DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 05/07/2026 has been entered.
Election/Restrictions
Newly amended claims 1, 3, 5, 6, 9, 16-18, 20-22, 24, 26, and 29, 31-34, 36 and 40 are pending and Group I is the elected group; claims 31-34 and 36 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 03/28/2024.
Claims 1, 3, 5, 6, 9, 16-18, 20-22, 24, 26, 29 and 40 are examined here.
Priority
The benefit of U.S. Provisional 62/717,251, filed on 08/10/2018, via its 371 PCT/US2019/045911, filed on 08/09/2019, is recognized. All examined claims enjoy the benefit of the filing date of ‘251.
Claim Rejections - 35 USC § 103
Rejection of claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29 under Siintola, Sena-Esteves, and Inouye is withdrawn. However, for convenience purposes claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29, along with cl. 40, have been rejected under Siintola, Sena-Esteves and Gould, as noted below.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29, and 40 are rejected under 35 U.S.C. 103 as being unpatentable over Sena-Esteves et al. (WO2016172155, pub. date 10/27/2016, referred as Sena-Esteves, of record) and Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) and Gould et al. (2014, Frontiers in Bioeng. And Biotech., 2, pg. 1-14, referred as Gould).
It should be noted that CLN7 is also designated MFSD8 (pg. 1, line 23-24).
Sena-Esteves discloses rAAV vector comprises a transgene encoding a CNS disease associated gene, specifically for treatment of lysosomal storage disease (LSD), including MFSD8 (pg. 32, line 13, 29, relevant to instant cl. 3, 22, 24). Sena-Esteves in Fig. 1 (see below) discloses an exemplary rAAV vector schematic with a first ITR, a promoter (CBA), ORF (β-galactosidase), a SV40 pA signal, and a second AAV ITR (pg. 75 (or 1/74), relevant to instant cl. 3, 5, 6, 9, 17, 18).
PNG
media_image1.png
248
481
media_image1.png
Greyscale
Further, instant SEQ ID NO: 3 is in Sena-Esteves SEQ ID NO: 3 from pos. 2063-2185, see sequence alignment provided below and comprises a polyadenylation site (CA dinucleotide sequence is known as a poly A site, relevant to instant cl. 17). Sena-Esteves discloses a vector may express one or more genes necessary for AAV replication, AAV gene (pg. 42, line 21, vector def. pg. 22, and notes of introducing genetic element capable of replication, line 22-25; relevant to instant cl. 16). An embodiment of a mRNA encapsulated in a lipid nanoparticle (LNP) expressing an ORF was administered to mice, pigs and monkeys to illustrate expression of target protein (pg. 660, line 35 to 662, relevant to instant cl. 26). Sena-Esteves discloses the invention is preferably provided as a pharmaceutical composition (pg. 79, line 19-23; relevant to instant cl. 29).
Sena-Esteves does not disclose the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence having at least 99% and 100% identity to SEQ ID NO: 1.
Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) disclose expression of wild-type and mutant CLN7/MFSD8 constructs tagged with a marker to understand CLN7/MFSD8, which may be associated neurological disease neuronal ceroid lipofuscinoses (Fig. 5, pg. 143; Table 1, pg. 140-141). Siintola discloses cloning human CLN7/MFSD8 (GenBank accession #: NM_152778, pg. 139) into pcDNA3.1 plasmid (pg. 138; relevant to instant cl. 1, 3, 22). Siintola discloses subcellular localization of CLN7/MFSD8 in vitro and co-localized with lysosomal markers (pg. 140, relevant instant cl. 26). However, there is only a 58% identity between CLN7/MFSD8 ORF sequence of NM_152778 and instant SEQ ID NO:1, much less than 99% and 100% required by claims 1 and 40, respectively. However, the protein expressed by both the sequences is the same, thus the ORF sequences are not patentably distinct.
Neither Sena-Esteves nor Siintola disclose a codon-optimized human CLN7 ORF (i.e. a nucleotide sequence that is at least 99% (cl. 1) or 100% (cl. 40) identical to the nucleotide sequence of SEQ ID NO: 1.
Gould et al. (2014, Frontiers in Bioeng. And Biotech., 2, pg. 1-14) disclose in silico tools available for codon-optimization (Table 1, pg. 4). Gould disclose that synthetically designed genes have historically been optimized for host codon bias and mRNA secondary structure, but there are other forces acting on translation throughput (pg. 12). Gould discloses in silico, including web-based application, tools that allow for user-based preference in designing a codon-optimized sequence based on various factors: codon context bias, RNA secondary structure, specific codon and/or motif preference, etc. . .(pg. 2-4, Table 2). Additional online tools to design a codon-optimization sequence were also available at the time of instant filing (e.g., a commercial company IDTdna.com provided codon-optimization sequence for purchase).
To reject a claim based on the obvious to try rationale, the following Graham factual inquiries need to be resolved:. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
Here, Gould discloses a codon-optimization method to improve expression of ORF sequence. Siintola identifies the problem of various mutations of CLN7/MFSD8 gene in a group of individuals with neuronal ceroid lipofuscinoses (NCLs, abstract) and were able to express the both the wild-type and missense mutant CLN7/MFSD8 in non-neuronal cells used (COS-1 and Hela cells) for cellular localization purposes. Gould discloses various finite platforms that can be utilized to codon-optimize the CLN7 ORF. Thus, a skilled artisan could have pursued to codon-optimize the CLN7/MFSD8 transcript based on any of the desired criteria to optimize the expression of the transcript (relevant to instant cl. 1, 40).
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify the CLN7/MFSD8 ORF sequence in view of Gould and arrive at the claimed invention with a reasonable expectation of success. Based on the ability to design transcribed genes for codon-optimization of Gould and success of Siintola to express a tagged protein to determine cellular localization in non-neuronal cells, a skilled artisan would try to utilize the codon-optimization strategy of Gould for the CLN7/MFSD8 ORF to improve expression of the CLN7/MFSD8 in other target cells, including neurons.
Further, one of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the rAAV-transgene vector of Sena-Esteves with the CLN7/MFSD8 ORF of Siintola and arrive at the claimed invention with a reasonable expectation of success. Sena-Esteves was successful in expressing the transgene protein in AAV vector comprising a promoter and SV40 pA signal, and Siintola was successful in expressing HA-tagged CLN7/MFSD8 for cellular localization, a skilled artisan would reasonably expect success in incorporating the CLN7/MFSD8 ORF of Siintola into the rAAV vector of Sena-Esteves to express the transgene in an organism. Thus, claims 1, 3, 5, 6, 9, 16, 17, 18, 22, 24, 26, 29, and 40 are obvious.
Claims 20, 21 are rejected under 35 U.S.C. 103 as being unpatentable over Sena-Esteves et al. (WO2016172155, pub. date 10/27/2016, referred as Sena-Esteves, of record) and Siintola et al. (2007, The American J. of Human Genetics, 81, pg. 136-146, referred as Siintola) and Gould et al. (2014, Frontiers in Bioeng. And Biotech., 2, pg. 1-14, referred as Gould), as applied to claims 1, 3, 5, 6, 9, 16, 17, 18, 24, 26, 29, 40 above, and further in view of Tornoe (2002, Gene Therapy, 297, pg. 21-32, of record).
Disclosure regarding rejection of claims 1, 3, 5, 6, 9, 16, 17, 18, 24, 26, 29 and 40 is noted above. Further Sena-Esteves discloses one or more ITRs can be selected from various AAV serotypes (AAV1-AAV6, see claim 38). Thus, the AAV can have hybrid ITRs, i.e. one is modified based on another AAV serotype ITR. SEQ ID NO: 3 (pg. 43, line 19) is an AAV vector, comprising a 5’-ITR sequence (pos. ~2531-2639) that is modified from the 3’-ITR sequence (~5509-5627), see alignment below; relevant to instant cl. 20).
Sena-Esteves, Siintola, and Gould do not disclose a SEQ ID NO: 4, which comprises instant SEQ ID NO: 1, JeT promoter, and SV40 polyadenylation signal.
The sequence for JeT promoter is known in the art.
Tornoe et al. disclose a JeT promoter sequence (pg. 24, Fig. 1 comprises the JeT promoter), which is a hybrid promoter, constructed as a 200 bp chimeric promoter built from a randomized JeT promoter libraries from fragments of the viral SV40 early promoter and human b-actin and ubiquitin promoters (Abstract); discloses a means of for more accurately controlling gene expression by designing synthetic promoters (pg. 21); discloses variance in JeT promoter activity depending on cell type (Fig. 4, pg. 26).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified rAAV-transgene of Sena-Esteves in view of Tornoe and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Sena-Esteves in expressing a transgene in various tissues and success of Tornoe of using a JeT promoter to fine tune expression of a transgene, a skilled artisan would simply substitute the JeT promoter of Tornoe for a promoter of rAAV vector of Sena-Esteves to fine-tune the expression of target gene based. Thus, claim 20 is obvious.
Regarding instant claim 21, instant SEQ ID NO: 4 is a CLN7 expression cassette of 1890 nt., comprising a JeT promoter (164 nt.), a codon-optimized CLN7 (1557 nt., i.e. SEQ ID NO: 1), and a SV40 pA (123 nt.) along with short nucleotide sequences appearing to be filler sequences.
As noted above, the expression vector with CLN7/MFSD8 ORF of Siintola is only ~58% identical to instant SEQ ID NO: 1, however the protein product is the same as instant CLN7 protein product and is not patentably distinct. Further, Gould discloses various platforms to codon-optimize a wild-type ORF sequence of gene to improve translation efficiency in mammalian cell, thus it would be obvious to try to modify CLN7 ORF sequence of Siintola to improve the translation efficiency of CLN7 ORF of Siintola. Further the Jet promoter and SV40 pA signal aid in improving transcript expression. Filler sequence, i.e. random nt. sequence, is well known in the art with no known function except for packaging purpose and does not disrupt the function of the vector. Thus, claim 21 is obvious.
Response to Arguments
Applicant's arguments filed 05/07/2026 (“the Remarks”) have been fully considered but they are not persuasive.
Here, since Inouye reference has been withdrawn, the arguments raised against Inouye will be addressed as far as they overlap with Gould’s reference.
The Remarks argue that the claims are not obvious under "obvious to try' rationale and are not obvious under the “combining prior art elements” rationale, nor obvious under the “use of known technique” or “applying a known technique” rationales.
Here, there is no finite number of identified, predictable potential solutions and since the potential solutions are unknown, a skilled artisan could not have pursued any known potential solutions with a reasonable expectation of success (pg. 7).
Gould’s methods and aim to increase protein expression are not a known potential solution that a skilled artisan would be motivated to pursue to come up with a codon-optimized CLN7 method to treat disorders associated with aberrant CLN7 expression (pg. 7); noting that potential issue of overexpression of CLN7, a transmembrane lysosomal transporter, would “alter the delicate balance of ions across the endolysosomal membrane and affect membrane potential in unpredictable ways (pg. 7-8). Then adds that a skilled artisan would want to “optimize CLN7 expression without overexpressing it” (pg. 8).
Since a sequence identity of 99% of SEQ ID NO: 1 is not taught in the prior art, the references fail to identify each element of the claimed subject matter, it is not obvious (pg. 8).
The Remarks insist that "the Applicant has found no benefit in overexpressing CLN7. Rather, the intent of codon optimization is to remove cryptic splice sites, alternative start codons, and other factors that could lead to unintended transcripts and peptides being expressed" and to distinguish it from endogenous native sequence for tracking purposes and thus the Applicant has different goals than those of references (pg. 9).
The Remarks argue that codon-optimized can be patentably distinct and non-obvious even if the protein product is the same as that of the cited reference (pg. 7).
In the alternative or contrary to earlier Remarks, the Remarks now note that "contrary to Examiner's assertion on page 9, the nucleotide sequence by itself is not meaningless, as the sequence alters how efficiently the protein is expressed and whether the correct forms and amounts of the protein are expressed" (pg. 11).
A sequence optimized using the methods disclosed in the cited references likely will not yield the same results as would be obtained using the claimed sequences (pg. 7).
The arguments are not persuasive.
Addressing argument 1, as noted in the rejection, there are finite solutions. Gould discloses the use of finite number of software tools to redesign of protein-coding genes using pre-defined features of interest for improved protein expression based on simplified DNA manipulation. Further, the number of codons that can be optimized are relatively finite, since the potential possibility of codon(s) for each amino acid is known in the art.
Siintola notes that CLN7/MFSD8 gene needs to be further characterized. Thus, a skilled artisan can have a different purpose or goal than that of the instant application to utilize an optimized sequence, which the Remarks alleges are to track the variant transcripts and not to increase expression. Here the claimed subject matter is to a codon-optimize sequence and not the purpose of codon-optimization.
Further, argument 3, insisting that the codon-optimized sequence can be patentably distinct and non-obvious even if the protein product is the same as that of the cited reference, is not persuasive. If the sequence is not optimized, e.g., for increased expression, then it is not functionally different than that of the wild-type transcript known in the art. Thus the codon-optimized sequence would be an obvious variant of the wild-type version of Siintola and thus is not patentably distinct.
Further the Remarks appear to distinguish between types of optimization: quantity, efficiency, and/or type of isoform transcribed (see pg. 11, quote provided below too). All these types of optimization are known in the art (see Gould pg. 3: secondary structure of mRNA affecting efficiency, hidden stop codons). Additionally, the Remarks note a few purposes for codon-optimization, including “to remove cryptic splice sites, alternative start codons, and other factors that could lead to unintended transcripts and peptides being expressed.” The generic concepts of cryptic splice sites/alternative start codons/unintended isoforms affecting gene expression is known in the art (Gould, pg. 3 and Siintola as well). The Remarks and specification generally fail to provide objective evidence for any improvement of codon-optimized claimed SEQ ID NO: 1, i.e. such as removing cryptic splice sites or “other factors” that eliminate unintended transcripts/peptides, which may aid their argument.
In their argument 2, to argue against the lack of patentable distinction argument of the action, the Remarks add that the differences in “the nucleotide sequence is not meaningless, as the sequence alters how efficiently the protein is expressed and whether the correct forms and amounts of the protein are expressed” (pg. 11). Here, indeed the Remarks suggest that correct amounts of expression or efficiency of expression. Correct amount of expression/efficiency are known codon-optimization purpose as suggested by Gould and known in the art (see pg. 3, “available tools that model translation initiation and aid the design of ribosomal binding site”).
Lastly, their argument that results of sequences of prior art will be different than that of claimed sequences will “likely” not be the same is not convincing, since there is no objective evidence to show a different outcome, which possibly could point to unexpected results. Alternatively, it could be argued that the results will be the same. Here, the Remarks provide no unexpected results.
Thus the rejection is maintained.
Sequence Alignment
Sequence Alignment: ITR sequences of Sena-Esteves (Qy-SEQ ID NO: 3 of Sena-Esteves; Db = ITR2 sequence, from GenBank: AF369964.1, accessed 8/7/2025, submitted 2001, included in PTO-892)
Query Match 1.9%; Score 112.6; DB 1; Length 143;
Best Local Similarity 96.6%;
Matches 115; Conservative 0; Mismatches 4; Indels 0; Gaps 0;
Qy 5509 GGGGGGGGGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA 5568
| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 19 GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA 78
Qy 5569 AAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 5627
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 79 AAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG 137
NASEQ2_08072025_094725/c
Query Match 1.8%; Score 109; DB 1; Length 143;
Best Local Similarity 100.0%;
Matches 109; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2531 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 2590
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 137 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 78
Qy 2591 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCA 2639
|||||||||||||||||||||||||||||||||||||||||||||||||
Db 77 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCA 29
Sequence Alignment: SV polyA signal of Sena-Esteves (Qy-SEQ ID NO: 3, Db-instant SEQ ID NO: 3)
Qy 2063 CATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATG 2122
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 123 CATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATG 64
Qy 2123 CTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAA 2182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63 CTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAA 4
Qy 2183 ACA 2185
|||
Db 3 ACA 1
Allowable Subject Matter
No claim allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600
Prosecution Insights