs tagged with a marker to understand CLN7/MFSD8, which may be associated neurological disease neuronal ceroid lipofuscinoses (Fig. 5, pg. 143; Table 1, pg. 140-141). Siintola discloses cloning human CLN7/MFSD8 (GenBank accession #: NM_152778, pg. 139) into pcDNA3.1 plasmid (pg. 138; relevant to instant cl. 1, 3, 22). Siintola discloses subcellular localization of CLN7/MFSD8 in vitro and co-localized with lysosomal markers (pg. 140, relevant instant cl. 26). However, there is only a 58% identity between CLN7/MFSD8 ORF sequence of NM_152778 and instant SEQ ID NO:1, much less than 90% or 99% required by the claims 1 and 40. However, the protein expressed by both the sequences is the same, thus the ORF sequences are not patentably distinct. Neither Sena-Esteves nor Siintola disclose a codon-optimized human CLN7 ORF (i.e. a nucleotide sequence that is at least 90% (cl. 1) or 99% (cl. 40) identical to the nucleotide sequence of SEQ ID NO: 1). Inouye et al. (2015, Protein Expression and Purification, 109, pg. 47-54) teaches a method of codon optimization for expression of polynucleotides in human cells using preferred human codons by mimicking human codon usage: to improve protein expression in mammalian cells, the overall proportions of usage of each codon were altered to closely match human codon usage (pg. 47). A simple method of codon-optimization was based on the GC-content of the ORF, and the “preferred human codon-optimized genes showed over 60% GC content” (pg. 51, Table 2; also see Figs. 2, 4 showing increased expression of target protein of preferred human codon-optimized genes; relevant to instant cl. 1). Here, the CLN7/MFSD8 ORF sequence (NM_152778) has 41.8% GC content, thus an increase in GC content would improve its expression efficiency in mammalian tissue with the aims of removing the tag marker (HA-tag) of Siintola. To reject a claim based on the obvious to try rationale, the following Graham factual inquiries need to be resolved:. Then, Office personnel must articulate the following: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and (4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness. Here, Inouye discloses a codon-optimization method to improve expression of ORF sequence, and provide a simple solution of increasing GC content to improve protein expression of a ORF sequence. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify the CLN7/MFSD8 ORF sequence in view of Inouye and arrive at the claimed invention with a reasonable expectation of success. Based on the success of codon-optimization of ORF sequence of Inouye and success of Siintola to express a tagged protein to determine cellular localization, a skilled artisan would try to utilize the codon-optimization strategy of Inouye for the CLN7/MFSD8 ORF to improve expression of the CLN7/MFSD8. Further, one of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the rAAV-transgene vector of Sena-Esteves with the CLN7/MFSD8 ORF of Siintola and arrive at the claimed invention with a reasonable expectation of success. Sena-Esteves was successful in expressing the transgene protein in AAV vector comprising a promoter and SV40 pA signal, and Siintola was successful in expressing HA-tagged CLN7/MFSD8 for cellular localization, a skilled artisan would reasonably expect success in incorporating the CLN7/MFSD8 ORF of Siintola into the rAAV vector of Sena-Esteves to express the transgene in an organism. Claim 40 is rejected under 35 U.S.C. 103 as being unpatentable over Sena-Esteves et al. (WO2016172155, pub. date 10/27/2016, referred as Sena-Esteves, of record) and Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) and Inouye et al. (2015, Protein Expression and Purification, 109, pg. 47-54) as applied to claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29 above, and further in view of Gould et al. (2014, Frontiers in Bioeng. And Biotech., 2, pg. 1-14, referred as Gould). Disclosure pertaining to rejection of instant cl. 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29 is noted above. Sena-Esteves, Siintola, Inouye do not disclose a sequence at least 99% identical to SEQ ID NO: 1. Gould et al. (2014, Frontiers in Bioeng. And Biotech., 2, pg. 1-14) discloses many in silico tools available for codon-optimization (Table 1, pg. 4). Gould disclose that synthetically designed genes have historically been optimized for host codon bias and mRNA secondary structure, but there are other forces acting on translation throughput (pg. 12). Gould disclose various in silico, including web-based application, tools allow for user-based preference in designing a codon-optimized sequence based on various factors: codon context bias, RNA secondary structure, specific codon and/or motif preference, etc. . .(pg. 2-4, Table 2). Additional online tools to design a codon-optimization sequence were also available at the time of instant filing(e.g., a commercial company IDTdna.com provided codon-optimization sequence for purchase). Thus, as similar rationale made above with Inouye, it would be obvious to try various in definite silico tools to design a codon-optimized sequence of CLN7 nucleotide sequence. Based on the availability of various codon-optimization in silico tools disclosed by Gould, and success of Siintola to express a tagged protein to determine cellular localization, a skilled artisan would try to utilize the codon-optimization strategy of Gould for the CLN7/MFSD8 ORF to improve expression of the CLN7/MFSD8. Thus, cl. 40 is obvious. Claims 20, 21 are rejected under 35 U.S.C. 103 as being unpatentable over Sena-Esteves et al. (WO2016172155, pub. date 10/27/2016, referred as Sena-Esteves, of record) and Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) and Inouye et al. (2015, Protein Expression and Purification, 109, pg. 47-54), as applied to claims 1, 3, 5, 6, 9, 16, 17, 18, 24, 26, 29 above, and further in view of Tornoe (2002, Gene Therapy, 297, pg. 21-32, of record). Disclosure regarding rejection of claims 1, 3, 5, 6, 9, 16, 17, 18, 24, 26, 29 is noted above. Further Sena-Esteves discloses one or more ITRs can be selected from various AAV serotypes (AAV1-AAV6, see claim 38). Thus, the AAV can have hybrid ITRs, i.e. one is modified from the other AAV serotype ITR. SEQ ID NO: 3 (pg. 43, line 19) is an AAV vector, comprising a 5’-ITR sequence (pos. ~2531-2639) that is modified from the 3’-ITR sequence (~5509-5627), see alignment below; relevant to instant cl. 20). Sena-Esteves and Siintola do not disclose a SEQ ID NO: 4, which comprises instant SEQ ID NO: 1, JeT promoter, and SV40 polyadenylation signal. The sequence for JeT promoter is known in the art. Tornoe et al. disclose a JeT promoter sequence (pg. 24, Fig. 1 comprises the JeT promoter), which is a hybrid promoter, constructed as a 200 bp chimeric promoter built from a randomized JeT promoter libraries from fragments of the viral SV40 early promoter and human b-actin and ubiquitin promoters (Abstract); discloses a means of for more accurately controlling gene expression by designing synthetic promoters (pg. 21); discloses variance in JeT promoter activity depending on cell type (Fig. 4, pg. 26). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified rAAV-transgene of Sena-Esteves in view of Tornoe and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Sena-Esteves in expressing a transgene in various tissues and success of Tornoe of using a JeT promoter to fine tune expression of a transgene, a skilled artisan would simply substitute the JeT promoter of Tornoe for a promoter of rAAV vector of Sena-Esteves to fine-tune the expression of target gene based. Thus, claim 20 is obvious. Regarding instant claim 21, instant SEQ ID NO: 4 is a CLN7 expression cassette of 1890 nt., comprising a JeT promoter (164 nt.), a codon-optimized CLN7 (1557 nt., i.e. SEQ ID NO: 1), and a SV40 pA (123 nt.) along with short nucleotide sequences appearing to be filler sequences. As noted above, the expression vector with CLN7/MFSD8 ORF of Siintola is only ~58% identical to instant SEQ ID NO: 1, however the protein product is the same as instant CLN7 protein product and is not patentably distinct. Further, Inouye discloses a discrete method of codon-optimizing a wild-type ORF sequence of gene to improve translation efficiency in mammalian cell, it would be obvious to try to modify CLN7 ORF sequence of Siintola to improve the translation efficiency of CLN7 ORF of Siintola. Further the Jet promoter and SV40 pA signal is noted above. Filler sequence, i.e. random nt. sequence, is well known in the art with no known function except for packaging purpose and that does not disrupt the function of the vector. Thus, claim 21 is obvious. Response to Arguments Applicant's arguments filed 11/17/2025 (“the Remarks”) have been fully considered but they are not persuasive. The Remarks argue the following: Siintola and Inouye do not teach all the elements of cl. 2 since the sequence of prior art does not meet the limitations of instant claimed invention (pg. 6). The patentability of the claim lies in having a codon-optimized ORF sequence, and not the protein product of the codon-optimized sequence and thus the conclusion that the ORF sequences are not patentably distinct is incorrect (pg. 7). The purpose of the invention is to optimize CLN7 ORF sequences to treat disorder marked by aberrant expression of CLN7 (pg. 7). The cited art “teaches away” from the present claims, since Inouye’s teaching of codon-optimization it teaches optimizing by using sequences with over 60% GC content and does not teach “decreasing CpG content and/or adding or removing ribosomal entry sites” (pg. 7). The results are unexpected since the “Applicant has demonstrated that the expression vectors of the instant claims increase total and lysosomal GCase and CathB activity around two-fold at the optimal dose . . .Fig. 3A-D” (pg. 7). The argument is not persuasive. Addressing argument 1, the Examiner does not contest the argument only that the difference is not sufficient for patentable distinction. § 103 does not require that the prior art teach every element of the claimed invention. Rather, it prohibits inventions that would have been obvious to a person of ordinary skill in the art given the teachings of the prior art. Addressing argument 2), the patentability of the claim lies in having a codon-optimized ORF sequence, and not the protein product of the codon-optimized sequence. The sequence by itself is meaningless and the purpose is to “treat a disorders marked by aberrant expression,” i.e. to express the sequence in to a protein and the sequence is not used to inhibit the expression of a gene or some other purpose. Thus, here, if the protein is the same as a wild-type disclosed protein, the outcome of the expression will be the same. Addressing argument 3) that the Inouye reference teaches away, the prior arts do not teach away even though it does not teach every element of codon optimization, since codon-optimization is based on skilled artisan preference. Although Inoue teaches a much higher level of GC content (i.e. over 60%) than instant sequence 56.5%, a skilled artisan would try different GC content levels. E.g. from the disclosed NM_152778 CLN7 sequence, a skilled artisan using the teachings of Inouye would increase the GC content in reasonable increments and try GC content of 50%, 55%, and 60% and 65%, etc. . . Further, even though there are differences in GC content, of say 60%, of Inouye and instant SEQ ID NO: 1, the claim still allows a difference of 9.9 % from SEQ ID NO: 1, amounting to some 150 nt. difference. Thus, a range of 60.1% and 56.5% is within the noted difference. Further, there are many codon-optimization tools that are available and allows a skilled artisan to modulate many selection criteria based on their preference, including based on organism, restriction site, and modifying the 5’ and 3’ ends. Addressing argument 4, the MPEP requires that the results are in commensurate with the claims. Here, the results of SEQ ID NO: 1 are not in commensurate with the claims (a sequence 90% identical to SEQ ID NO: 1). Further, even if they were, the results provided are not an apple to apple comparison. Here, the results fail to show that the codon-optimized SEQ ID NO: 1 provides the unexpected results compared to a non-codon-optimized CLN7 sequence; the results do not provide a non-codon-optimized CLN7 sequence (say of NM_152778 sequence). It could be argued that the CLN7 NM_152778 or even a sequence optimized of Inouye would provide similar GCase and CathB activities. Thus, the rejection of examined claims is maintained. Sequence Alignment: ITR sequences of Sena-Esteves (Qy-SEQ ID NO: 3 of Sena-Esteves; Db = ITR2 sequence, from GenBank: AF369964.1, accessed 8/7/2025, submitted 2001, included in PTO-892) Query Match 1.9%; Score 112.6; DB 1; Length 143; Best Local Similarity 96.6%; Matches 115; Conservative 0; Mismatches 4; Indels 0; Gaps 0; Qy 5509 GGGGGGGGGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA 5568 | | || |||||||||||||||||||||||||||||||||||||||||||||||||||| Db 19 GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA 78 Qy 5569 AAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 5627 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 79 AAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 137 NASEQ2_08072025_094725/c Query Match 1.8%; Score 109; DB 1; Length 143; Best Local Similarity 100.0%; Matches 109; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2531 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 2590 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 137 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 78 Qy 2591 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCA 2639 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 77 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCA 29 Sequence Alignment: SV polyA signal of Sena-Esteves (Qy-SEQ ID NO: 3, Db-instant SEQ ID NO: 3) Qy 2063 CATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATG 2122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 123 CATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATG 64 Qy 2123 CTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAA 2182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 63 CTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAA 4 Qy 2183 ACA 2185 ||| Db 3 ACA 1 Allowable Subject Matter No claim allowed. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Feb 09, 2021
Application Filed
Jun 17, 2024
Non-Final Rejection — §103
Sep 25, 2024
Response Filed
Jan 21, 2025
Final Rejection — §103
Apr 23, 2025
Examiner Interview Summary
Apr 28, 2025
Request for Continued Examination
Apr 29, 2025
Response after Non-Final Action
Aug 11, 2025
Non-Final Rejection — §103
Nov 17, 2025
Response Filed
Jan 29, 2026
Final Rejection — §103
Feb 19, 2026
Interview Requested
Feb 25, 2026
Examiner Interview Summary
Feb 25, 2026
Applicant Interview (Telephonic)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
2y 5m to grant Granted Apr 14, 2026
Patent 12570974
OLIGONUCLEOTIDES FOR CONTROLLING TAU SPLICING, AND USES THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12516322
MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12509716
FUNCTIONAL LIGANDS TO TARGET MOLECULES
2y 5m to grant Granted Dec 30, 2025
Patent 12509681
COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+60.4%)
3y 8m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month