Prosecution Insights
Last updated: September 19, 2026
Application No. 17/267,299

PRECISELY ENGINEERED STEALTHY MESSENGER RNAS AND OTHER POLYNUCLEOTIDES

Final Rejection §102§112
Filed
Feb 09, 2021
Priority
Aug 09, 2018 — provisional 62/716,451 +2 more
Examiner
EBBINGHAUS, BRIANA NOEL
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Kernal Biologics Inc.
OA Round
4 (Final)
62%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allowance Rate
45 granted / 72 resolved
+2.5% vs TC avg
Strong +63% interview lift
Without
With
+62.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
52 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
32.9%
-7.1% vs TC avg
§102
15.9%
-24.1% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 72 resolved cases

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 1, 3-5, 8-18, and 28-31 are pending. Claims 3, 5, 8-18 and 29-31 are withdrawn. Claims 1, 4, and 28 are under examination. Withdrawn Claim Objections The objection to claim 1 as set forth in the previous office action is withdrawn in view of Applicant’s amendments. Response to Summary of Applicant Initiated Examiner Interview Applicant presents a summary of the interview with Inventors Erkul, and Yilmaz, Jeff Ozdemir and Applicant's representatives Brenda Hershbach Jarrell and Michael L. Vetter on December 12, 2025 (pg. 6). It is noted that Applicant states “With respect to the engineered polynucleotide, Applicant's representatives noted that the Office Action stated "[t]he presence of negative limitation together with a Markush list makes it unclear whether the negative limitation applies to all of the listed motifs, or whether it applies to the listed motifs in the alternative." Applicant's representatives noted that Applicant would like to make clear that the engineered polynucleotide of the present claims has each of the recited sequence motifs removed.” (pg. 6). Specifically, Applicant notes “Examiners agreed that reciting that the engineered polynucleotide lacks any instance of the recited sequence motifs would clarify this language” (pg. 6). In response, while potential amendments were discussed, and the Examiners commented on language that may appear to work, no agreement was reached on specific language to address the intended claim interpretation. Furthermore, as discussed further below, it is noted that Applicant’s claim still specifically recites that the engineered polynucleotide lacks (a negative limitation) together with a list of alternatives (KNUNDK, KWUNDK, UNUNDK, or KNUNUK sequence motif, or a complement thereof) and Applicant’s amendment does not address this specific issue. It is noted that Applicant states “Finally, the Examiner's noted that the Written Description rejection may not be addressed by the amendments discussed above. Specifically, the Examiner's summarized the position laid out in the Office Action that the claims include a large number of sequences and the application does not appear to provide an adequate number of species such that one of ordinary skill in the art could arrive at the presently claimed genus. Applicant's representatives noted that the Application demonstrates, even as compared to existing methods, the presently claimed removal of any instance of the recited motifs reduces immunogenicity of a polynucleotide. Applicant's representatives further noted that the application supported a structure-function relationship between the engineered polynucleotide and reduction of immunogenicity.” (pg. 7). Specifically, Applicant states “To support this position Examiner's recommended adding additional functional language to the claims, for example, how the immunogenicity could be tested” (pg. 7). In response, while potential amendments were discussed, and the Examiners commented on functional language possibly helping support the position, the Examiner notes that no agreement was reached on specific functional language to support this position. Maintained Claim Rejections - 35 USC § 112(a) Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 4, and 28 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The purpose of the written description requirement is to ‘ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1353-54 (Fed. Cir. 2010) (en banc) (quoting Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 920 (Fed. Cir. 2004)). To satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163.04. For a claim to a genus, a generic statement that defines a genus of substances by only their functional activity does not provide an adequate written description of the genus. Reagents of the University of California v. Eli Lilly, 43 USPQ2d 1398 (CAFC 1997). To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include a disclosure of a representative number of species to describe the complete structure of the claimed genus and/or disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof. Breadth of the Claims Instant claims encompass: Reference polynucleotides that encode a polypeptide and include one or more sequence motifs selected from the group consisting of KNUNDK, UCW, UNU, UWN, USU, KWUNDK, UNUNDK, and KNUKUK. The broadest reasonable interpretation of the scope of this genus is all possible reference polynucleotides that encode a polypeptide off all possible lengths that encode polypeptides, as long as they include one or more sequence motifs selected from the group consisting of KNUNDK, UCW, UNU, UWN, USU, KWUNDK, UNUNDK, and KNUNUK. Furthermore, instant claims encompass “complements thereof” which can include all possible sequences that can hybridize at any stringency to one or more of the claimed motifs, which includes a large number of structurally and functionally distinct sequences that encode a large number of structurally and functionally distinct engineered polynucleotides that differs from that of the reference polynucleotide in that it lacks any instance of KNUNDK, KWUNDK, UNUNDK, or KNUNUK sequence motif, or a complement thereof. The broadest reasonable interpretation of the scope of this genus is all possible engineered polynucleotides that correspond to the above reference polynucleotides and do not have any instance of KNUNDK, UCW,UNU, UWN, USU, KWUNDK, UNUNDK, or KNUNUK motifs Furthermore, instant claims encompass “complements thereof” which can include all possible sequences that can hybridize at any stringency to one or more of the claimed motifs, which includes a large number of sequences. Furthermore, instant claims require the function that the engineered polynucleotide has reduced innate immunogenicity relative to the reference polynucleotide as reflected in activity of secreted embryonic alkaline phosphatase (SEAP) measured 24 hours after transfection of a polynucleotide into HEK293 cells that express TLR8 and contain a reporter plasmid encoding SEAP. This appears to be an inherent property that results from removing one or more KNUNDK, UCW,UNU, UWN, USU, KWUNDK, UNUNDK, or KNUNUK sequence motifs and therefore this functional language would apply to all of the engineered nucleotides discussed above. The reference and engineered polynucleotides above include all possible polynucleotides of all possible lengths from all possible organisms that encode a polypeptide, as long as the reference sequence has one or more of the recited motifs. This includes an unfathomable number of structurally diverse sequences that encode an unfathomable number of functionally diverse polypeptides. Disclosure of Structure Regarding the reference and engineered polynucleotides, Applicant discloses 1 specific reference polynucleotide (SEQ ID NO: 1 wildtype eGFP mRNA pg. 33), and 1 specific engineered nucleotide (SEQ ID NO: 3 Low Motif eGFP mRNA KNUNDK removed Aequorea vicotoria eGFP coding sequence pg. 35) that corresponds to said reference polynucleotide. Structure/Function Correlation Regarding the reference and engineered polynucleotides, as stated above, these encompass an unfathomable number of structurally diverse polynucleotides that encode an unfathomable number of structurally distinct proteins. As an example of one of these unfathomably large number of sequences, Applicant is directed to the art of record Schlake et al. (WO-2015/062738 -A1; see IDS filed 21st, February, 2024; henceforth “Schlake”). Schlake discloses a reference polynucleotide for Wildtype mRNA sequence R873 coding for Photinus pyralis luciferase; pg. 12-13; Figure 1; SEQ ID NO: 1) that encodes a polypeptide and includes 3 KNUNDK (GAUAUG) motifs (3 within its polypeptide-coding sequences). This sequences is structurally distinct the reference polynucleotide disclosed by Applicant (instant SEQ ID NO: 1 wildtype eGFP mRNA pg. 33), and each of these encode functionally distinct proteins (Photinus pyralis luciferase versus GFP). Therefore, the unfathomable number of sequences claimed by Applicant clearly encompasses structurally and functionally distinct embodiments. Because Applicant has not provide a nexus between the claimed sequences structure and function, one of ordinary skill would not be able to envision the requisite structural requirements of instant claims. Conclusion Therefore, the examiner concludes there is insufficient written description support for the instantly claimed genera of reference and engineered polynucleotides. Specifically, Applicant disclosed one species of reference polynucleotide and one species of engineered polynucleotide. One species example is not representative of such a diverse genus as the claimed reference and engineered polynucleotides which, as discussed above, encompass an unfathomable number of structurally and functionally diverse sequences. As such, one of ordinary skill in the art could not envision all the embodiments that fall outside of the description provide by the specification and the art, and Applicant has not shown possession of the invention. Response to Arguments Applicant’s arguments, filed 22nd, December, 2025, have been fully considered but are not found persuasive. Applicant argues “Applicant submits the present application provides one of skill examples sufficiently demonstrating the steps required to arrive of presently claimed engineered polynucleotide. The present examples demonstrate targeted removal, as amply described in the specification, of recited sequence motifs is superior with respect to reduction of immunogenicity relative to other methods known in the art. Applicant submits one of skill would readily recognize the presently described targeted removal is applicable, without undue or burdensome experimentation, to any polynucleotide” (pg. 8). Applicant further argues the present application describes a strong structure/function relationship (pg. 8). Applicant argues “the application clearly lays out the structure of the presently claimed engineered polynucleotide and how the claimed structure is achieved” (pg. 8). Applicant argues “Applicant submits the present claims encompass a structure that results in a particular function that is well described in the specification” (pg. 8). In response, the rejection of record is a rejection under 35 U.S.C. 112a written description. The ability to make and use the claimed nucleotide ( Applicant’s argument that “recognize the presently described targeted removal is applicable, without undue or burdensome experimentation, to any polynucleotide” as well as “the application clearly lays out the structure of the presently claimed engineered polynucleotide and how the claimed structure is achieved”) is pertinent to questions of enablement and does not remedy the written descriptions issues discussed above. Applicant is reminded that the written description requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly and Co., 598 F.3d 1336, 1341, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) (If Congress had intended enablement to be the sole description requirement of § 112, first paragraph, the statute would have been written differently.) Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562, 19 USPQ2d 1111, 1115 (Fed. Cir. 1991) (see MPEP 2161 (II)). While one of ordinary skill make be enabled to make and use the claimed polynucleotides from the methods discussed in the specification, the breadth of the claims still encompasses an unfathomably large genus of structurally and functionally distinct polynucleotides and Applicant has shown possession of only one species of engineered polynucleotide. Instant claims are drawn to an unfathomably broad genus of polypeptides, as discussed above, Applicant is directed to MPEP 2163 II which states that for each claim drawn to a genus, the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see i)(A) above), reduction to drawings (see i)(B) above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus) (MPEP 2163 II). These are discussed above. In brief, Applicant discloses actual reduction to practice of one species, and no nexus is provided in the instant disclosure between the structure of the claimed polynucleotide and the unfathomably broad genus of nucleotides. In the instant case, as discussed above, Applicant discloses only one species of engineered polynucleotide, which is not a sufficient number of species to show possession of the unfathomably broad genus of polynucleotides. Applicant is directed to MPEP 2163 which states that a "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that "only describe[d] one type of structurally similar antibodies" that "are not representative of the full variety or scope of the genus."). The disclosure of only one species encompassed within a genus adequately describes a claim directed to that genus only if the disclosure "indicates that the patentee has invented species sufficient to constitute the gen[us]." See Enzo Biochem, 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) ("[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated."). "A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed." In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004). MPEP 2163 further states the Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 "merely by clearly describing one embodiment of the thing claimed." LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005). In the instant case, because Applicant’s claims encompass an unfathomably large number of structurally and functionally distinct polypeptides, that encode an unfathomable number of structurally and functionally distinct amino acids, the 1 species disclosed by Applicant does not indicate that the patentee has invented species sufficient to constitute the genus because the one species of nucleotide disclosed by Applicant, which encodes GFP, is not representative of the functionally and structurally diverse genus of nucleotides encompasses by instant claims, which encompasses all possible nucleotides that encode polypeptides and meet the criteria above, that are functionally distinct from GFP. Maintained Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 4, and 28 remain rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the engineered polynucleotide “lacks any instance of a KNUNDK, KWUNDK, UNUNDK, or KNUNUK sequence motif or complement thereof” The presence of negative limitation (“lacks”) together with a list of alternative (“or”) makes it unclear whether the negative limitation applies to all of the listed motifs, or whether it applies to the listed motifs in the alternative. Furthermore, it is unclear whether the negative limitation refers to all instances of specific species of the claimed motifs, or the full genus of claimed motifs (e.g. whether the lack of just one version of a KNUNDK motif, such as “gauaug” or all versions of KNUNDK motifs are required). The dependent claims are included in the basis of this rejection because they do not clarify this issue. Claim Interpretation Due to the 112b issues identified above, for the sake of compact prosecution, the claims identified with 112 issues above are being examined against the prior art and double-patenting as follows: Instant claims are interpreted as requiring the lack of any instance of the listed motifs in the alternative for each specific motif of the claimed genera of motifs. In other words, an engineered polynucleotide that lacked any instance of one specific KNUNDK, KWUNDK, UNUNDK, or KNUNUK motif would read on instant claims. Response to Arguments Applicant’s arguments, filed 22nd, December, 2025, have been fully considered but are not found persuasive. Applicant argues “As discussed with the Examiner's, the present claims have been amended to recite that the engineered polynucleotide lacks any instance of any of the recited sequence motifs; i.e., the engineered polynucleotide does not contain any of the recited sequence motifs. Accordingly, Applicant submits the present claims are definite” (pg. 8-9). In response instant claims are still indefinite because they still recite the presence of negative limitation together with a list of alternatives, which makes it unclear whether the negative limitation applies to all of the listed motifs, or whether it applies to the listed motifs in the alternative, as stated above. The Examiner notes that while claim 1 was amended, the specific issue of the negative limitation together with a list of alternatives was not changed in this amendment. Examiner’s Remark The Examiner notes that there has been discussion on the record with the regard to the breadth of the claimed engineered polynucleotide, which requires the limitation that “the engineered polynucleotide' s sequence differs from that of the reference polynucleotide in that it lacks any instance of a KNUNDK, KWUNDK, UNUNDK, or KNUNUK sequence motif, or a complement thereof” as presently claimed. It is noted that based on the record, it appears that Applicant intends to claim that the engineered polynucleotide lacks all instances of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs and all instances of complements of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs (see “Applicant would like to make clear that the engineered polynucleotide of the present claims has each of the recited sequence motifs removed” pg. 6). However, as discussed above, Applicant’s claims still present definiteness issues and encompass broader embodiments including requiring the lack of any instance of the listed motifs in the alternative for each specific motif of the claimed genera of motifs (an engineered polynucleotide that lacked any instance of one specific KNUNDK, KWUNDK, UNUNDK, or KNUNUK motif would read on instant claims). To clearly claim that the engineered polynucleotide lacks all instances of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs and all instances of all complements of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs, some recommended language for the engineered polynucleotide is below. “wherein the engineered polynucleotide' s sequence differs from that of the reference polynucleotide in that it lacks any instance of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs and complements thereof” Another option would be as follows: “wherein the engineered polynucleotide' s sequence differs from that of the reference polynucleotide in that it lacks all instances of KNUNDK, KWUNDK, UNUNDK, and KNUNUK sequence motifs and complements thereof” The examiner notes that this suggestion would overcome only the claim interpretation issue and 112b issue only and the other rejections of record will require additional consideration. It is additionally noted that any amendments made require the assessment of the entire claim, which may present additional issues. Maintained Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 4, and 28 remain rejected under 35 U.S.C. 102(a)(1) as being anticipated by Schlake et al. (WO-2015/062738 -A1; see IDS filed 21st, February, 2024; henceforth “Schlake”). Regarding claim 1, Schlake discloses an engineered polynucleotide (SEQ ID NO: 3 C-enriched mRNA sequence R2103; pg. 12-13; Figure 3) whose sequence corresponds to that of a reference oligonucleotide (Wildtype mRNA sequence R873 coding for Photinus pyralis luciferase; pg. 12-13; Figure 1; SEQ ID NO: 1) that encodes a polypeptide and includes three KNUNDK (GAUAUG) motifs (3 within its polypeptide-coding sequences, except that the engineered polynucleotide lacks any instance of the KNUNDK motif GAUAUG of (3) but still encodes the polypeptide (see also pg. 2, 31-32, and 59; Figs. 8-11); Field of the Invention; Summary of the Invention; See attached Schlake_Alignment_3_7_24.pdf, relevant portions are pasted below ). Alignment: SCHLAKE, et al. WO 2015/062738 A1 GAUAUG (instant SEQ ID NO 3) EMBOSS alignment, Top Sequence=Reference, Bottom Sequence= Engineered EMBOSS_001 201 cguucgguuggcagaagcuaugaaacgauaugggcugaauacaaaucaca 250 |||.||..|.||.||.||.|||||.||.||.||.||.||.||.||.|||. EMBOSS_001 201 cguccgccucgccgaggccaugaagcgcuacggccucaacaccaaccacc 250 EMBOSS_001 751 caucacgguuuuggaauguuuacuacacucggauauuugauauguggauu 800 ||.|||||.||.||.|||||.||.||.|||||.||..|.||.||.||.|| EMBOSS_001 751 caccacggcuucggcauguucaccacccucggcuaccucaucugcggcuu 800 EMBOSS_001 999 gguugccaagagguuccaucugccagguaucaggcaaggauaugggcuca 1048 .||.||||||.|.|||||.||.||.||.|||.|.||.||.||.||.|||| EMBOSS_001 999 cgucgccaagcgcuuccaccuccccggcauccgccagggcuacggccuca 1048 Regarding claim 1, the protein encoded by the engineered polynucleotide of Schlake has the same amino acid sequence as that of the protein encoded by the reference polynucleotide (Photinus pyralis luciferase). Regarding claim 1, it is noted that Schlake discloses all the structural limitations of instant claims and therefore the nucleotide disclosed by Schlake would meet the functional limitation that (ii) the engineered polynucleotide has reduced innate immunogenicity relative to the reference polynucleotide as reflected in activity of secreted embryonic alkaline phosphatase (SEAP) measured 24 hours after transfection of a polynucleotide into HEK293 cells that express TLR8 and contain a reporter plasmid encoding SEAP. Additionally, is noted that the Schlake discloses that the nucleotide has reduced immunogenicity ( abstract; pg. 7 1st para.; pg. 8 3rd para.; pg. 9 2nd – 3rd and 5th para.; pg. 10 2nd-4th para.; pg. 12 3rd para.; pg. 27 2nd para.; pg. 29 2nd- 4th para.; pg. 56 3rd para.; claims 6-8 and 12), and therefore would meet this requirement. Regarding claim 4, further to the discussion of claim 1 above, Schlake discloses the engineered polynucleotide is RNA (pg. 1, 10; Title; Abstract; Field of the Invention; Summary of the Invention). Regarding claim 28, further to the discussion of claim 1 above, Schlake discloses a pharmaceutical composition comprising the engineered polynucleotide (pg. 10-11). Accordingly, Schlake anticipates instant claims. Response to Arguments Applicant’s arguments, filed 22nd, December, 2025, have been fully considered but are not found persuasive. Applicant argues “Invention; Summary of the Invention;)." Applicant submits, as noted in the Office Action response filed April 17, 2025, SEQ ID NO. 3 of Schlaake still contains 30 KNUNDK motifs. The engineered polynucleotide of the present claims lacks any instance of KNUNDK as well as any instance of the other recited sequence motifs. Accordingly, Schlake does not disclose each and every element of the present claims” (pg. 9). In response, this is not found persuasive because Applicant is not appreciating the broadest reasonable interpretation of the claims. As discussed above (see claim interpretation above), instant claims encompass the lack of any instance of the listed motifs in the alternative for each specific motif of the claimed genera of motifs (In other words, an engineered polynucleotide that lacked any instance of one specific KNUNDK, KWUNDK, UNUNDK, or KNUNUK motif would read on instant claims) because the motifs are listed in the alternative. Therefore the prior art of Schlake anticipates instant claims for the reasons stated above because it lacks any instance of the KNUNDK motif GAUAUG (lacks any instance of “a” KNUNDK sequence motif of GAUAUG ) relative to the reference polynucleotide. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. No claim is allowable. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to BRIANA N EBBINGHAUS whose telephone number is (703)756-4548. The examiner can normally be reached M-F 9:30 AM to 5:30 PM ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571) 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIANA N EBBINGHAUS/Examiner, Art Unit 1632 /VALARIE E BERTOGLIO/Primary Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Show 3 earlier events
Oct 18, 2024
Final Rejection mailed — §102, §112
Jan 22, 2025
Examiner Interview Summary
Apr 17, 2025
Request for Continued Examination
Apr 23, 2025
Response after Non-Final Action
Jun 24, 2025
Non-Final Rejection mailed — §102, §112
Dec 12, 2025
Examiner Interview Summary
Dec 22, 2025
Response Filed
Apr 21, 2026
Final Rejection mailed — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735720
GENE EDITING OF MONOGENIC DISORDERS IN HUMAN HEMATOPOIETIC STEM CELLS -- CORRECTION OF X-LINKED HYPER-IGM SYNDROME (XHIM)
5y 9m to grant Granted Sep 15, 2026
Patent 12698513
CRISPR COMPOSITIONS AND METHODS FOR PROMOTING GENE EDITING OF RIBOSOMAL PROTEIN S19 (RPS19) GENE
5y 0m to grant Granted Aug 04, 2026
Patent 12680081
HUMAN INDUCED PLURIPOTENT STEM CELL LINE TRANSFORMED WITH FLUORESCENT PROTEIN-LABELED CYTOCHROME P450 AND AHR MODULATOR SCREENING METHOD USING SAME
3y 7m to grant Granted Jul 14, 2026
Patent 12662685
SELF-INACTIVATING TRANSPOSASE PLASMIDS AND USES THEREOF
5y 3m to grant Granted Jun 23, 2026
Patent 12655426
POLYPEPTIDES USEFUL FOR GENE EDITING AND METHODS OF USE
4y 11m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
62%
Grant Probability
99%
With Interview (+62.7%)
3y 11m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 72 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month