DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restriction/Election
Claims 1-4, 9-10, 15, 23, 25-30, 33-42, 44-66, 69-73, 77 are pending, with claims 35-42, 45-51, 53-55, 71-73, 77 of Group II and IV stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claims 1-4, 9-10, 15, 23, 25-30, 33-34, 44, 52, 56-66, 69-70 are examined in this Action. Claim 52 was rejoined in previous action.
Priority
It is recognized this application claims priority to PCT/US2019/048400 filed on 8/27/2019, which claims benefit of 62/723326, filed on 8/27/2018. All examined claims enjoy the benefit of filing date of ‘326.
Specification
The objection regarding SEQ ID NOs: 61-79 is withdrawn. The Amended specification of 10/03/2025 deletes the sections with SEQ ID NOs: 61-79.
Claim Objections
Objection to claims 1, 8, 12, 13, 14, 19, 20 and 66 is withdrawn. Limitations in claims 1 and 66 with language at issue is deleted. Claims 8, 12, 13, 14, 19, 20 are canceled.
Claim 52 is objected to since it still has the status of “(Withdrawn”) but the claim was indicated as rejoined and examined in previous action. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 4, 9, 10, 13-15, 19-30, 33, 34, 44, 52, 57-66, 69-70, 74-76 -4, 9-10, 12, 15, 23, 25-30, 33-34, 44, 52, 56-66, 69-70 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The prior action had different sections, but have now been combined to address the written description issue associated with “antisense oligomer comprising 10 to 50 linked nucleotides.”
Written description issue with claims 1-4, 9-10, 15, 23, 25-30, 33-34, 44, 52, 56-66, 69-70.
Claim 1 is directed to a modified antisense oligomer (ASO) of 10 to 50 linked nucleotides that targets a target region of a Kit-encoding pre-mRNA and the ASO has a targeting sequence complementary to a target sequence in the Kit-encoding pre-mRNA, such that the oligonucleotide “specifically hybridizes” to the target sequence, and the targeting sequence is at least 80% complementary over its entire length to a same sized portion of contiguous nucleobases in the target sequence. Claim 66 recites an antisense oligomer comprising a sequence selected from the group consisting of SEQ ID NO: 1 and a reverse complement of SEQ ID NO: 28; it is interpreted that ASO comprising a sequence is a full length of reverse complement of SEQ ID NO: 28, which would be a 50 nt. in length sequence.
There is a failure to meet the written description requirement because, while one can at once envision the genus of antisense oligomer comprising 10 to 50 linked nucleotides of a targeting sequence that is at least 80% complementary over its entire length to SEQ ID NO: 28 (cl. 1), or an ASO comprising a sequence that is a full length of reverse complement of SEQ ID NO: 28 (cl. 66), it is not clear which of these will provide the function of specifically hybridizing as required by the claims.
The claimed invention encompasses any modified ASO of at least 10 nucleotides (nt.) with at least 80% complementary to target sequence that “specifically hybridizes” to SEQ ID NO: 28 or an ASO comprising a sequence that is a full length of reverse complement of SEQ ID NO: 28 (cl. 66). SEQ ID NO: 28 is a 50 nt. sequence: language from the Remarks, screen-shot below (pg. 20) provides succinct explanation:
PNG
media_image1.png
101
495
media_image1.png
Greyscale
There is a failure to meet the written description requirement because, while one can at once envision the genus of ASOs of 10-50 nucleotides with a targeting sequence that is at least 80% complementary to a target region of a Kit-encoding pre-mRNA, it is not clear which of these will provide the function of specifically hybridizing to SEQ ID NO: 28, as required by the claims.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, SEQ ID NO: 1 and SEQ ID NO: 2 are the only species (oligomers or targeting sequences) disclosed in the specification. SEQ ID NO: 1 and SEQ ID NO: 2 are exon-splicing oligonucleotides (ESO) targeting exon 4 of human and murine, respectively, c-kit gene product (SEQ ID NO: 1 is also termed KitStop ESO in specification, pg. 11). Further, the examples only provide using KitStop ESO, which is a vivo-morpholino oligomer of 25 nt. and hybridizes to a portion of SEQ ID NO: 28, which is associated with exon 4. While the genus encompasses a modified ASO comprising a targeting sequence that is at least 80% complementary over its entire length to a same sized portion of contiguous nucleobases of SEQ ID NO: 28, the genus encompasses a large number of variants and molecules that have the same activity of hybridizing to SEQ ID NO: 28 and the genus encompasses a large number of variants and molecules that have a different structure, the specification does not describe the complete structure of a representative number of species of the large genus of ASOs of claimed subject matter that hybridizes to SEQ ID NO: 28.
Further the genus is also broad in the terms of how an oligomer is defined. The specification indicates “[o]ligomers of this disclosure include, but are not limited to, primers, probes, antisense compounds, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs” (pg. 25, line 10-12). The functional limitation or inherent results of cl. 2 and 9, and 3 can be interpreted to be contrary to each other. Reduction of expression (cl. 3) can be considered contrary to alteration in splicing (cl. 2, 9) since the mechanisms are different, and, potentially, splicing alteration can be achieved without reduction in protein expression. The specification fails to disclose different structural features, including different oligomer lengths, that would achieve the function across the genus.
It is known by one skilled in the art that modifying the length of splice switching oligonucleotides affects the efficiency of the oligonucleotide. Wu et al. (2011, PLoS ONE, 6, pg. 1-11) disclose that splice switching oligonucleotides have a range of nt. length that are efficient, and the efficiency varies based on the system tested. Wu, in Table 1, indicates testing 15-32 base pair length and demonstrating that increasing or decreasing the length of the oligonucleotide affects the efficiency of the splice switching oligonucleotide (pg. 4); if it is too short (for example 15 or 16 bp) or is too long (>30 bp in length) the efficiency decreases or there is no splice switching. Similarly, Harding et al. (2007, Mol. Ther., 15, 157-166), testing antisense oligonucleotides (AO) of various lengths in mdx myoblasts and primary human myoblasts from patient biopsies, highlight that an “upper limit in optimal length, . .. have to be established on a case-by-case basis” (Abstract), and note in their conclusion, “[s}imply designing an AO of 30 nucleotides will not guarantee induction of exon skipping, and in some cases may be counterproductive” (pg. 164). Here the specification does not disclose, i.e. does not possess, ASOs of different sizes, ranging from 10 to 50 nt. that hybridize with SEQ ID NO: 28.
Next, then, it is determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics (i.e. other than nucleotide sequence), specific features and functional attributes that would distinguish different members of the claimed genus. In the instant case, the specification provides only the studies of SEQ ID NO: 1 (the KitStop ESO) of 25 nt. in length functioning as an ESO (see Ex. 1-8, pg. 48-52). Further, here, the KitStop ESO (SEQ ID NO: 1) skips exon 4 and introduces a frame shift mutation, “which results in an immediate STOP codon and loss of function” (pg. 3, line 11-15; see Fig. 1A).
Next, then, it is determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics (i.e. other than nucleotide sequence), specific features and functional attributes that would distinguish different members of the claimed genus. In the instant case, the only other identifying characteristic is an ASO’s ability to modulate splicing or hybridize to a Kit pre-mRNA. Such a functional limitation cannot be an identifying characteristic for the claimed diverse genus of molecules.
The inventions of claims (dependent claims 2-4, 9-10, 15, 23, 25, -30, 33-34, 44, 52, 56-65, 69-70) require the use of the inventions of Claim 1 and therefore are likewise rejected under 35 U.S.C. 112, first paragraph, as failing to comply with the written description requirement.
Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163).
In conclusion, Applicant’s disclosure of one species of SEQ ID NO: 1, i.e. the KitStop ESO, a vivo-morpholino, of the claimed broad genus is not deemed sufficient to reasonably convey to one skilled in the art that Applicant was in possession of the claimed broad genus at the time the application was filed. Thus, it is concluded that the written description requirement is not satisfied for the claimed genus.
Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163).
Response to Arguments
Applicant's arguments filed 10/03/2025 (“the Remarks”) have been fully considered but they are not persuasive.
It appears the Remarks indicates that since the target region is known (i.e. noted in Table 2) then a skilled artisan “would have no difficult designing other targeting sequences (i.e. oligomers)” (pg. 16-17). (Since the claims have been amended to specifically recite the targeting sequence complementary to SEQ ID NO: 28, the arguments regarding other exons is not addressed here.) The issue is not whether a skilled artisan would have difficulty in designing ASOs comprising targeting sequences, but whether the Applicant is in possession of the broad genus that is claimed. As several references cited note that ASOs of certain length are not capable of causing exon-skipping, possibly due to lack of hybridization. Here, the specification does not possess an ASO of 10 nt. or one of 50 nt. that would “specifically hybridize to the target sequence.”
Thus, the rejection is maintained.
New Matter
Claim 1, 2-4, 6-10, 12-15, 19-29, 32, 34, 43-44, 52, 56, 57-60 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 1(iv) is directed to modifications to an antisense oligomer, while the specification discloses only antisense RNA molecules comprising the recited modifications of claim 1(iv). The newly recited antisense oligomer of claim 1 is broader in scope than the antisense RNA molecules comprising a modification as described in the specification, i.e. the described antisense RNA molecules are only species of the broader genus of the newly recited antisense oligomer of claim 1. Thus, claim 1 and it dependents claims 2-4, 6-10, 12-15, 19-29, 32, 34, 43-44, 52, 56, 57-60 are rejected as reciting new matter.
Response to Arguments
Applicant's arguments filed 10/03/2025 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks point to recitation of modification required in claim 1 and then note that the “language is identical between the claim and the specification, and thus applicant respectfully submits that there appears to be no basis for the Patent Office to assert that claim 1 includes new matter” (pg. 18).
For clarification, the relevant screen-shot of an excerpt from the specification is provided below:
PNG
media_image2.png
223
716
media_image2.png
Greyscale
Here, the specification indicates that only the antisense RNA molecule comprises a modification, and not the broader genus of antisense oligomer, which can be a DNA oligomer, i.e. a primer or a hybrid DNA/RNA oligomer, that can comprise a modification. The broad genus of antisense oligomer is not identical to antisense RNA molecule. Further the claims also indicate that antisense oligomer is understood to be broader than antisense RNA oligomer; claim 30 recites the antisense oligomer is an antisense RNA oligomer, a further limitation of cl. 1; while claim 33 recites a morpholino oligomer.
Thus, the new matter rejection is maintained.
Enablement
Rejection of claims 32 and 43 is withdrawn, the claims are canceled.
35 U.S.C. 112(b):
Rejection of claims 1, 2-4, 6-10, 12-15, 19-26, 29-30, 32-34, 43-44, 52, 56-65, 74-76 is withdrawn. Claim 1 deletes “similarly” language. Claims 74-76 are canceled. Claim 26 is amended to 80% identical.”
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 25, 29, 52 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 25 recites that “the targeting sequence comprises at least 10 contiguous nucleobases identical in sequence to at least 10 contiguous nucleobases in SEQ ID NO: 28” (underline added for emphasis). The targeting sequence cannot comprise 10 contiguous nucleobases identical to SEQ ID NO: 28. The targeting sequence is complementary to the target sequence SEQ ID NO: 28. In the interest of compact prosecution, the term identical is interpreted to mean complementary.
Claims 29, 52 recites the limitation "the target region" in line 7, while the amendment of claim 1 has crossed out “a target region” from claim 1, line 2. There is insufficient antecedent basis for this limitation in the claim. The use of target sequence and target region in the claims creates confusion whether target sequence and target region are the same or are distinct.
In the interest of compact prosecution and for consistency, “region” is interpreted as “sequence.”
Claim Rejections - 35 USC § 102
Rejection of claims in view of Buchardt and rejection of claims in view of Bhat have been withdrawn, while rejection of claims 1, 3, 4, 9-10, 23, 25-27, 29-30, 34, 52, 56 in view of Khvorova is maintained, as noted below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 3, 4, 9-10, 23, 25-27, 29-30, 34, 52, 56 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Khvorova et al. (US Pat. 7691997, issued 04/06/2010, referred as Khvorova).
SEQ ID NO: 1 is gaatgaagcgattcactcacctgac, which targets a portion of SEQ ID NO: 28, a splice donor sequence according to table 3. The specification discloses that “[o]ligomers of this disclosure include, but are not limited to, . . . . . siRNAs” (pg. 25, line 10-12).
Also it is interpreted that a targeting sequence would bind to its inherent target sequence (i.e. “the target sequence” recited in claim 1, line 8).
Khvorova discloses voluminous numbers of siRNA molecules that are used to inhibit protein expression through RNA interference mechanism (Col. 1, line 54-65); and one siRNA duplex comprises of a SEQ ID NO: 1424860: gugagugaauccauacauu. Khvorova discloses that all siRNA duplexes are referred by sense strand (Col. 35, lines 15-17) and preferably each siRNA will be 19 base pairs in length and one strand of each of the siRNAs will be 100% complementary to a portion of the target mRNA (Col. 30, line 1-3); thus the antisense strand of the sense strand SEQ ID NO: 1424860 is 5’ aauguauggauucacucac, a 19 nt. strand (bold sequence is the identical portions between the two sequences) and has 16 nt. matches over a 19 nt. sequence (a 84% match with instant SEQ ID NO: 1 over the same sized portion) and has at least 80% identity over its entire length of SEQ ID NO: 1 (relevant to instant cl. 1, 9, 10, 25, 26, 27). The antisense strand also comprises the exon 4 splice donor sequence (relevant to cl. 1). Khvorova discloses nucleotide modifications at 2’ positions, such as 2’-methyl ribose (Col. 31, line 36). Since the antisense strand of the siRNA duplex meets the structural limitation it will also meet the functional limitations, such as reducing the expression of wild-type or mutant Kit protein, unless the evidence to contrary is provided under MPEP 2112(V) (relevant to instant cl. 3, 4, 13, 14).
Regarding instant cl. 23, 29, 30, 52, the claim recites wherein the target sequence comprises “a sequence at least 90% identical to SEQ ID NO: 28.” Khvorova’s sense strand SEQ ID NO: 1424860 comprises a 11 nt. sequence that is exactly identical to portion of instant SEQ ID NO: 28, thus has a 11 nt. that is 100% identical to portion of instant SEQ ID NO: 28, and as noted above, is indicated as a splice donor sequence of exon 4 (relevant to instant cl. 52).
Regarding instant cl. 56, Khvorova discloses a coupling the polynucleotide to a conjugate or a ligand to facilitate the uptake of the siRNA (Col. 35, line 1-3).
Response to Arguments
Applicant's arguments filed 10/03/2025 (“the Remarks”) have been fully considered but they are not persuasive. Only Khvorova reference is the remaining reference used for the 102 rejection. The Remarks indicate that “there is no disclosure of any siRNAs in Khvorova that includes any such modification, and thus Khvorova does not anticipate instant claim 1” (pg. 20).
The argument is not persuasive.
Below are screen-shots of Col. 11, 12 and 31 of Khvorova’s patent, with paragraphs disclosing nucleotide modifications as bordered text.
PNG
media_image3.png
943
617
media_image3.png
Greyscale
A screen shot of an excerpt from Col. 31:
PNG
media_image4.png
177
329
media_image4.png
Greyscale
The rejection is maintained.
Allowable Subject Matter
No claim allowed.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600