DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 11/24/2025. Claims 1-2, 4, 9-13 and 27 are currently pending.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Objection
Claim 4 is objected to because of the following informalities: The claim recites, “The method of claim 1, comprising”. This is grammatically incorrect. Claim 1, from which it depends, already recites administering SEQ ID NO: 2, which is one of the nucleic acids recited in claim 4. A more grammatically correct claim structure to clearly further limit claim 1 would be, “The method of claim 1, further comprising”. Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 2 and 27 are rejected under 35 U.S.C. 103 as being unpatentable Perdigoto et al. (of record) in view of over WIPO Publication 2011/130426 A2 to Hernando (of record, hereinafter Hernando).
Perdigoto et al. teach methods of treating, reducing risk of development or progression of, or reducing symptoms of Type 1 diabetes (hereinafter T1D) or multiple sclerosis (hereinafter MS) comprising administering therapeutics to induce the expansion of Tregs:
Regulatory T cells (Tregs) control unwanted immune responses, including those that mediate tolerance to self as well as to foreign antigens…A number of immune therapies, such as rapamycin, IL-2, and anti-T cell antibodies, are able to induce Tregs.(§Abstract)
rapamycin, which inhibits PI3K/AKT signaling through its direct interaction with the mTORC1 complex enhances Treg expansion and survival…Administration of rapamycin in NOD mice, a model of T1DM, resulted in prevention of diabetes…due to expansion of Tregs (p. 5 §Rapamycin)
NOD mice treated with low-dose IL-2 showed increase in Tregs and reversal or prevention of diabetes. In an EAE mouse model of multiple sclerosis, IL-2 treatment resulted in restoration of FOXP3 expression, Treg stability, and prevention of autoimmunity [p. 5 §Interleukin-2]
oral anti-CD3 could induce Tregs in humans (p. 6 CD3 Monoclonal Antibodies)
Because of their central role in regulating immune tolerance and modulating immune responses, manipulation of Tregs represents a clear target for treatment of unwanted immune responses. Contrary to the strategy of immune suppression or cell deletion as a means to curtail responses, treatment with agents that enhance or cellular therapies with Tregs represent a strategy to restore immune tolerance. Trials that have enhanced the number and function of Tregs have shown success in treatment of a variety of conditions (p. 8 §CONCLUSION)
In summary, Perdigoto et al. teach that various agents were known to induce Treg expansion, and that Treg expansion was known to be generally effective at treating a variety of conditions, including but not limited to T1D and/or MS.
Perdigoto et al. do not teach Treg expansion may be induced via administration of a nucleic acid comprising SEQ ID NO: 2.
Hernando teaches that administration of a nucleic acid comprising SEQ ID NO: 2 (i.e., miR-30d, including miR-30d mimics) induces expansion of FoxP3+ Tregs (also relevant to claim 27):
FACS analysis showed that lungs of B16F10/miR-30d injected mice contain significantly more Tregs (p=0.03; FIG. 17A) than the equivalent scrambled controls. [p. 74 ln. 16-19]
supernatants from miR-30d and siGALNT7 promoted T cell differentiation into regulatory T cells (Tregs), as indicated by the number of CD25+GFP+(Foxp3+) cells ( FIG. 19C). [p. 75 ln. 13-14]
Subconfluent B16F10 cells transfected with…miR-30d mimic…were injected intravenously… for all experiments [p. 58 ln 19-22]
[0035] FIG. 1E demonstrates that miR-30d (SEQ ID NO: 9)
The alignment below shows that instant SEQ ID NO: 2 and Hernando’s SEQ ID NO: 9 share 100% full length identity:
RESULT 1
HERNANDO_SEQIDNO9
Query Match 100.0%; Score 22; DB 1; Length 22;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 UGUAAACAUCCCCGACUGGAAG 22
||||||||||||||||||||||
Db 1 UGUAAACAUCCCCGACUGGAAG 22
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of inducing Treg expansion to treat a variety of conditions, as taught by Perdigoto et al., by administering a nucleic acid comprising SEQ ID NO: 2 (mir-30d/SEQ ID NO: 9), to induce Treg expansion, as taught by Hernando. Perdigoto et al. show that the administration of agents (IL-2 and rapamycin) to induce Treg expansion was a known effective therapy for various diseases. Hernando provides an alternative agent known to successfully induce Treg expansion, miR-30d. Based on the combination of Perdigoto and Hernando, the ordinary artisan would have predicted, with a reasonable expectation of success, that miR-30d would have induced Treg expansion.
Response to Arguments
Applicant's arguments filed 11/24/2025 have been fully considered but they are not fully persuasive for the reasons that follow.
Applicant’s arguments that, “One of skill in the art would appreciate that the immune milieu of melanoma differs significantly from that in diabetes, multiple sclerosis, or obesity." of Hernando's disclosure….with no guidance in Hernando that miR-30d…could be used in a disease unrelated to “melanoma or melanoma associated symptoms”…a person of skill in the art would have had no reason to combine Perdigoto and Hernando…and arrive at instant claims 1…with any reasonable expectation of success.” have been considered and are persuasive for the reasons that follow:
Claim 1 is drawn to a method of treating or reducing risk or progression of Type1 diabetes (T1D), multiple sclerosis (MS) or obesity. In the foregoing rejection, Perdigoto is cited to teach that Treg expansion treats type 1 diabetes and MS, while Hernando is cited to teach that miR30-d induces Treg expansion. The prior art makes clear that Treg expansion is effective for treatment type 1 diabetes and MS. The question is: would one having ordinary skill have predicted, with a reasonable expectation of success, that miR-30d would also predictably induce Treg expansion in other milieus besides melanoma, so that administration thereof would be an effective treatment for those diseases?
Further search and consideration of the art supports Applicant’s argument, evidencing that the different roles and gene expression profiles of Tregs in different tissues and diseases were not well-understood but were known to differ widely and unpredictably. Burzyn reviews the diversity of regulatory T cells in nonlymphoid tissues, stating, “There is growing evidence that Treg cells are present in various nonlymphoid tissues in health and disease, that they have a unique phenotype and that their functions go beyond the classical modulation of immune responses.” (Abstract)(Burzyn et al. Regulatory T cells in nonlymphoid tissues. Nature Immunology volume 14, pages1007–1013 (2013).). Burzyn further notes that, “…certain properties make each tissue-resident Treg cell population unique, such as by the expression of specific transcription factors, chemokine receptors or effector molecules; or by a distinct T cell antigen receptor (TCR) repertoire, migration pattern, mechanism of action or targets.”.
The prior art also evidences that miRNA expression profiles differ among Treg populations and between diseases. As one example, De Santis found “23 human miRNAs differentially expressed between…Treg cells from MS patients vs. healthy donors” (Abstract) (De Santis et al. Altered miRNA expression in T regulatory cells in course of multiple sclerosis. Journal of Neuroimmunology. Volume 226, Issues 1–2, 14 September 2010, Pages 165-171.).
Based on the differing roles, functions, and expression profiles (particularly miRNA expression) of differing Treg populations in differing diseases and tissues, as disclosed in the art, it would not have been clear to the ordinary artisan that the Treg expansion induced by miR-30d in melanoma cells, as taught by Hernando, could have been predictably achieved, with a reasonable expectation of success, in other contexts.
In contrast, Claim 2 is drawn to a method of expanding regulatory T cells anywhere in the periphery and/or CNS of a subject who has the recited diseases. The instant specification does not explicitly define “periphery”, but does state on page 1 that, “CD4+ T cells in the periphery migrate to the CNS.” Since these are circulating immune cells, the broadest reasonable interpretation of the term “periphery” encompasses anywhere CD4+ T cells may be found, i.e., throughout the body, including in cancer tissue such as melanoma. The claim does not recite that the subject is in need of the administration. The preamble of the claim merely states the purpose or intended use, i.e., of administration to a particular group of subjects, but this limitation does not result in a manipulative difference, so is not given patentable weight (MPEP 2011.02). Hernando shows that in the specific context of melanoma, mir-30D predictably induces Treg expansion. Therefore, although Hernando does not teach a subject having the recited diseases, Hernando reads on the claimed method of expanding Tregs in a subject by administering the claimed nucleic acid.
Conclusion
Claims 1 and 9-13 are allowed.
Claim 4 is free of the prior art for the reasons discussed above.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.M.Z./Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636