DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 10/07/2025 has been entered.
Amended claims 12-16, 31-32, 35, 37-39, 52 and 54 are pending in the present application.
Applicant elected previously without traverse the Invention of Group I. Applicant also elected previously the following species without traverse: (i) SEQ ID NO: 1; and (ii) AAV9. It is noted that the Examiner has rejoined and examined SEQ ID NO: 13 together with the elected SEQ ID NO: 1.
Claims 31-32, 35, 37-39 and 52 were withdrawn previously from further consideration because they are directed to a non-elected invention.
Accordingly, amended claims 12-16 and 54 are examined on the merits herein with the above elected and rejoined species.
Claim Rejections - 35 USC § 112 (Scope of Enablement)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Amended claims 12, 15-16 and 54 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide having a nucleotide sequence at least 85% identical to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 13, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (“CAG”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein, wherein the polynucleotide encodes a polypeptide having the amino acid sequence of SEQ ID NO: 4; and a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier;
does not reasonably provide enablement for a rAAV particle comprising a full-length complement of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 14 as encompassed by the instant claims. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. This is a modified rejection.
The factors to be considered in the determination of an enabling disclosure have been summarized as the quantity of experimentation necessary, the amount of direction or guidance presented, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art and the breadth of the claims. Ex parte Forman, (230 USPQ 546 (Bd Pat. Appl & Unt, 1986); In re Wands, 858 F.2d 731, 8 USPQ 2d 1400 (Fed. Cir. 1988)).
When read in light of the instant specification, the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients (see at least Summary; particularly paragraph [0004]; and Title of the application). The instant specification is not enabled for the instant broadly claimed invention for the reasons discussed below.
1. The breadth of the claims
The instant claims encompass a recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, or a full-length complement of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter, or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (“CAG”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein; and a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier.
2. The state and the unpredictability of the prior art
At about the effective filing date of the present application (08/30/2018), little was known about a recombinant AAV particle comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4 (470-amino-acid GALT sequence), or a full-length complement of such a polynucleotide for use in a gene therapy treatment of galactosemia as evidenced at least by the teachings of High (WO 01/96587), Fotin-Mleczek et al (US 11,078,247) and Derosa et al (WO 2014/144196).
3. The amount of direction or guidance provided
Apart from disclosing the nucleotide sequence of SEQ ID NO:1 (1140-bp codon optimized GALT nucleotide sequence) and SEQ ID NO:13 (wild-type 1,140-bp GALT nucleotide sequence), each of which encodes the GALT amino acid sequence of SEQ ID NO:4 (470-amino-acid sequence) (see at least Summary; paragraphs [0049]-[0051], [0106], [0128]; and Fig.4); the specification fails to provide sufficient guidance for an ordinary skilled artisan on how to make and use a full-length complement of such a polynucleotide in an artificial genome of a recombinant AAV virus and a pharmaceutical composition comprising the same rAAV virus as encompassed by the instant claims. There is no evidence of record indicating or suggesting that a recombinant AAV virus comprising the full-length complement of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 4 has any GALT activity to reduce or alleviate the toxic galactosemia-induced metabolite galactose-1-phosphate in tissues of a galactosemia patient. Please note that a complement of a polynucleotide molecule encoding a polypeptide is an antisense or non-coding nucleic acid sequence, and it normally does not encode any amino acid sequence. Then how such a rAAV particle comprising a full-length complement of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4 could yield any therapeutic effect in a claimed pharmaceutical composition?
Since the prior art at the effective filing date of the present application failed to provide sufficient guidance regarding to the above issues, it is incumbent upon the present application to do so. Given the state of the prior art discussed above, coupled with the lack of sufficient guidance provided by the present application, it would have required undue experimentation for a skilled artisan to make and use the rAAV particle as claimed broadly.
The physiological art was also recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires:
That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.
Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maizel.).
Accordingly, due to the lack of sufficient guidance provided by the specification regarding to the issues set forth above, the state and unpredictability of the relevant gene therapy art to attain desired therapeutic effects, and the breadth of the instant claims, it would have required undue experimentation for one skilled in the art to make and use the instant broadly claimed invention.
The examiner noted that in the Amendment dated 10/07/2025 (middle of page 5), Applicant failed to address the issue “a full-length complement thereof”. Please refer to the above modified rejection for details.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 12-16 and 54 are rejected under 35 U.S.C. 103 as being unpatentable over High (WO 01/96587) in view of the GenBank Accession No. AY408624, Davidsohn et al (WO 2017/201527), Zincarelli et al (Molecular Therapy 16:1073-1080, 2008) and Kobinger et al (US 8,663,981). This is a modified rejection.
The instant claims encompass a recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, or a full-length complement thereof, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein; and a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier.
High already disclosed a recombinant AAV virion (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6) comprising a heterologous nucleic acid sequence that codes for a therapeutic protein/polypeptide that is defective or missing from a recipient cell, including galactose-1-phosphate uridyl transferase (GALT) associated with galactosemia, wherein the heterologous nucleic acid sequence is flanked by one or more AAV ITRs and the expression of the heterologous nucleic acid sequence is under the control of a promoter (e.g., CMV promoter, RSV promoter or other constitutive promoters known in the art) for administering into a subject in need thereof (see at least Summary of the Invention; particularly page 7, first full paragraph; page 8, last two complete sentences; page 10, first full paragraph; page 11, second paragraph; and page 12, last paragraph).
High did not teach specifically at least a recombinant AAV virion comprising: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4, preferably a polynucleotide having a nucleotide sequence at least 85% identical to the nucleotide sequence of SEQ ID NO:13 (1,140-bp wild-type GALT sequence), wherein the polynucleotide is operably linked to a CBA promoter and is flanked by AAV ITR sequences (e.g., each comprises an AAV2 ITR, or one AAV ITR sequence is a scAAV ITR sequence), and b) an AAV9 capsid protein.
Before the effective filing date of the present application (8/30/2018), the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application (see attached sequence search below) was already available in the prior art.
Additionally, Davidsohn et al already taught gene therapy methods for age-related diseases and conditions by increasing a functional protein that can either be intracellular or be secreted providing a therapeutic effect via the use of a recombinant AAV vector/particle (e.g., AAV1, AAV2, AAV3…AAV8, AAV9, AAV10 and others) comprising one or more polynucleotide sequences of interest or transgenes that are flanked by at least one AAV ITRs (see at least Summary; page 8, fourth paragraph; and the section titled “Vectors” on pages 48-53). Davidsohn et al also taught the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles (page 52, last paragraph continues to first paragraph on page 53; and Table 4 on pages 29-31). Davidsohn et al further disclosed that the gene therapy constructs comprise one or more pol II promoters such as the CMV promoter, the β-actin promoter and others (page 54, first paragraph); and that the disclosed viral particles are in the form of a pharmaceutical composition that include a pharmaceutically acceptable carrier (page 55, first full paragraph). In an exemplification, Davidsohn et al further disclosed the use of self-complimentary AAV vectors, and stated “A rate-limiting step for the standard AAV genome involves the second-strand synthesis since the typical AAV genome is a single-stranded DNA template. However, this is not the case for scAAV genomes. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription….Additional advantages of scAAV include increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability and more effective circularization” (page 66, first paragraph).
Moreover, Zincarelli et al already investigated the tropism and kinetics of expression for nine different serotypes of AAV (AAV 1-9 in the form a recombinant vector with each having flanking AAV2 ITRs), packaging the same transgene, produced and purified in the same manner, and injected in mice through the same systemic route (tail vein injection) (Abstract and Figure 1). They found that AAV9 had the best viral genome distribution and highest protein levels, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain (Figure 4). Zincarelli et al stated clearly “AAV8 and AAV9 transduce tissues more ubiquitously than the other serotypes do, with AAV9 having the most robust tissue expression” (page 1078, right column, middle of last full paragraph).
Furthermore, Kobinger et al also taught an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom (see at least Abstract; col. 1, lines 10-31 and lines 45-53; and Figure 3).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of High by also selecting the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase and operably linked to a chicken β-actin (CBA) promoter in a recombinant AAV vector/ particle with the AAV9 capsid protein for galactosemia treatment, as well as using a recombinant scAAV9 particle with a self-complementary AAV ITR; in light of the teachings of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above.
An ordinary skilled artisan would have been motivated to carry out the above modifications because: (i) the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application was already available in the prior art; (ii) Davidsohn et al already taught at least the advantages of using scAAV particles relative to standard AAV particles (e.g., increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability); as well as the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles in gene therapy methods for age-related diseases; (iii) Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain; and (iv) Kobinger et al already taught the use of an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above is indistinguishable and encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claim 13 (elected embodiment of SEQ ID NO: 1) is rejected under 35 U.S.C. 103 as being unpatentable over High (WO 01/96587) in view of the GenBank Accession No. AY408624, Davidsohn et al (WO 2017/201527), Zincarelli et al (Molecular Therapy 16:1073-1080, 2008) and Kobinger et al (US 8,663,981) as applied to claims 12-16 and 54 above, and further in view of Fotin-Mleczek et al (US 11,078,247).
The combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al were presented above. However, none of the cited references teach or suggest using a polynucleotide having a nucleotide sequence at least 85% identical to the nucleotide sequence of SEQ ID NO:1 (1140-bp codon optimized GALT sequence).
Before the effective filing date of the present application (8/30/2018), Fotin-Mleczek et al already disclosed at least the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is 86% identical to SEQ ID NO:1 (an optimized 1140-bp DNA sequence encoding GALT) of the present application, that is suitable for use as a medicament to treat galactosemia (see at least Abstract; particularly col. 28, line 46; col. 103, line 22; SEQ ID NO:17,387 and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skilled artisan to further modify the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al by also selecting a GALT DNA coding sequence corresponding to the 1140-bp mRNA sequence of SEQ ID NO:17,387 of Fotin-Mlezek et al as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase in a recombinant AAV vector/ particle with the AAV9 capsid protein for galactosemia treatment.
An ordinary skilled artisan would have been motivated to further carry out the above modification because Fotin-Mleczek et al already disclosed the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is already 86% identical to SEQ ID NO:1 of the present application (particularly all uracils in the mRNA sequence of SEQ ID NO: 17,387 are replaced by thymines in its corresponding encoding DNA sequence), that is suitable for use as a medicament to treat galactosemia.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al, Kobinger et al and Fotin-Mlezek et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al, Kobinger et al and Fotin-Mlezek et al as set forth above is indistinguishable and encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejections in the Amendment filed on 10/07/2025 (pages 5-13) along with the 1.132 Declaration of Dr. Michael Hughes filed on 02/10/2025 have been fully considered, but they are respectfully not found persuasive for the following reason.
A. Applicant argued basically that the Office cannot use hindsight to reconstruct the claimed invention, with no explicit teachings relating directly to motivation to combine the six discrete, isolated pieces of cited prior art.
With respect to the primary High reference, Applicant argued that this reference only discloses GALT and galactosemia as one of a laundry list of genes and diseases as potential targets for AAV therapy, while the more specific teachings within the specification and the examples relate treatment of clotting diseases and more specifically to the administration of rAAV carrying a transgene encoding Factor IX for treatment of hemophilia B. Applicant also argued that High provides no guidance for development and use of AAV vectors for the wide array of different transgenes and diseases listed in patent application laundry list, and specifically does not provide any guidance relating to the treatment of galactosemia using an AAV vector. With respect to the Fotin-Mleczek reference, Applicant argued that the reference relates to the mRNA delivery of multiple transgenes and does not even mention AAV, and SEQ ID NO: 17,378 is mentioned once in the entire application and out of 78,370 sequences described for the treatment of hundreds of different diseases. Applicant also argued that Fortin-Mleczek teaches away from DNA based vector gene therapy by delivery of modified mRNA molecules specifically. Thus, a person of ordinary skill in the art reading Fortin-Mleczek would not have had a motivation to put the disclosed sequences in a viral based therapy. With respect to the Genbank Accession No. AY408624, Applicant argued that since this sequence provides no direction on its use in AAV based gene therapy for the treatment of galactosemia, there would be no reason for a person of ordinary skill in the art to look to this sequence absent motivation from the other cited references. With respect to the Davidsohn reference, Applicant argued that this reference does not mention GALT and galactosemia is not an “age-related disease”, and without any teaching or suggestion to use any of the disclosed elements for the treatment of galactosemia. With respect to the Zincarelli reference, Applicant argued that nowhere in the reference discussing galatosemia, or which serotypes would be best for the administration of a gene therapy for the treatment of galactosemia. Applicant argued that although the Office seems to assume that because AAV9 had high expression of luciferase across multiple tissues, that it would be best, however, even Zincarelli suggests that propensity of AAV9 for transducing testes is an important safety issue for future clinical investigation of this serotype. Thus, Zincarelli simply does not provide support for the selection of an AAV9 serotype for the treatment of galactosemia. With respect to the Kobinger reference, Applicant argued that the reference does not address regulatory sequences optimal for administration of a gene therapy for the treatment of galactosemia; rather it simply lists a promoter that is capable of driving high levels of gene expression. Accordingly, the Office improperly blends the art together and choosing various components of High, Fotin-Mleczek, GenBank Accession No. AY408624, Davidsohn, Zincarelli and Kobinger using the instant disclosure as a roadmap to construct the impermissible hindsight-driven obviousness rejection. Applicant also cited two reviews relating to the treatment of galactosemia, Timson (Gene 589:133-141, 2016; Exhibit A) and Coelho et al (Journal of inherited metabolic disease 40:325-342, 2017; Exhibit B), both discuss future directions for the treatment of galactosemia and yet neither of them even mention gene therapy. Yet, with High published in 2001 the Office’s assertion that a person of ordinary skill in the art would have started with High and would have been motivated to combine it with the disparate cited references (most of which are not directed to AAV therapy) to arrive at Applicant’s invention is simply wrong. Applicant also argued that the prior art must provide more than a wish or dream, with High was published in 2001 in the early stages of gene therapy, and the first AAV-based gene therapy was not approved until 2017. Additionally, Applicant argued that apart from High, not a single one of the other references (published between 2008 and 2017) refers to the treatment of galactosemia with an AAV gene therapy system, pointing to the fact that the Office is simply picking and choosing the elements of Applicant’s claims based upon hindsights.
First, claims 12-16 are simply drawn to a recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, or a full-length complement thereof, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (“CAG”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein; while claim 54 is directed to a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier.
Second, with respect to Applicant’s argument on impermissible hindsight reconstruction Examiner would like to recite a paragraph from in re Oetiker, 977, F.2d 1443, 1448 (Fed. Cir. 1992).
"[T]here must be some teaching, reason, suggestion, or motivation found "in the prior art" or "in the prior art references" to make a combination to render an invention obvious within the meaning of 35 U.S.C. 103 (1998). Similar language appears in a number of opinions and if taken literally would mean that an invention cannot be held to have been obvious unless something specific in a prior art reference would lead an inventor to combine the teachings therein with another piece of prior art. This restrictive understanding of the concept of obviousness is clearly wrong…. While there must be some teaching, reason, suggestion, or motivation to combine existing elements to produce the claimed device, it is not necessary that the cited references or prior art specifically suggest making the combination…. In sum, it is off the mark for litigants to argue, as many do, that an invention cannot be held to have been obvious unless a suggestion to combine the prior art teachings is found in a specific reference."
Although the cited artisans do not specifically point out a motivation to in their disclosure, an ordinarily skilled artisan would have been able to identify the need for the combination of the teachings without the disclosure of the instant application. It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Please refer to the above modified 103 rejections for more details along with the motivations provided why an ordinary skill in the art would have combined at least the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al to arrive at the presently claimed rAAV virus.
Third, the primary High reference already disclosed a recombinant AAV virion (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6) comprising a heterologous nucleic acid sequence that codes for a therapeutic protein/polypeptide that is defective or missing from a recipient cell, including galactose-1-phosphate uridyl transferase (GALT) associated with galactosemia, wherein the heterologous nucleic acid sequence is flanked by one or more AAV ITRs and the expression of the heterologous nucleic acid sequence is under the control of a promoter (e.g., CMV promoter, RSV promoter or other constitutive promoters known in the art) for administering into a subject in need thereof (see at least Summary of the Invention; particularly page 7, first full paragraph; page 8, last two complete sentences; page 10, first full paragraph; page 11, second paragraph; and page 12, last paragraph). This is not a hope for constructing a recombinant AAV comprising a nucleotide sequence encoding a wild-type GALT that is useful for galactosemia treatment. The teachings of High are not necessarily limited only to rAAV virions that are useful for the treatment of clotting diseases, or more specifically a rAAV virion comprising a transgene encoding Factor IX for treatment of hemophilia B. Please also note that similar to Galactosemia (defective or missing a GALT gene), clotting diseases such as hemophilia B also have a defective or missing Factor IX gene. An ordinary skill in the art would readily recognize that the guidance provided by the primary High reference is more than sufficient to prepare a recombinant AAV virion comprising an expression cassette containing a wild-type transgene encoding a GALT protein that is useful for the treatment of galactosemia. Additionally, the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application was already available to the public. Davidsohn et al also taught gene therapy methods for age-related diseases and conditions by increasing a functional protein that can either be intracellular or be secreted providing a therapeutic effect via the use of a recombinant AAV vector/particle (e.g., AAV1, AAV2, AAV3…AAV8, AAV9, AAV10 and others) comprising one or more polynucleotide sequences of interest or transgenes that are flanked by at least one AAV ITRs; the disclosed viral particles are in the form of a pharmaceutical composition that include a pharmaceutically acceptable carrier; the advantages of using scAAV particles relative to standard AAV particles (e.g., increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability which are motivations); as well as the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles in gene therapy methods. Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9 (a motivation), with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain. Finally, Kobinger et al also taught the use of an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom (a motivation).
Fourth, please note that since the above rejection was made under 35 U.S.C. 103 and therefore none of the cited references have to teach every limitation of the instant claims. It is also apparent that Applicant considered each of the cited references in total isolation one from the others and not the specific combination of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above. Once again, the instant claims are composition claims, and not gene therapy method claims that require a particular therapeutic efficacy. Furthermore, the standard under 35 U.S.C. 103 is a “reasonable’ expectation of success.
Fifth, Zincarelli et al stated “AAV8 and 9 transduce tissues more ubiquitously than the other serotypes do, with AAV9 having the most robust tissue expression. AAV9 showed low levels of luciferase protein expression and genome copy numbers in the brain and testes. The expression in the testes is an important safety issue for future clinical investigation of this serotype” (page 1078, right column, last paragraph). Please note that safety issue is not a factor involved in the determination of obviousness, particularly the instant claims are simply drawn to a recombinant AAV particle comprising components (a)-(b) as recited in independent claim 12.
Sixth, the absence of mentioning gene therapy for galactosemia treatment in both the reviews of Timson and Coelho et al is irrelevant regarding to the obviousness determination of the claimed recombinant AAV particle, particularly none of the reviews cited or considered any of the cited references in the above 103 rejections. Nor does any of the reviews mention mRNA therapy approach for galactosemia, which was already known in the prior art as evidenced at least by the teachings of Fotin-Mlezek et al and Martini et al (WO 2017/201348; IDS).
Seventh, please note that the obviousness determination for the claimed recombinant AAV particle is assessed in light of the state of the prior art before the effective filing date 08/30/2018 of the present application, and not only in 2001 when the High reference was published. Once again, since the rejection was made under 35 USC 103 none of the supplemental references have to mention about galactosemia treatment. There is no picking and choosing since the above modified 103 rejections have provided motivations why an ordinary skill in the art would have been motivated to modify the teachings of High to arrive at the presently claimed recombinant AAV particle at least in light of the teachings of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above.
Eighth, with respect to the additional citation of the Fotin-Mlezek et al there is no teaching away whatsoever. The reference was cited because Fotin-Mlezek et al already disclosed at least the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is 86% identical to SEQ ID NO:1 (an optimized 1140-bp DNA sequence encoding GALT) of the present application, that is suitable for use as a medicament to treat galactosemia. As set forth in the above modified 103 rejection, it would have been obvious for an ordinary skilled artisan to further modify the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al by also selecting a GALT DNA coding sequence corresponding to the 1140-bp mRNA sequence of SEQ ID NO:17,387 of Fotin-Mlezek et al as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase in a recombinant AAV vector/ particle with the AAV9 capsid protein for galactosemia treatment.
Ninth, in response to applicant's argument that the examiner has combined an excessive number of references (5 or 6 references), reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991).
B. Unexpected Results.
Applicant argued that there are currently no approved drugs or biologic products for the treatment of Type 1 galactosemia, and the invention solves the problem by providing an rAAV that, when administered, provides a sustained, long-term expression of GALT in tissues impacted by the disease, including particularly the CNS. The 1.132 Declaration of Dr. Hughes provides evidence that the claimed invention “unexpectedly” provides sustained GALT expression after a single administration (in two different animal models) of a rAAV comprising hGALT, a variety of tissues, including the brain, resulting in the reduction of toxic metabolites in theses tissues and even amelioration of symptoms of galactosemia also found in humans, including cataract formation and pre-pubertal growth delay. Applicant argued that at the time of filing the present application in 2018, a person of skill in the art would not have had an expectation that AAV particles, as claimed, would be effective for achieving sustained therapeutic levels, particularly in CNS, sufficient to ameliorate symptoms of galactosemia.
First, the concept of constructing a recombinant AAV virion comprising a transgene encoding a wild-type GALT and/or a modified mRNA encoding a wild-type GALT for the treatment of galactosemia (a genetic/metabolic disorder with a defective GALT gene) is already known in the prior art and taught by High and Fotin-Mlezek et al, respectively. Additionally, High stated “AAV, a parvovirus belonging to the genus Dependovirus, has several features not found in other viruses that make it particularly well suited for gene therapy applications. For example, AAV can infect a wide range of host cells, including non-dividing cells. Furthermore, AAV can infect cells from a variety of species. Importantly, AAV has not been associated with any human or animal disease, and does not appear to alter the physiological properties of the host cell upon integration. Finally, AAV is stable at a wide range of physical and chemical conditions, which lends itself to production, storage, and transportation requirements” (page 2, second last paragraph); and “Expression of certain rAAV-delivered transgenes has been shown to have therapeutic effect in laboratory animals; for example, expression of Factor IX was reported to have restored phenotypic normalcy in dog models of hemophilia B (High and Herzog, supra). Moreover, expression of rAAV-delivered VEGF to mouse myocardium resulted in neovascular formation (Su et al. supra), and expression of rAAV-delivered AADC to the brains of parkinsonian monkeys resulted in the restoration of dopaminergic function (Bankiewicz et al., supra)” (page 5, first paragraph). Moreover, Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain; and that AAV1-9 mediated transgene expression was detected 9-months after the first injection (a sustained and stable transgene expression) (see at least Figures 1-2 of Zincarelli). Accordingly, an ordinary skill in the art would have a “reasonable” expectation of success based at least on the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al to arrive at the presently claimed rAAV virus; and such rAAV would be useful to ameliorate at least a symptom of galactosemia in a subject in need thereof. It is noted that Applicant has not provided any objective/factual evidence to support Applicant’s assertion that at the time of filing the present application in 2018, a person of skill in the art would not have had a “reasonable” expectation of success to construct the claimed AAV particles, or that the AAV particles would not be effective for ameliorating at least a symptom of galactosemia in a subject in need thereof via a sustained, rapid-onset and high expression levels of a wild-type GALT in cells of numerous tissues such as liver, heart, lung, muscles and the brain.
Second, the absence of “approved drugs or biologic products for the treatment of Type 1 galactosemia” is not a criterion for the determination of obviousness under 35 U.S.C. 103, particularly for a recombinant adeno-associated viral particle of the present application.
Third, the modified recombinant AAV virion resulting at least from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth in the above modified 103 rejection is indistinguishable from the claimed rAAV particle of the present application. Since the modified recombinant AAV virion has the same structure and components as the claimed rAAV particle of the present application, it necessarily or inherently exhibits the same properties (e.g., sustained GALT expression in a variety of tissues, including the brain; reduction of toxic metabolites and symptoms of galactosemia such as reduction of cataract formation and pre-pubertal growth delay as observed in two different animal models as reported in the 1.132 Declaration of Dr. Hughes) when it is placed in the same requisite environments.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Derosa et al (WO 2014/144196) disclosed the human galactose-1-phosphate uridyl transferase (GALT) mRNA of SEQ: 2 that is 100% identical to SEQ ID NO:13 of the present application (see attached sequence search below).
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Sequence 17387,
Patent No. 11078247
Query Match 86.0%; Score 980; Length 1140;
Best Local Similarity 79.7%;
Matches 909; Conservative 131; Mismatches 100; Indels 0; Gaps 0;
Qy 1 ATGAGCAGAAGCGGCACCGACCCTCAGCAGAGACAGCAGGCCTCTGAAGCCGATGCCGCC 60
|:||||||||||||||||||||| |||||||||||||||||| || ||||| ||||||
Db 1 AUGAGCAGAAGCGGCACCGACCCCCAGCAGAGACAGCAGGCCAGCGAGGCCGACGCCGCC 60
Qy 61 GCTGCCACCTTCAGAGCCAATGACCACCAGCACATCCGGTACAACCCCCTGCAGGACGAG 120
|| ||||||::||||||||| |||||||||||||:| | :|||||||||:||||||||||
Db 61 GCCGCCACCUUCAGAGCCAACGACCACCAGCACAUCAGAUACAACCCCCUGCAGGACGAG 120
Qy 121 TGGGTGCTGGTGTCCGCCCACAGAATGAAGAGGCCTTGGCAGGGCCAGGTGGAACCCCAG 180
:|||:||:||:| |||||||||||:|||||| || :||||||||||||:||| ||||||
Db 121 UGGGUGCUGGUGAGCGCCCACAGAAUGAAGAGACCCUGGCAGGGCCAGGUGGAGCCCCAG 180
Qy 181 CTGCTGAAAACCGTGCCCAGACACGACCCCCTGAACCCTCTGTGTCCTGGCGCCATTAGA 240
|:||:||| ||||:|||||||||||||||||:|||||| |:|:| || |||||||: |||
Db 181 CUGCUGAAGACCGUGCCCAGACACGACCCCCUGAACCCCCUGUGCCCCGGCGCCAUCAGA 240
Qy 241 GCCAACGGCGAAGTGAACCCCCAGTACGACAGCACCTTCCTGTTCGACAACGACTTCCCC 300
||||||||||| |:||||||||||:|||||||||||::||:|::||||||||||::||||
Db 241 GCCAACGGCGAGGUGAACCCCCAGUACGACAGCACCUUCCUGUUCGACAACGACUUCCCC 300
Qy 301 GCCCTGCAGCCTGATGCCCCATCTCCTGGACCTAGCGACCACCCTCTGTTCCAGGCCAAG 360
||||:|||||| || ||||| || || || ||||||||||| |:|::||||||||||
Db 301 GCCCUGCAGCCCGACGCCCCCAGCCCCGGCCCCAGCGACCACCCCCUGUUCCAGGCCAAG 360
Qy 361 TCTGCCAGAGGCGTGTGCAAAGTGATGTGCTTCCACCCTTGGAGCGACGTGACCCTGCCC 420
||||||||||:|:|||| |:||:|:||::|||||| :|||||||||:|||||:||||
Db 361 AGCGCCAGAGGCGUGUGCAAGGUGAUGUGCUUCCACCCCUGGAGCGACGUGACCCUGCCC 420
Qy 421 CTGATGAGCGTGCCAGAGATCAGAGCCGTGGTGGATGCCTGGGCCAGCGTGACAGAAGAA 480
|:||:|||||:||| ||||:||||||||:||:||| |||:|||||||||:||| || ||
Db 421 CUGAUGAGCGUGCCCGAGAUCAGAGCCGUGGUGGACGCCUGGGCCAGCGUGACCGAGGAG 480
Qy 481 CTGGGAGCCCAGTACCCCTGGGTGCAGATCTTCGAGAACAAGGGCGCCATGATGGGCTGC 540
|:||| ||||||:|||||:|||:|||||:|::|||||||||||||||||:||:||||:||
Db 481 CUGGGCGCCCAGUACCCCUGGGUGCAGAUCUUCGAGAACAAGGGCGCCAUGAUGGGCUGC 540
Qy 541 AGCAACCCCCACCCTCACTGTCAAGTGTGGGCCAGCAGCTTCCTGCCCGATATCGCCCAG 600
|||||||||||||| |||:| || |:|:|||||||||||::||:|||||| |:|||||||
Db 541 AGCAACCCCCACCCCCACUGCCAGGUGUGGGCCAGCAGCUUCCUGCCCGACAUCGCCCAG 600
Qy 601 CGGGAAGAGAGAAGCCAGCAGGCTTACAAGAGCCAGCACGGCGAGCCCCTGCTGATGGAA 660
| || ||||||||||||||||| :||||||||||||||||||||||||:||:||:|||
Db 601 AGAGAGGAGAGAAGCCAGCAGGCCUACAAGAGCCAGCACGGCGAGCCCCUGCUGAUGGAG 660
Qy 661 TACTCCAGACAGGAACTGCTGCGGAAAGAACGGCTGGTGCTGACCAGCGAGCACTGGCTG 720
:|| ||||||||| |:||:| | || || | |:||:||:|||||||||||||:|||:|
Db 661 UACAGCAGACAGGAGCUGCUGAGAAAGGAGAGACUGGUGCUGACCAGCGAGCACUGGCUG 720
Qy 721 GTGCTGGTGCCTTTTTGGGCCACATGGCCCTACCAGACCCTGCTGCTGCCTAGAAGGCAC 780
|:||:||:||| :: :||||||| :|||||:|||||||||:||:||:||| ||||| |||
Db 721 GUGCUGGUGCCCUUCUGGGCCACCUGGCCCUACCAGACCCUGCUGCUGCCCAGAAGACAC 780
Qy 781 GTGCGGAGACTGCCTGAGCTGACACCCGCCGAGAGAGATGACCTGGCCAGCATCATGAAG 840
|:| | ||||:||| ||||:||| |||||||||||||| ||||:||||||||:||:||||
Db 781 GUGAGAAGACUGCCCGAGCUGACCCCCGCCGAGAGAGACGACCUGGCCAGCAUCAUGAAG 840
Qy 841 AAACTGCTGACCAAATACGACAACCTGTTCGAGACCAGCTTCCCCTACAGCATGGGCTGG 900
|| |:||:|||||| :|||||||||:|::||||||||||::||||:||||||:||||:||
Db 841 AAGCUGCUGACCAAGUACGACAACCUGUUCGAGACCAGCUUCCCCUACAGCAUGGGCUGG 900
Qy 901 CACGGCGCTCCTACAGGATCTGAGGCTGGCGCCAACTGGAACCACTGGCAGCTGCACGCC 960
|||||||| || || || ||||| |||||||||:||||||||:||||||:|||||||
Db 901 CACGGCGCCCCCACCGGCAGCGAGGCCGGCGCCAACUGGAACCACUGGCAGCUGCACGCC 960
Qy 961 CACTACTACCCCCCACTGCTGAGATCTGCCACCGTGCGGAAGTTCATGGTGGGATACGAG 1020
|||:||:||||||| |:||:|||| |||||||:| | |||::||:||:||| :|||||
Db 961 CACUACUACCCCCCCCUGCUGAGAAGCGCCACCGUGAGAAAGUUCAUGGUGGGCUACGAG 1020
Qy 1021 ATGCTGGCTCAGGCCCAGAGAGATCTGACCCCTGAACAGGCCGCCGAACGGCTGAGAGCA 1080
|:||:||| |||||||||||||| |:|||||| || ||||||||||| | |:||||||
Db 1021 AUGCUGGCCCAGGCCCAGAGAGACCUGACCCCCGAGCAGGCCGCCGAGAGACUGAGAGCC 1080
Qy 1081 CTGCCCGAAGTGCACTACCACCTGGGACAGAAGGACAGAGAGACAGCCACAATCGCCTGA 1140
|:|||||| |:||||:||||||:||| ||||||||||||||||| ||||| |:||||: |
Db 1081 CUGCCCGAGGUGCACUACCACCUGGGCCAGAAGGACAGAGAGACCGCCACCAUCGCCUAA 1140
LOCUS AY408624 1140 bp DNA linear GSS 02-OCT-2013
DEFINITION Homo sapiens GALT gene, VIRTUAL TRANSCRIPT, partial sequence,
genomic survey sequence.
COMMENT This sequence was made by sequencing genomic exons and ordering
them based on alignment.
Query Match 100.0%; Score 1140; Length 1140;
Best Local Similarity 100.0%;
Matches 1140; Conservative 0; Mismatches 0; Indels 0; Gaps 0