DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendment filed on 05/06/2026 has been entered.
Amended claims 12-16, 31-32, 35, 37-39, 52 and 54 are pending in the present application.
Applicant elected previously without traverse the Invention of Group I. Applicant also elected previously the following species without traverse: (i) SEQ ID NO: 1; and (ii) AAV9. It is noted that the Examiner has rejoined and examined SEQ ID NO: 13 together with the elected SEQ ID NO: 1.
Claims 31-32, 35, 37-39 and 52 were withdrawn previously from further consideration because they are directed to a non-elected invention.
Accordingly, amended claims 12-16 and 54 are examined on the merits herein with the above elected and rejoined species.
Response to Amendment
The rejection under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for Scope of Enablement was withdrawn in light of currently amended independent claim 12, particularly with the deletion of the limitation “or a full length complement thereof”.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 12-16 and 54 are still rejected under 35 U.S.C. 103 as being unpatentable over High (WO 01/96587) in view of the GenBank Accession No. AY408624, Davidsohn et al (WO 2017/201527), Zincarelli et al (Molecular Therapy 16:1073-1080, 2008) and Kobinger et al (US 8,663,981).
The instant claims encompass a recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein; and a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier.
High already disclosed a recombinant AAV virion (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6) comprising a heterologous nucleic acid sequence that codes for a therapeutic protein/polypeptide that is defective or missing from a recipient cell, including galactose-1-phosphate uridyl transferase (GALT) associated with galactosemia, wherein the heterologous nucleic acid sequence is flanked by one or more AAV ITRs and the expression of the heterologous nucleic acid sequence is under the control of a promoter (e.g., CMV promoter, RSV promoter or other constitutive promoters known in the art) for administering into a subject in need thereof (see at least Summary of the Invention; particularly page 7, first full paragraph; page 8, last two complete sentences; page 10, first full paragraph; page 11, second paragraph; and page 12, last paragraph).
High did not teach specifically at least a recombinant AAV virion comprising: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4, preferably a polynucleotide having a nucleotide sequence at least 85% identical to the nucleotide sequence of SEQ ID NO:13 (1,140-bp wild-type GALT sequence), wherein the polynucleotide is operably linked to a CBA promoter and is flanked by AAV ITR sequences (e.g., each comprises an AAV2 ITR, or one AAV ITR sequence is a scAAV ITR sequence), and b) an AAV9 capsid protein.
Before the effective filing date of the present application (8/30/2018), the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application (see attached sequence search below) was already available in the prior art.
Additionally, Davidsohn et al already taught gene therapy methods for age-related diseases and conditions by increasing a functional protein that can either be intracellular or be secreted providing a therapeutic effect via the use of a recombinant AAV vector/particle (e.g., AAV1, AAV2, AAV3…AAV8, AAV9, AAV10 and others) comprising one or more polynucleotide sequences of interest or transgenes that are flanked by at least one AAV ITRs (see at least Summary; page 8, fourth paragraph; and the section titled “Vectors” on pages 48-53). Davidsohn et al also taught the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles (page 52, last paragraph continues to first paragraph on page 53; and Table 4 on pages 29-31). Davidsohn et al further disclosed that the gene therapy constructs comprise one or more pol II promoters such as the CMV promoter, the β-actin promoter and others (page 54, first paragraph); and that the disclosed viral particles are in the form of a pharmaceutical composition that include a pharmaceutically acceptable carrier (page 55, first full paragraph). In an exemplification, Davidsohn et al further disclosed the use of self-complimentary AAV vectors, and stated “A rate-limiting step for the standard AAV genome involves the second-strand synthesis since the typical AAV genome is a single-stranded DNA template. However, this is not the case for scAAV genomes. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription….Additional advantages of scAAV include increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability and more effective circularization” (page 66, first paragraph).
Moreover, Zincarelli et al already investigated the tropism and kinetics of expression for nine different serotypes of AAV (AAV 1-9 in the form a recombinant vector with each having flanking AAV2 ITRs), packaging the same transgene, produced and purified in the same manner, and injected in mice through the same systemic route (tail vein injection) (Abstract and Figure 1). They found that AAV9 had the best viral genome distribution and highest protein levels, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain (Figure 4). Zincarelli et al stated clearly “AAV8 and AAV9 transduce tissues more ubiquitously than the other serotypes do, with AAV9 having the most robust tissue expression” (page 1078, right column, middle of last full paragraph).
Furthermore, Kobinger et al also taught an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom (see at least Abstract; col. 1, lines 10-31 and lines 45-53; and Figure 3).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of High by also selecting the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase and operably linked to a chicken β-actin (CBA) promoter in a recombinant AAV vector/ particle with the AAV9 capsid protein for galactosemia treatment, as well as using a recombinant scAAV9 particle with a self-complementary AAV ITR; in light of the teachings of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above.
An ordinary skilled artisan would have been motivated to carry out the above modifications because: (i) the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application was already available in the prior art; (ii) Davidsohn et al already taught at least the advantages of using scAAV particles relative to standard AAV particles (e.g., increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability); as well as the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles in gene therapy methods for age-related diseases; (iii) Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain; and (iv) Kobinger et al already taught the use of an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above is indistinguishable and encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claim 13 (elected embodiment of SEQ ID NO: 1) is still rejected under 35 U.S.C. 103 as being unpatentable over High (WO 01/96587) in view of the GenBank Accession No. AY408624, Davidsohn et al (WO 2017/201527), Zincarelli et al (Molecular Therapy 16:1073-1080, 2008) and Kobinger et al (US 8,663,981) as applied to claims 12-16 and 54 above, and further in view of Fotin-Mleczek et al (US 11,078,247).
The combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al were presented above. However, none of the cited references teach or suggest using a polynucleotide having a nucleotide sequence at least 85% identical to the nucleotide sequence of SEQ ID NO:1 (1140-bp codon optimized GALT sequence).
Before the effective filing date of the present application (8/30/2018), Fotin-Mleczek et al already disclosed at least the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is 86% identical to SEQ ID NO:1 (an optimized 1140-bp DNA sequence encoding GALT) of the present application, that is suitable for use as a medicament to treat galactosemia (see at least Abstract; particularly col. 28, line 46; col. 103, line 22; SEQ ID NO:17,387 and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skilled artisan to further modify the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al by also selecting a GALT DNA coding sequence corresponding to the 1140-bp mRNA sequence of SEQ ID NO:17,387 of Fotin-Mlezek et al as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase in a recombinant AAV vector/ particle with the AAV9 capsid protein for galactosemia treatment.
An ordinary skilled artisan would have been motivated to further carry out the above modification because Fotin-Mleczek et al already disclosed the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is already 86% identical to SEQ ID NO:1 of the present application (particularly all uracils in the mRNA sequence of SEQ ID NO: 17,387 are replaced by thymines in its corresponding encoding DNA sequence), that is suitable for use as a medicament to treat galactosemia.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al, Kobinger et al and Fotin-Mlezek et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al, Kobinger et al and Fotin-Mlezek et al as set forth above is indistinguishable and encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above 103 rejections in the Amendment filed on 05/06/2026 (pages 2-36) along with the 1.132 Declaration #2 of Dr. Michael Hughes filed on 05/06/2026 have been fully considered, but they are respectfully not found persuasive for the following reason.
A. Applicant argued basically that based on the teachings of the High reference, a POSA would not have selected GALT as a transgene to develop recombinant AAV particles, and would not have provided a reasonable expectation that such rAAV particles would provide a successful gene therapy to treat Type I galactosemia.
Specifically, Applicant argued that High only recites GALT in a long list of potential proteins that could be replaced in a cell where it is missing or deficient; and High does not provide any motivation to select GALT among the disclosed 26 genes known to be associated with human disease. Additionally, Applicant argued that the focus of High is gene therapy delivery of Factor IX and other blood coagulation factors, which is significantly different from the use of AAV to deliver non-secreted, ubiquitously expressed enzymes like GALT, which requires a therapy that can express sufficient levels of GALT in a broad variety of cells and tissues. Applicant then relied on the Second Hughes Declaration to explain why, as of August 30, 2018, persons of ordinary skill in the art would have recognized that achieving a successful AAV gene therapy designed to deliver non-secreted proteins (like GALT) would have been substantially more challenging than achieving a successful AAV gene therapy designed to delivery secreted proteins (like Factor IX). This is because a successful gene therapy for Type I galactosemia would require expression of GALT in a sufficient number of cells across a broad variety of target tissues, including the liver, brain, central nervous system, and ovaries, at sufficient levels to reduce the toxic intracellular accumulation of GAL-1-P in those tissues and in the subject overall. This view is confirmed by the review of Demirbas (Metabolism Clinical and Experimental 83: 188-196, 2018; IDS) that is cited by Applicant. Finally, Applicant cited bits and pieces of certain statements made in the 112(a), first paragraph, for Scope of Enablement rejection in the Non-Final Office Action dated 11/06/2025 (now withdrawn due to the deletion of the limitation “a full complement thereof” in currently amended independent claim 12) as admissions that a POSA would not have been motivated by High to develop the claimed AAV particles for delivery of GALT as gene therapy for Type 1 galactosemia.
First, claims 12-16 are simply drawn to a recombinant AAV particle comprising: a) an artificial genome comprising a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO:4, wherein said polynucleotide is operably linked to a chicken β-actin (“CBA”) promoter or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (“CAG”) promoter and is flanked by AAV inverted terminal repeat (ITR) sequences, and (b) an AAV9 capsid protein; while claim 54 is directed to a pharmaceutical composition comprising the same recombinant AAV particle and a pharmaceutically acceptable carrier. The instant claims are composition claims, and not in vivo gene therapy method claims that require any particular therapeutic efficacy, let alone a safe and efficacious gene therapy for the treatment of Type I galactosemia.
The statement “the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients” in the 112(a), first paragraph, for Scope of Enablement rejection (now withdrawn) in the Non-Final Office Action dated 11/06/2025 is incorrect. This is because the as-filed specification stated clearly “In one aspect, a method is provided for introducing a functional GALT enzyme into a cell, comprising contacting the cell with a recombinant polynucleotide and/or AAV vector or a capsid or viral particle containing the same, or a composition as described herein. The contacting can be ex vivo or in vivo” (paragraph [0014]; “A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro” (paragraph [0068]); “A “pharmaceutical composition” is intended to include the combination of an active polypeptide, polynucleotide or antibody with a carrier, inert or active such as a solid support making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo” (paragraph [0098]); and even in the context of gene therapy the instant specification defined the term “an effective amount of an rAAV viral particle” to be an amount sufficient to result in expression of a gene in a subject (paragraph [0103]). Thus, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy.
Second, the above rejections were made under 35 U.S.C. 103 and therefore none of the cited references individually has to teach every limitation of the instant claims. It is also apparent that Applicant considered each of the cited references in total isolation one from the others and at least not the specific combination of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth above.
Third, High stated clearly “The invention further includes the delivery of rAAV virions carrying heterologous nucleic acid sequences comprising the DNA of any desired gene that encodes a polypeptide that is defective or missing from a recipient cell, or that encodes a non-native polypeptide having a desired physiological activity, i.e., a therapeutic effect (e.g., an antibacterial function), or a molecule having an anti-sense (e.g., anti-sense mRNA) or ribozyme function…..More specifically, suitable DNA and associated diseases include, but are not limited to: DNA encoding glucose-6-phosphatase, associated with glycogen storage deficiency type 1A; DNA encoding phosphoenolpyruvatecarboxykinase, associated with Pepck deficiency; DNA encoding galactose-1-phosphate uridyl transferase, associated with galacosemia; DNA encoding phenylalanine hydroxylase, associated with phenylkenouria…” (first half of the second paragraph at page 11”. Additionally, independent claim 1 of the High reference is drawn to a method of administering rAAV virions to a human, wherein at least one rAAV virion comprising a vector further comprising a heterologous nucleic acid sequence encoding any polypeptide, not necessarily limited to a heterologous nucleic acid sequence encoding Factor IX. Thus, the teachings of High are not necessarily limited to gene therapy delivery of Factor IX or other blood coagulation factors or only secreted polypeptides or working examples. Please note that glucose-6-phosphatase, phosphoenolpyruvatecarboxykinase, galactose-1-phosphate uridyl transferase (GALT) and phenylalanine hydroxylase are non-secreted enzymes. Based on the teachings of High, a POSA would readily recognize that High did teach specifically a rAAV virion comprising a polynucleotide encoding GALT that is operably linked to a constitutive promoter and is flanked by AAV ITR sequences. However, the rAAV virion of High differs from the claimed rAAV virion of the present application in that High did not disclose: (i) the polynucleotide of SEQ ID NO: 13 which encodes the human wild-type GALT polypeptide of SEQ ID NO: 4; (ii) the promoter is a chicken β-actin (CBA) promoter or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (CAG) promoter; and (iii) the rAAV virion comprising an AAV9 capsid protein. These missing vector elements were supplemented by the teachings of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al along with the provided motivations for combining these cited references as set forth in the above 103 rejection; and the resulting modified rAAV virions would mediate a sustained, rapid-onset and high level of GALT expression in numerous tissues that include the liver, the heart, the lung, the hamstring and the brain.
Fourth, neither the generic statement “A successful gene therapy approach would need to achieve an adequate gene expression in all of the target tissues, particularly but not exclusively to brain and ovary. This poses a difficult challenge.” in the Demirbas review (left column, fourth paragraph at page 193); nor bits and pieces of certain generic statements made by the Office in the 112(a), first paragraph, for Scope of Enablement rejection (now withdrawn) in the Non-Final Office Action dated 11/06/2025 would dissuade an ordinary skilled artisan from having a reasonable expectation of success to construct the claimed rAAV particle of the present application that is useful for the treatment of galactosemia in light of the teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. Please also note that the standard under 35 U.S.C. 103 is a “reasonable’ expectation of success.
B. Applicant argued that cited secondary references do not remedy the deficiencies of High.
Specifically, Applicant argued that none of Genbank Accession No. AY408624, Zincarelli, Davidsohn, Kobinger, and Fotin-Mleczek is directed to AAV-mediated gene therapy for the treatment of galactosemia; and maintained that the Office’s obviousness rejection is the epitome of an impermissible hindsight reconstruction based on what is disclosed and claimed in the Applicant’s application. With respect to the wild-type human GALT nucleotide sequence with GenBank Accession No. AY 408624, Applicant argued that the mere fact that the sequence of the human GALT gene was known would not have motivated a POSA to develop rAAV virions designed to express non-secreted proteins (like GALT), or have given a person of ordinary skill in the art a reasonable expectation of success that this would provide a successful treatment for Type 1 galactosemia. With respect to Zincarelli, Applicant argued that Zincarelli discloses in vivo expression results of rAAV particles with a number of capsid serotypes and would not have motivated a POSA to select AAV9 in particular as the serotype of choice to deliver a non-secreted protein like GALT for treatment of Type 1 galactosemia; and Zincarelli does not mention GALT or galactosemia, or AAV9 as preferred over other serotypes; and expressly flags a safety concern uniquely AAV9 (robust expression in testes). Applicant also argued that Zincarelli does not provide any information as to which of the serotypes provides for persistent, long-term transgene expression as would be required for an effective gene therapy; coupled with the safety concerns for AAV9 would have motivated a POSA to choose a different AAV serotype as a gene therapy vector for delivery of GALT to treat Type I galactosemia. With respect to Davidsohn, Applicant argued that Davidsohn is directed to gene therapy for age-related diseases, does not mention GALT or Type 1 galactosemia, discloses a variety of serotype and genome options (including AAV2/8 and AAV2/PHP.B) from which the Office has, with the benefit of hindsight, selected the specific options corresponding the claimed AAV particles. Applicant also argued that Davisohn does not address or remedy the safety concerns that would motivate a POSA to choose a non-AAV9 serotype for human gene therapy (as described by Zincarelli). Applicant also argued that Davidsohn’s disclosure of the use of scAAV genomes is limited to Example 3, which describes gene therapy methods to enhance the expression of adiponectin, for which Table 4 of Davidsohn lists AAV2/8 as the proper serotype for delivery; and Davidsohn does not indicate that scAAV genomes should be chosen for expression of other nucleic acids in the Appendices or Tables 1-3. Applicant further argued that prior to August 30, 2018, researchers had expressed concerns regarding the use of scAAV genomes for gene therapy, that include reports that the use of scAAV genomes could increase immune responses as compared to single-stranded AAV (ssAAV) genomes, and that these observations should be taken into consideration during clinical trial design (Rogers et al, J. Transl. Med. 12:1-10; 2014; IDS); and Applicant cited “scAAV gene therapy may carry the risk of inducing an immune response to the transgene through DC antigen presentation unless a cell type-specific promoter is used” (McCarty, Molecular Therapy 16: 1648-1656, 2008; IDS; last sentence of first full paragraph of left column at page 1654), which teaches away from the use of scAAV genomes to deliver GALT, which at the time was thought to require expression in a variety of cells and tissues. With respect to Kobinger, Applicant argued that Kobinger does not measure the in vivo efficacy of the CAG promoter, or compare the in vivo or in vitro efficacy of the disclosed promoter to that of other known promoters; nor Kobinger teaches or suggests that the disclosed CAG should be used to drive the expression of GALT for rAAV-mediated gene therapy. Accordingly, a POSA would not have any motivation to choose the CAG promoter to other known promoters known for “driving high levels of expression” in a gene therapy context, such as the CMV promoter discussed in High, Davidsohn, and Zincarelli; the Rous sarcoma virus promoter disclosed in High, or the hEf1α promoter and other promoters disclosed for use in gene therapy applications of Davidsohn. With respect to Fotin-Mleczek, Applicant argued that Fotin-Mleczek does not teach or suggest SEQ ID NO: 17,387 should be used in a viral vector-based gene therapy system, aside from noting that SEQ ID NO: 17,387 encodes GALT. As such, the combination of High and Fotin-Mleczek, which together disclose thousands of combinations of transgenes and diseases, does not provide any motivation or guidance regarding the use of rAAV vectors to deliver GALT for the treatment of Type I galactosemia, or any expectation that such gene therapy methods would be successful.
First, based on the teachings of High as discussed in Section A above, a POSA would readily recognize that High did teach specifically a rAAV virion comprising a polynucleotide encoding GALT that is operably linked to a constitutive promoter and is flanked by AAV ITR sequences. However, the rAAV virion of High differs from the claimed rAAV virion of the present application in that High did not disclose: (i) the polynucleotide of SEQ ID NO: 13 which encodes the human wild-type GALT polypeptide of SEQ ID NO: 4; (ii) the promoter is a chicken β-actin (CBA) promoter or a CMV early enhancer/chicken β-actin/rabbit β-globin splice acceptor (CAG) promoter; and (iii) the rAAV virion comprising an AAV9 capsid protein. These missing vector elements were supplemented by the teachings of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al. Please also refer to the Office’s responses in Section A above for details.
Second, once again with respect to Applicant’s argument on impermissible hindsight reconstruction Examiner would like to recite a paragraph from in re Oetiker, 977, F.2d 1443, 1448 (Fed. Cir. 1992).
"[T]here must be some teaching, reason, suggestion, or motivation found "in the prior art" or "in the prior art references" to make a combination to render an invention obvious within the meaning of 35 U.S.C. 103 (1998). Similar language appears in a number of opinions and if taken literally would mean that an invention cannot be held to have been obvious unless something specific in a prior art reference would lead an inventor to combine the teachings therein with another piece of prior art. This restrictive understanding of the concept of obviousness is clearly wrong…. While there must be some teaching, reason, suggestion, or motivation to combine existing elements to produce the claimed device, it is not necessary that the cited references or prior art specifically suggest making the combination…. In sum, it is off the mark for litigants to argue, as many do, that an invention cannot be held to have been obvious unless a suggestion to combine the prior art teachings is found in a specific reference."
Although the cited artisans do not specifically point out a motivation to in their disclosure, an ordinarily skilled artisan would have been able to identify the need for the combination of the teachings without the disclosure of the instant application. It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
In this instance, the primary High reference already disclosed a recombinant AAV virion (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6) comprising a heterologous nucleic acid sequence that codes for a therapeutic protein/polypeptide that is defective or missing from a recipient cell, including galactose-1-phosphate uridyl transferase (GALT) associated with galactosemia, wherein the heterologous nucleic acid sequence is flanked by one or more AAV ITRs and the expression of the heterologous nucleic acid sequence is under the control of a promoter (e.g., CMV promoter, RSV promoter or other constitutive promoters known in the art) for administering into a subject in need thereof (see at least Summary of the Invention; particularly page 7, first full paragraph; page 8, last two complete sentences; page 10, first full paragraph; page 11, second paragraph; and page 12, last paragraph). This is not a hope for constructing a recombinant AAV comprising a nucleotide sequence encoding a wild-type GALT that is useful for galactosemia treatment. The teachings of High are not necessarily limited only to rAAV virions that are useful for the treatment of clotting diseases, or more specifically a rAAV virion comprising a transgene encoding Factor IX for treatment of hemophilia B. Please also note that similar to Galactosemia (defective or missing a GALT gene), clotting diseases such as hemophilia B also have a defective or missing Factor IX gene. An ordinary skill in the art would readily recognize that the guidance provided by the primary High reference is more than sufficient to prepare a recombinant AAV virion comprising an expression cassette containing a wild-type transgene encoding a GALT protein that is useful for the treatment of galactosemia. Additionally, the 1140-bp human GALT DNA sequence with the GenBank Accession No. AY408624 that is 100% identical to SEQ ID NO: 13 of the present application was already available to the public. Davidsohn et al also taught gene therapy methods for age-related diseases and conditions by increasing a functional protein that can either be intracellular or be secreted providing a therapeutic effect via the use of a recombinant AAV vector/particle (e.g., AAV1, AAV2, AAV3…AAV8, AAV9, AAV10 and others) comprising one or more polynucleotide sequences of interest or transgenes that are flanked by at least one AAV ITRs; the disclosed viral particles are in the form of a pharmaceutical composition that include a pharmaceutically acceptable carrier; the advantages of using scAAV particles relative to standard AAV particles (e.g., increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability which are motivations); as well as the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles in gene therapy methods. Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9 (a motivation), with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain. Finally, Kobinger et al also taught the use of an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom (a motivation).
Third, it would have been obvious for a POSA to select the wild-type human GALT nucleotide sequence with GenBank Accession No. AY 408624 that is publicly available for constructing a recombinant AAV comprising a nucleotide sequence encoding a wild-type GALT that is useful for galactosemia treatment in the context of the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al.
Fourth, it would also have been obvious for a POSA to select AAV9 capsid protein for a rAAV virion because Zincarelli et al already taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain. Additionally, Zincarelli taught that AAV1-9 mediated transgene expression was detected 9-months after the first injection, which is an indication of a sustained and stable transgene expression (see at least Figures 1-2 of Zincarelli). Zincarelli et al stated “AAV8 and 9 transduce tissues more ubiquitously than the other serotypes do, with AAV9 having the most robust tissue expression. AAV9 showed low levels of luciferase protein expression and genome copy numbers in the brain and testes. The expression in the testes is an important safety issue for future clinical investigation of this serotype” (page 1078, right column, last paragraph). Please note that safety issue is not a factor involved in the determination of obviousness, particularly the instant claims are simply drawn to a recombinant AAV particle comprising components (a)-(b) as recited in independent claim 12. Nevertheless with respect to a safety issue a POSA before the effective filing date of the present application (08/30/2018) would be able to adjust and/or monitor the amount of rAAV9 virions being administered into a subject, given the numerous advantages provided by the use of rAAV9 virions. Moreover, before the effective filing date of the present application (08/30/2018), various groups have successfully constructed and used rAAV9 vectors for in vivo gene therapy applications as evidenced at least by the teachings and claims issued to Donsante et al (US 12,070,510), Hinderer et al (US 10,973,929 and US 11,253,612), and Marsala et al (US 10,688,285).
Fifth, the teachings of Davidsohn are not necessarily limited to the working example 3. Davidsohn et al already taught clearly gene therapy methods for age-related diseases and conditions by increasing a functional protein that can either be intracellular or be secreted providing a therapeutic effect via the use of a recombinant AAV vector/particle (e.g., AAV1, AAV2, AAV3…AAV8, AAV9, AAV10 and others) comprising one or more polynucleotide sequences of interest or transgenes that are flanked by at least one AAV ITRs; the disclosed viral particles are in the form of a pharmaceutical composition that include a pharmaceutically acceptable carrier; the advantages of using scAAV particles relative to standard AAV particles (e.g., increased and prolonged transgene expression in vitro and in vivo, as well as higher in vivo DNA stability which are motivations); as well as the use of pseudotyped rAAV particles comprising the capsid proteins of one serotype (e.g., AAV5) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2), such as the exemplary 2/5 rAAV particles having ITRs from AAV2 and a capsid from AAV5, as well as 2/8 rAAV particles and 2/9 rAAV particles in gene therapy methods. Despite the use of scAAV genomes could increase immune responses as compared to single-stranded AAV (ssAAV) genomes that should be taken into account during clinical trial design, a POSA would still select scAAV genome/particles for the many advantages of scAAV genomes over ssAAV genomes. There is no teaching-away whatsoever by the statement “scAAV gene therapy may carry the risk of inducing an immune response to the transgene through DC antigen presentation unless a cell type-specific promoter is used” (McCarty, Molecular Therapy 16: 1648-1656, 2008; IDS; last sentence of first full paragraph of left column at page 1654) that Applicant cited because this statement refers specifically to the transduction of dendritic cells (DCs) for the purpose of immunotherapy.
Sixth, there is no requirement whatsoever that Kobinger has to measure the in vivo efficacy of the CAG promoter, or compare the in vivo or in vitro efficacy of the disclosed promoter to that of other known promoters. This is because the primary High reference already taught that the expression of the heterologous nucleic acid sequence can be under the control of any promoter, including CMV promoter, RSV promoter or other constitutive promoters known in the art. Kobinger already taught an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom (see at least Abstract; col. 1, lines 10-31 and lines 45-53; and Figure 3). Particularly, the optimized promoter sequence of SEQ ID NO: 1 in pCAGGS∆829-EGFP that is at least 3-fold more active than the non-optimized CAG promoter in pCAGGS-EGFP (see Figure 3); and the instant claims also simply require any CAG promoter. Accordingly, it would have been obvious for a POSA to select at least the optimized promoter sequence of SEQ ID NO: 1 as taught by Kobinger to drive the expression of GALT in the context of the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al. Moreover, before the effective filing date of the present application (08/30/2018), Qin et al (PLoS ONE 5: e10611.doi:10.1371/journal.pone.0010611, 4 pages; 2010) already carried out a systematic comparison of eight commonly used constitutive promoters (SV40, CMV, UBC, EF1A, PGK and CAGG) for mammalian systems; and none of the tested promoters have 2-fold more active than CAGG promoter, let alone 3-fold more active than CAGG promoter (Abstract; particularly Fig. 1).
Seventh, it would have been obvious for an ordinary skilled artisan to further modify the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al by also selecting a GALT DNA coding sequence corresponding to the 1140-bp mRNA sequence of SEQ ID NO:17,387 of Fotin-Mlezek et al as a heterologous nucleic acid sequence that codes for wild-type galactose-1-phosphate uridyl transferase in a recombinant AAV vector/ particle with the AAV9 capsid protein that is useful for galactosemia treatment because Fotin-Mleczek et al already disclosed the 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT that is already 86% identical to SEQ ID NO:1 of the present application (particularly all uracils in the mRNA sequence of SEQ ID NO: 17,387 are replaced by thymines in its corresponding encoding DNA sequence) with a reasonable expectation of success. Fotin-Mleczek disclosed a single 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT, while High did teach specifically a rAAV virion comprising a polynucleotide encoding GALT (associated with galactosemia) that is operably linked to a constitutive promoter and is flanked by AAV ITR sequences. Accordingly, a POSA would not have to pick or choose from thousands of transgenes and diseases as argued by Applicant to arrive at a rAAV virion with a polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO: 1 of the present application (an embodiment of dependent claim 13).
Eighth, please note that the obviousness determination for the claimed recombinant AAV particle is assessed in light of the state of the prior art before the effective filing date 08/30/2018 of the present application, and not only in 2001 when the High reference was published. Once again, since the rejection was made under 35 USC 103 none of the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al individually has to mention about galactosemia treatment. There is no picking and choosing since the above 103 rejections have provided motivations why an ordinary skill in the art would have been motivated to modify the teachings of High to arrive at the presently claimed recombinant AAV particle.
C. Responses to the Office’s arguments regarding to Prima Facie Obviousness in the previous Office Action.
(i) With respect to the issue that the instant claims are simply drawn to a recombinant AAV9 particle comprising the specific elements recited in independent claim 12, with claim 54 is drawn to a pharmaceutical composition comprising said rAAV9 particle and a pharmaceutically acceptable carrier; Applicant argued that the Office’s admission that “the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients” (The 112(a), first paragraph, for Scope of Enablement rejection in the Non-Final Office Action dated 11/06/2025; now withdrawn), and in view of this sole purpose, the consideration of a POSA’s motivation and expectation of success with respect to the combination of the various elements the Office has selected must be taken into account whether a POSA would have found that such a combination would provide an effective and safe rAAV particle for the treatment of Type I galactosemia.
The statement “the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients” in the 112(a), first paragraph, for Scope of Enablement rejection (now withdrawn) in the Non-Final Office Action dated 11/06/2025 is incorrect. This is because the as-filed specification stated clearly “In one aspect, a method is provided for introducing a functional GALT enzyme into a cell, comprising contacting the cell with a recombinant polynucleotide and/or AAV vector or a capsid or viral particle containing the same, or a composition as described herein. The contacting can be ex vivo or in vivo” (paragraph [0014]; “A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro” (paragraph [0068]); “A “pharmaceutical composition” is intended to include the combination of an active polypeptide, polynucleotide or antibody with a carrier, inert or active such as a solid support making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo” (paragraph [0098]); and even in the context of gene therapy the instant specification defined the term “an effective amount of an rAAV viral particle” to be an amount sufficient to result in expression of a gene in a subject (paragraph [0103]). Thus, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy.
(ii) With respect to the Office’s rebuttal to Applicant’s characterization of its obviousness rejection as an improper hindsight reconstruction, Applicant maintained that the Office has failed to provide substantive evidence that the claimed rAAV particles are prima facie obvious and has relied on impermissible hindsight, by working backwards from the elements of the claims to cobble together prior art references that mention the elements that do not provide a meaningful basis to combine those references, for the reasons discussed above for each of the cited references along with the accompanying Declaration #2, that the claimed rAAV particles provide an unexpected efficacious gene therapy for the treatment of Type I galactosemia, at the time when there was no known rAAV-mediated gene therapy for the disease.
It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). The Office has provided substantive reasonings and/or motivations why the claimed rAAV particle is prima facie obvious. Please refer to the Office’s Responses in Sections A-B above for details. The issue of unexpected efficacious gene therapy for the treatment of Type I galactosemia in the accompanying Declaration #2 will be addressed below.
(iii) With respect to the issues that none of the cited references individually has to teach every limitation of the instant claims and the instant claims are composition claims and not gene therapy method claims that require a particular efficacy, Applicant once again refers to the reasons discussed above for each of the cited references, and the Office’s obviousness rejection fails to provide substantive evidence that the claimed rAAV particles are prima facie obvious. Particularly, Applicant argued that the cited prior art references recite a vast number potential elements for combination (e.g., any of the open-ended list of therapeutic transgenes of High; any of the 78,730 different mRNAs of Fotin-Mleczek, any of the promoters of High, Davidsohn, and/or Zincarelli, and any of the AAV serotypes and pseudotypes disclosed in High, Davidsohn, and Zincarelli). In view of the astounding number of possible combinations available in view of the references above, the Office has not pointed to sufficient evidence to show that a POSA would have motivated to select the particular elements required to produce the claimed rAAV particles, or have expected that such a combination would result in a safe and effective treatment for Type I galactosemia (which is the “sole” purpose for such particles).
Once again, the as-filed specification stated clearly “In one aspect, a method is provided for introducing a functional GALT enzyme into a cell, comprising contacting the cell with a recombinant polynucleotide and/or AAV vector or a capsid or viral particle containing the same, or a composition as described herein. The contacting can be ex vivo or in vivo” (paragraph [0014]; “A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro” (paragraph [0068]); “A “pharmaceutical composition” is intended to include the combination of an active polypeptide, polynucleotide or antibody with a carrier, inert or active such as a solid support making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo” (paragraph [0098]); and even in the context of gene therapy the instant specification defined the term “an effective amount of an rAAV viral particle” to be an amount sufficient to result in expression of a gene in a subject (paragraph [0103]). Thus, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy, let alone a safe and effective treatment for Type I galactosemia. The Office has provided substantive reasonings and/or motivations why the claimed rAAV particle is prima facie obvious. Please refer to the Office’s Responses in Sections A-B above for details.
(iv) With respect to Zincarell’s finding that AAV9-alone among the serotypes tested-exhibited expression in the testes, and the Office’s noting that expression in the testes is an important safety issue for future clinical investigation of this serotype is irrelevant to the determination of obviousness because the claims are simply drawn to a recombinant AAV particle comprising the elements recited in independent claim 12; once again Applicant argued that the Office’s admission that the sole purpose of the claimed rAAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients; and in view of this “sole” purpose, the AAV9 safety concerns explicitly raised by Zincadelli, coupled with the lack of a clearly stated preference for AAV9 as a gene therapy vector in Zincarelli, Davidsohn, or any of the cited references, would have motivated a POSA to choose a non-AAV9 serotype as a gene therapy vector for delivery of GALT to treat Type 1 galactosemia; let alone the claimed rAAV9 gene therapy vector to provide a safe and effective treatment for Type 1 galactosemia and/or selecting AAV9 for the purposes of providing sustained expression of a functional GALT protein.
There are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy, let alone a safe and effective treatment for Type I galactosemia (Please also refer to the Office’s responses above). Zincarelli et al already taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain. Additionally, Zincarelli taught that AAV1-9 mediated transgene expression was detected 9-months after the first injection, which is an indication of a sustained and stable transgene expression (see at least Figures 1-2 of Zincarelli). Zincarelli et al stated “AAV8 and 9 transduce tissues more ubiquitously than the other serotypes do, with AAV9 having the most robust tissue expression. AAV9 showed low levels of luciferase protein expression and genome copy numbers in the brain and testes. The expression in the testes is an important safety issue for future clinical investigation of this serotype” (page 1078, right column, last paragraph). Please note that safety issue is not a factor involved in the determination of obviousness, particularly the instant claims are simply drawn to a recombinant AAV particle comprising components (a)-(b) as recited in independent claim 12. Nevertheless, with respect to a safety issue a POSA before the effective filing date of the present application (08/30/2018) would be able to adjust and/or monitor the amount of rAAV9 virions being administered into a subject, given the numerous advantages provided by the use of rAAV9 virions. Moreover, before the effective filing date of the present application (08/30/2018), various groups have successfully constructed and used rAAV9 vectors for in vivo gene therapy applications as evidenced at least by the teachings and claims issued to Donsante et al (US 12,070,510), Hinderer et al (US 10,973,929 and US 11,253,612), and Marsala et al (US 10,688,285).
(v) With respect to the fact that the reviews of Timson and Coelho et al do not mention gene therapy for treatment of galacosemia is irrelevant regarding to the obviousness determination of the claimed recombinant AAV particle, Applicant argued that this is not surprising because of the reasons discussed above, namely: (i) High is directed to gene therapy to deliver Factor IX, does not disclose AAV9 as serotype to be used in gene therapy, does not provide any guidance or instruction regarding gene therapy for Type I galactosemia, and only mentions GALT in a virtually unlimited laundry list of potential therapeutic transgenes; and (ii) none of the other references even discuss gene therapy for Type I galactosemia. Additionally, Applicant argued that the Office fails to provide substantive evidence that a POSA would have been motivated to select the particular elements required to produce the claimed rAAV particles, or have expected that such a combination would result in a safe and effective treatment for Type I galactosemia, which was a known need. Moreover, Applicant argued that the fact that during the 17 years between High’s December 2001 publication and the August 30, 2018 (effective filing date of the present claims), no AAV gene therapy for Type I galactosemia was developed, is by itself an objective indicator of non-obviousness.
Please refer to the Office’s responses in Sections A-B above for details; and the Office has provided substantive reasonings and/or motivations why the claimed rAAV particle is prima facie obvious. Once again, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy, let alone a safe and effective treatment for Type I galactosemia. Additionally, the obviousness determination for the claimed recombinant AAV particle is assessed in light of the state of the prior art before the effective filing date 08/30/2018 of the present application, and not only in 2001 when the High reference was first published. The modified rAAV virion resulting from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth in the above 103 rejection would mediate a sustained, rapid-onset and high level of GALT expression in a broad spectrum of tissues that include the liver, the heart, the lung, the hamstring and the brain, and it would be useful for galactosemia treatment. The absence of a reported safe and effective in vivo gene therapy for Type I galactosemia in a subject at the effective filing date of the present application (08/30/2018) does not indicate or suggest in any way that the claimed rAAV particle of the present application is not prima facie obvious in light of the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al.
(vi) With respect to the Office’s assertion that Fotin-Mleczek does not teach away from the combination of the prior art elements necessary to achieve the claimed rAAV particles, once again Applicant argued that Fotin-Mleczek focused on “liposomes, lipoplex, or lipid nanoparticle” formulations for the delivery RNA sequences, without any guidance or instruction that any of the 78,730 different mRNAs disclosed in the patent, and certainly not SEQ ID NO: 17,387 should be used in a viral vector-based gene therapy system, such as an AAV system. Additionally, the combination of Fotin-Mleczek and the other cited references, which altogether disclose thousands of combinations of therapeutic transgenes and potential delivery vectors, does not provide a POSA with any motivation or guidance regarding the use of rAAV vectors to deliver GALT for the treatment of Type I galactosemia, or any expectation that such gene therapy methods would be successful.
Once again, please refer to the Office’s responses in Sections A-B above for details; and the Office has provided substantive reasonings and/or motivations why the claimed rAAV particle is prima facie obvious. Particularly, Fotin-Mleczek disclosed a single 1140-bp mRNA sequence of SEQ ID NO:17,387 encoding GALT, while High did teach specifically a rAAV virion comprising a polynucleotide encoding GALT (associated with galactosemia) that is operably linked to a constitutive promoter and is flanked by AAV ITR sequences. Accordingly, a POSA would not have to pick or choose from thousands of transgenes and diseases as argued by Applicant to arrive at a rAAV virion with a polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO: 1 of the present application (an embodiment of dependent claim 13) with a reasonable expectation of success. It is also worth noting that the absence of mentioning gene therapy for galactosemia treatment in both the reviews of Timson and Coelho et al is irrelevant regarding to the obviousness determination of the claimed recombinant AAV particle, particularly none of the reviews cited or considered any of the cited references in the above 103 rejections. Nor does any of the reviews mention mRNA therapy approach for galactosemia, which was already known in the prior art as evidenced at least by the teachings of Fotin-Mlezek et al and Martini et al (WO 2017/201348; IDS).
(vii) With respect to the issue of reliance on a large number of references in a rejection, Applicant argued that the rejection should be withdrawn based on what the disclosures “would have meant to a person of ordinary skill in the field of the invention”, for the reasons set forth above for each of the cited references, the failure of the Office’s obviousness rejection to provide a substantive evidence that the claimed rAAV particles are prima facie obvious, and particularly in view of the unexpected results disclosed in the accompanying Second Hughes 132 Declaration.
Please refer to the Office’s responses in Sections A-B above for details; and the Office has provided substantive reasonings and/or motivations why the claimed rAAV particle is prima facie obvious. The unexpected results disclosed in the accompanying Second Hughes 132 Declaration will be addressed below.
D. Unexpected Results
I. Applicant referred the Office to the First 1.132 Declaration of Dr. Hughes providing evidence that the claimed invention “unexpectedly” provides sustained GALT expression after a single administration (in two different animal models: GALT-deficient mice and GALT-null rats) of a rAAV (JAG101) comprising the hGALT transgene of SEQ ID NO: 13 encoding a wild-type human GALT protein, in a variety of tissues, including the brain, resulting in the reduction of toxic metabolites in theses tissues and even amelioration of symptoms of galactosemia also found in humans, including cataract formation and pre-pubertal growth delay. Additionally, the Second 1.132 Declaration of Dr. Hughes explains, prior to August 30, 2018, it was not expected that a single administration of JAG101 would result in transduction of sufficient target cells, or in expression of sufficient levels of GALT in those cells, to systemically reduce the toxic accumulation of Gal-1-P that causes Type I galactosemia. Moreover, the result was surprising because RBCs lack nuclei and therefore do not have the cellular machinery required to express GALT from a rAAV-delivered transgene, and yet Gal-1-P was reduced in those same RBCs. Dr. Hughes explains that the claimed rAAV particles can exert therapeutic effect, even in RBC cells that cannot themselves be transduced by AAV to express the GALT transgene, and the clinical significance of this RBC Gal-1-P reduction is further supported by contemporaneous literature showing that the level of Gal-1-P in RBCs of galactosemia patients correlates negatively with the severity of the underlying genotype, and that higher RBC Gal-1-P levels are associated with poorer long-term clinical outcomes, whereas RBC GALT enzyme levels themselves do not necessarily correlate with either RBC Gal-1-P levels or long-term clinical outcomes (Yuzyuk et al, Mol. Genetics and Metabolism 125:258-265, 2018; IDS; and Yuzyuk et al, J. Inherit. Metab. Dis. 41:197-208, 2018; IDS). Dr. Hughes also explains that it was unexpected that the aforementioned GALT expression and reduction of GAL-1-P could be achieved in the time frame of 2 weeks to 12 weeks after administration, as was observed for JAG101. Accordingly, the unexpected results described in the Second Hughes Declaration provide further evidence that the claimed rAAV particles as exemplified by JAG101 satisfy the longstanding need for an effective treatment for Type 1 galactosemia.
First, the Office noted that the “unexpected” results that were described in both the First and Second Hughes Declarations were obtained in a non-clinical testing for JAG101 as a one-time treatment for Type I galactosemia at two specific different doses (low dose at 3.74 x 1013 vg/kg and high dose at 1.15 x 1014 vg/kg) and the GALT transgene is operably linked to a CAG promoter in JAG101. However, any unexpected result should be commensurate with the scope of the claims. Moreover, the instant claims are composition claims, and not in vivo gene therapy method claims that require a particular therapeutic efficacy. Furthermore, none of the rejected claims recite any particular dosage of a rAAV particle that is used in the First and Second Hughes Declarations.
Second, even assuming that the observed “unexpected” results are not dependent on the administered dosages of the claimed rAAV particle and/or the utilized CAG promoter, since the modified recombinant AAV virion resulting at least from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth in the above 103 rejection is indistinguishable from the claimed rAAV particle of the present application, the modified recombinant AAV virion has the same structure and components as the claimed rAAV particle of the present application, it necessarily or inherently exhibits the same properties (e.g., sustained GALT expression in a variety of tissues, including the brain; reduction of toxic metabolites and symptoms of galactosemia such as reduction of cataract formation and pre-pubertal growth delay; and RBC Gal-1-P reduction as observed in two different animal models as reported in the First and Second Hughes 1.132 Declarations) when it is placed in the same requisite environments. The patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure.
II. Responding to the Office’s bases for disregarding Unexpected Results.
(i) Applicant argued that the mere observation that AAV was known to have favorable characteristics for gene therapy does not support to conclusion that the AAV particle recited in the pending claims was obvious, particularly given the Office’s admission that “[t]he physiological art was recognized as unpredictable”, and that as of August 30, 2018, “little was known” about rAAV delivery of GALT for gene therapy treatment in patients suffering from galactosemia” (The 112(a), first paragraph, for Scope of Enablement rejection in the Non-Final Office Action dated 11/06/2025; now withdrawn). Applicant also argued that prior to August 30, 2018, a POSA would not have reasonably expected that rAAV-mediated delivery of GALT would result in sufficient expression of GALT in a sufficient number of cells to reduce to toxic accumulation of Gal-1-P across a variety of cell types in different tissues throughout the body.
First, once again the statement “the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients” in the 112(a), first paragraph, for Scope of Enablement rejection (now withdrawn) in the Non-Final Office Action dated 11/06/2025 is incorrect. This is because the as-filed specification stated clearly “In one aspect, a method is provided for introducing a functional GALT enzyme into a cell, comprising contacting the cell with a recombinant polynucleotide and/or AAV vector or a capsid or viral particle containing the same, or a composition as described herein. The contacting can be ex vivo or in vivo” (paragraph [0014]; “A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro” (paragraph [0068]); “A “pharmaceutical composition” is intended to include the combination of an active polypeptide, polynucleotide or antibody with a carrier, inert or active such as a solid support making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo” (paragraph [0098]); and even in the context of gene therapy the instant specification defined the term “an effective amount of an rAAV viral particle” to be an amount sufficient to result in expression of a gene in a subject (paragraph [0103]). Thus, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy.
Second, the concept of constructing a recombinant AAV virion comprising a transgene encoding a wild-type GALT and/or a modified mRNA encoding a wild-type GALT for the treatment of galactosemia (a genetic/metabolic disorder with a defective GALT gene) was already known in the prior art and taught by High and Fotin-Mlezek et al, respectively. Additionally, High stated “AAV, a parvovirus belonging to the genus Dependovirus, has several features not found in other viruses that make it particularly well suited for gene therapy applications. For example, AAV can infect a wide range of host cells, including non-dividing cells. Furthermore, AAV can infect cells from a variety of species. Importantly, AAV has not been associated with any human or animal disease, and does not appear to alter the physiological properties of the host cell upon integration. Finally, AAV is stable at a wide range of physical and chemical conditions, which lends itself to production, storage, and transportation requirements” (page 2, second last paragraph); and “Expression of certain rAAV-delivered transgenes has been shown to have therapeutic effect in laboratory animals; for example, expression of Factor IX was reported to have restored phenotypic normalcy in dog models of hemophilia B (High and Herzog, supra). Moreover, expression of rAAV-delivered VEGF to mouse myocardium resulted in neovascular formation (Su et al. supra), and expression of rAAV-delivered AADC to the brains of parkinsonian monkeys resulted in the restoration of dopaminergic function (Bankiewicz et al., supra)” (page 5, first paragraph). Moreover, Zincarelli et al also taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain; and that AAV1-9 mediated transgene expression was detected 9-months after the first injection (a sustained and stable transgene expression) (see at least Figures 1-2 of Zincarelli). Kobinger also taught an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom, particularly the optimized promoter sequence of SEQ ID NO: 1 in pCAGGS∆829-EGFP that is at least 3-fold more active than the non-optimized CAG promoter in pCAGGS-EGFP (see Figure 3). Moreover, before the effective filing date of the present application (08/30/2018), Qin et al (PLoS ONE 5: e10611.doi:10.1371/journal.pone.0010611, 4 pages; 2010) already carried out a systematic comparison of eight commonly used constitutive promoters (SV40, CMV, UBC, EF1A, PGK and CAGG) for mammalian systems; and none of the tested promoters have 2-fold more active than CAGG promoter, let alone 3-fold more active than CAGG promoter (Abstract; particularly Fig. 1). Accordingly, an ordinary skill in the art would have a “reasonable” expectation of success based at least on the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al to arrive at the presently claimed rAAV virus; and such rAAV would be useful for galactosemia treatment. It is noted that Applicant has not provided any objective/factual evidence to support Applicant’s assertion that at the time of filing the present application in 2018, a person of skill in the art would not have had a “reasonable” expectation of success to construct the claimed AAV particles, or that the AAV particles would not be useful for galactosemia treatment via a sustained, rapid-onset and high expression levels of a wild-type GALT in cells of numerous tissues such as liver, heart, lung, muscles and the brain.
(ii) Applicant also argued that the Office disregards Applicant’s evidence of unexpected results as described in the First and Second Hughes Declarations because expression of certain rAAV-delivered transgenes (e.g., Factor IX of High and Herzog; VEGF of Su et al; AADC of Bankiewicz et al) has been shown to have therapeutic effect in laboratory animals are not applicable to a gene therapy designed to deliver GALT. This is because as discussed above and in the Second Hughes Declaration, prior to August 30, 2018, it was recognized in the art that gene therapy intended to deliver ubiquitous, non-secreted proteins like GALT was more challenging, and less likely to succeed, than those intended to deliver secreted proteins (like Factor IX and VEGF), or to deliver to a specific tissue type (like ADDC) since gene therapies designed to express non-secreted proteins require expression in sufficient number of cells of target tissues to achieve an intracellular functionality required for a therapeutic effect.
Please refer to the Office’s responses in Sections A-B for details. The teachings of High are not necessarily limited to gene therapy delivery of Factor IX or other blood coagulation factors or only secreted polypeptides or working examples. Please note that glucose-6-phosphatase, phosphoenolpyruvatecarboxykinase, galactose-1-phosphate uridyl transferase (GALT) and phenylalanine hydroxylase are non-secreted enzymes that are also taught by High. Based on the teachings of High, a POSA would readily recognize that High did teach specifically a rAAV virion comprising a polynucleotide encoding GALT that is operably linked to a constitutive promoter and is flanked by AAV ITR sequences. Additionally, Zincarelli et al already taught that AAV9 had the best viral genome distribution and highest protein levels among tested AAV serotypes 1-9, with rapid-onset transgene expression and AAV9-mediated luciferase enzyme activity was found mainly at least in the liver, in the heart, as well as in other tissues such as the lung, the hamstring and the brain; and that AAV1-9 mediated transgene expression was detected 9-months after the first injection (a sustained and stable transgene expression) (see at least Figures 1-2 of Zincarelli). Moreover, Kobinger also taught an optimized chicken β-actin promoter that is capable of driving high levels of expression of a sequence of interest inserted downstream therefrom, particularly the optimized promoter sequence of SEQ ID NO: 1 in pCAGGS∆829-EGFP that is at least 3-fold more active than the non-optimized CAG promoter in pCAGGS-EGFP (see Figure 3).
(iii) With respect to the issue that the absence of approved drugs or biologic products for the treatment of Type I galactosemia is not a criterion for the determination of obviousness under 35 U.S.C. 103, once again Applicant relied on the statement “the sole purpose for the claimed recombinant AAV particle is to provide a sustained expression of a functional GALT protein to alleviate symptoms in Galactosemia patients” (The 112(a), first paragraph, for Scope of Enablement rejection in the Non-Final Office Action dated 11/06/2025; pages 3-4; now withdrawn) and the fact that there were no approved treatments for the treatment of Type I galactosemia shows that the claimed recombinant AAV particle satisfies a long-felt need for the approved Type I galactosemia treatment as supported by the unexpected results discussed in the First and Second Hughes Declarations. Satisfaction of a long-felt need but unsolved need is among the secondary considerations can support a finding that challenged claims are not obvious.
First, once again the as-filed specification stated clearly “In one aspect, a method is provided for introducing a functional GALT enzyme into a cell, comprising contacting the cell with a recombinant polynucleotide and/or AAV vector or a capsid or viral particle containing the same, or a composition as described herein. The contacting can be ex vivo or in vivo” (paragraph [0014]; “A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro” (paragraph [0068]); “A “pharmaceutical composition” is intended to include the combination of an active polypeptide, polynucleotide or antibody with a carrier, inert or active such as a solid support making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo” (paragraph [0098]); and even in the context of gene therapy the instant specification defined the term “an effective amount of an rAAV viral particle” to be an amount sufficient to result in expression of a gene in a subject (paragraph [0103]). Thus, there are many uses for the claimed rAAV particle and the claimed rAAV particle and a pharmaceutical composition comprising the same rAAV particle do not require any therapeutic efficacy.
Second, the absence of “approved drugs or biologic products for the treatment of Type 1 galactosemia” and/or no approved treatments for the treatment of Type I galactosemia are not criteria for the determination of obviousness under 35 U.S.C. 103, particularly for the claimed recombinant adeno-associated viral particle of the present application.
Third, please also refer to the Office’s responses to the unexpected results in Section D. I above. Additionally, the data presented in both the First and Second Hughes Declarations are not approved treatments for Type I galactosemia.
(iv) With respect to the issue that the modified rAAV resulting from the combined teachings of High, GenBank Accession No. AY408624, Davidsohn, Zincarelli and Kobinger is indistinguishable and necessarily exhibits the same properties when it is placed in the same requisite environments, Applicant argued that unexpected results are longstanding secondary considerations of non-obviousness offered to negate arguments that a claimed invention is obvious in view of a combination of elements from the prior art, and must be considered in determining whether a challenged claim is obvious is obvious in view of such art. Once again, Applicant argued that as discussed above and in the Second Hughes Declaration, prior to August 30, 2018, those of ordinary skill in the art would not reasonably have expected that rAAV-mediated delivery of GALT would result in sufficient expression of GALT in a sufficient number of cells to reduce the toxic accumulation across a variety of cell types in different tissues throughout the body, particularly in a time frame of 2 weeks to 12 weeks after administration. Moreover, Applicant’s unexpected finding that a single administration of JAG101 resulted in a rapid and systemic reduction of the toxic metabolite Gal-1-P even in RBCs of GALT-deficient mice and GALT-null rats provides further evidence to rebut the Office’s argument that the pending claims are prima facie obvious over the cited references.
First, the Office noted that the “unexpected” results that were described in both the First and Second Hughes Declarations were obtained in a non-clinical testing for JAG101 as a one-time treatment for Type I galactosemia at two specific different doses (low dose at 3.74 x 1013 vg/kg and high dose at 1.15 x 1014 vg/kg) and the GALT transgene is operably linked to a CAG promoter in JAG101. However, any unexpected result should be commensurate with the scope of the claims. Moreover, the instant claims are composition claims, and not in vivo gene therapy method claims that require a particular therapeutic efficacy. Furthermore, none of the rejected claims recite any particular dosage of a rAAV particle that is used in the First and Second Hughes Declarations.
Second, even assuming that the observed “unexpected” results are not dependent on the administered dosages of the claimed rAAV particle and/or the utilized CAG promoter, since the modified recombinant AAV virion resulting at least from the combined teachings of High, the GenBank Accession No. AY408624, Davidsohn et al, Zincarelli et al and Kobinger et al as set forth in the above 103 rejection is indistinguishable from the claimed rAAV particle of the present application, the modified recombinant AAV virion has the same structure and components as the claimed rAAV particle of the present application, it necessarily or inherently exhibits the same properties (e.g., sustained GALT expression in a variety of tissues, including the brain; reduction of toxic metabolites and symptoms of galactosemia such as reduction of cataract formation and pre-pubertal growth delay; and RBC Gal-1-P reduction as observed in two different animal models as reported in the First and Second Hughes 1.132 Declarations) when it is placed in the same requisite environments. The patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Derosa et al (WO 2014/144196) disclosed the human galactose-1-phosphate uridyl transferase (GALT) mRNA of SEQ: 2 that is 100% identical to SEQ ID NO:13 of the present application (see attached sequence search below).
Conclusion
No claim is allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Sequence 17387,
Patent No. 11078247
Query Match 86.0%; Score 980; Length 1140;
Best Local Similarity 79.7%;
Matches 909; Conservative 131; Mismatches 100; Indels 0; Gaps 0;
Qy 1 ATGAGCAGAAGCGGCACCGACCCTCAGCAGAGACAGCAGGCCTCTGAAGCCGATGCCGCC 60
|:||||||||||||||||||||| |||||||||||||||||| || ||||| ||||||
Db 1 AUGAGCAGAAGCGGCACCGACCCCCAGCAGAGACAGCAGGCCAGCGAGGCCGACGCCGCC 60
Qy 61 GCTGCCACCTTCAGAGCCAATGACCACCAGCACATCCGGTACAACCCCCTGCAGGACGAG 120
|| ||||||::||||||||| |||||||||||||:| | :|||||||||:||||||||||
Db 61 GCCGCCACCUUCAGAGCCAACGACCACCAGCACAUCAGAUACAACCCCCUGCAGGACGAG 120
Qy 121 TGGGTGCTGGTGTCCGCCCACAGAATGAAGAGGCCTTGGCAGGGCCAGGTGGAACCCCAG 180
:|||:||:||:| |||||||||||:|||||| || :||||||||||||:||| ||||||
Db 121 UGGGUGCUGGUGAGCGCCCACAGAAUGAAGAGACCCUGGCAGGGCCAGGUGGAGCCCCAG 180
Qy 181 CTGCTGAAAACCGTGCCCAGACACGACCCCCTGAACCCTCTGTGTCCTGGCGCCATTAGA 240
|:||:||| ||||:|||||||||||||||||:|||||| |:|:| || |||||||: |||
Db 181 CUGCUGAAGACCGUGCCCAGACACGACCCCCUGAACCCCCUGUGCCCCGGCGCCAUCAGA 240
Qy 241 GCCAACGGCGAAGTGAACCCCCAGTACGACAGCACCTTCCTGTTCGACAACGACTTCCCC 300
||||||||||| |:||||||||||:|||||||||||::||:|::||||||||||::||||
Db 241 GCCAACGGCGAGGUGAACCCCCAGUACGACAGCACCUUCCUGUUCGACAACGACUUCCCC 300
Qy 301 GCCCTGCAGCCTGATGCCCCATCTCCTGGACCTAGCGACCACCCTCTGTTCCAGGCCAAG 360
||||:|||||| || ||||| || || || ||||||||||| |:|::||||||||||
Db 301 GCCCUGCAGCCCGACGCCCCCAGCCCCGGCCCCAGCGACCACCCCCUGUUCCAGGCCAAG 360
Qy 361 TCTGCCAGAGGCGTGTGCAAAGTGATGTGCTTCCACCCTTGGAGCGACGTGACCCTGCCC 420
||||||||||:|:|||| |:||:|:||::|||||| :|||||||||:|||||:||||
Db 361 AGCGCCAGAGGCGUGUGCAAGGUGAUGUGCUUCCACCCCUGGAGCGACGUGACCCUGCCC 420
Qy 421 CTGATGAGCGTGCCAGAGATCAGAGCCGTGGTGGATGCCTGGGCCAGCGTGACAGAAGAA 480
|:||:|||||:||| ||||:||||||||:||:||| |||:|||||||||:||| || ||
Db 421 CUGAUGAGCGUGCCCGAGAUCAGAGCCGUGGUGGACGCCUGGGCCAGCGUGACCGAGGAG 480
Qy 481 CTGGGAGCCCAGTACCCCTGGGTGCAGATCTTCGAGAACAAGGGCGCCATGATGGGCTGC 540
|:||| ||||||:|||||:|||:|||||:|::|||||||||||||||||:||:||||:||
Db 481 CUGGGCGCCCAGUACCCCUGGGUGCAGAUCUUCGAGAACAAGGGCGCCAUGAUGGGCUGC 540
Qy 541 AGCAACCCCCACCCTCACTGTCAAGTGTGGGCCAGCAGCTTCCTGCCCGATATCGCCCAG 600
|||||||||||||| |||:| || |:|:|||||||||||::||:|||||| |:|||||||
Db 541 AGCAACCCCCACCCCCACUGCCAGGUGUGGGCCAGCAGCUUCCUGCCCGACAUCGCCCAG 600
Qy 601 CGGGAAGAGAGAAGCCAGCAGGCTTACAAGAGCCAGCACGGCGAGCCCCTGCTGATGGAA 660
| || ||||||||||||||||| :||||||||||||||||||||||||:||:||:|||
Db 601 AGAGAGGAGAGAAGCCAGCAGGCCUACAAGAGCCAGCACGGCGAGCCCCUGCUGAUGGAG 660
Qy 661 TACTCCAGACAGGAACTGCTGCGGAAAGAACGGCTGGTGCTGACCAGCGAGCACTGGCTG 720
:|| ||||||||| |:||:| | || || | |:||:||:|||||||||||||:|||:|
Db 661 UACAGCAGACAGGAGCUGCUGAGAAAGGAGAGACUGGUGCUGACCAGCGAGCACUGGCUG 720
Qy 721 GTGCTGGTGCCTTTTTGGGCCACATGGCCCTACCAGACCCTGCTGCTGCCTAGAAGGCAC 780
|:||:||:||| :: :||||||| :|||||:|||||||||:||:||:||| ||||| |||
Db 721 GUGCUGGUGCCCUUCUGGGCCACCUGGCCCUACCAGACCCUGCUGCUGCCCAGAAGACAC 780
Qy 781 GTGCGGAGACTGCCTGAGCTGACACCCGCCGAGAGAGATGACCTGGCCAGCATCATGAAG 840
|:| | ||||:||| ||||:||| |||||||||||||| ||||:||||||||:||:||||
Db 781 GUGAGAAGACUGCCCGAGCUGACCCCCGCCGAGAGAGACGACCUGGCCAGCAUCAUGAAG 840
Qy 841 AAACTGCTGACCAAATACGACAACCTGTTCGAGACCAGCTTCCCCTACAGCATGGGCTGG 900
|| |:||:|||||| :|||||||||:|::||||||||||::||||:||||||:||||:||
Db 841 AAGCUGCUGACCAAGUACGACAACCUGUUCGAGACCAGCUUCCCCUACAGCAUGGGCUGG 900
Qy 901 CACGGCGCTCCTACAGGATCTGAGGCTGGCGCCAACTGGAACCACTGGCAGCTGCACGCC 960
|||||||| || || || ||||| |||||||||:||||||||:||||||:|||||||
Db 901 CACGGCGCCCCCACCGGCAGCGAGGCCGGCGCCAACUGGAACCACUGGCAGCUGCACGCC 960
Qy 961 CACTACTACCCCCCACTGCTGAGATCTGCCACCGTGCGGAAGTTCATGGTGGGATACGAG 1020
|||:||:||||||| |:||:|||| |||||||:| | |||::||:||:||| :|||||
Db 961 CACUACUACCCCCCCCUGCUGAGAAGCGCCACCGUGAGAAAGUUCAUGGUGGGCUACGAG 1020
Qy 1021 ATGCTGGCTCAGGCCCAGAGAGATCTGACCCCTGAACAGGCCGCCGAACGGCTGAGAGCA 1080
|:||:||| |||||||||||||| |:|||||| || ||||||||||| | |:||||||
Db 1021 AUGCUGGCCCAGGCCCAGAGAGACCUGACCCCCGAGCAGGCCGCCGAGAGACUGAGAGCC 1080
Qy 1081 CTGCCCGAAGTGCACTACCACCTGGGACAGAAGGACAGAGAGACAGCCACAATCGCCTGA 1140
|:|||||| |:||||:||||||:||| ||||||||||||||||| ||||| |:||||: |
Db 1081 CUGCCCGAGGUGCACUACCACCUGGGCCAGAAGGACAGAGAGACCGCCACCAUCGCCUAA 1140
LOCUS AY408624 1140 bp DNA linear GSS 02-OCT-2013
DEFINITION Homo sapiens GALT gene, VIRTUAL TRANSCRIPT, partial sequence,
genomic survey sequence.
COMMENT This sequence was made by sequencing genomic exons and ordering
them based on alignment.
Query Match 100.0%; Score 1140; Length 1140;
Best Local Similarity 100.0%;
Matches 1140; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTCGCGCAGTGGAACCGATCCTCAGCAACGCCAGCAGGCGTCAGAGGCGGACGCCGCA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGTCGCGCAGTGGAACCGATCCTCAGCAACGCCAGCAGGCGTCAGAGGCGGACGCCGCA 60
Qy 61 GCAGCAACCTTCCGGGCAAACGACCATCAGCATATCCGCTACAACCCGCTGCAGGATGAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GCAGCAACCTTCCGGGCAAACGACCATCAGCATATCCGCTACAACCCGCTGCAGGATGAG 120
Qy 121 TGGGTGCTGGTGTCAGCTCACCGCATGAAGCGGCCCTGGCAGGGTCAAGTGGAGCCCCAG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 TGGGTGCTGGTGTCAGCTCACCGCATGAAGCGGCCCTGGCAGGGTCAAGTGGAGCCCCAG 180
Qy 181 CTTCTGAAGACAGTGCCCCGCCATGACCCTCTCAACCCTCTGTGTCCTGGGGCCATCCGA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CTTCTGAAGACAGTGCCCCGCCATGACCCTCTCAACCCTCTGTGTCCTGGGGCCATCCGA 240
Qy 241 GCCAACGGAGAGGTGAATCCCCAGTACGATAGCACCTTCCTGTTTGACAACGACTTCCCA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GCCAACGGAGAGGTGAATCCCCAGTACGATAGCACCTTCCTGTTTGACAACGACTTCCCA 300
Qy 301 GCTCTGCAGCCTGATGCCCCCAGTCCAGGACCCAGTGATCATCCCCTTTTCCAAGCAAAG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GCTCTGCAGCCTGATGCCCCCAGTCCAGGACCCAGTGATCATCCCCTTTTCCAAGCAAAG 360
Qy 361 TCTGCTCGAGGAGTCTGTAAGGTCATGTGCTTCCACCCCTGGTCGGATGTAACGCTGCCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 TCTGCTCGAGGAGTCTGTAAGGTCATGTGCTTCCACCCCTGGTCGGATGTAACGCTGCCA 420
Qy 421 CTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTCAGTCACAGAGGAG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTCAGTCACAGAGGAG 480
Qy 481 CTGGGTGCCCAGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGCTGT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CTGGGTGCCCAGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGCTGT 540
Qy 541 TCTAACCCCCACCCCCACTGCCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 TCTAACCCCCACCCCCACTGCCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAG 600
Qy 601 CGTGAGGAGCGATCTCAGCAGGCCTATAAGAGTCAGCATGGAGAGCCCCTGCTAATGGAG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 CGTGAGGAGCGATCTCAGCAGGCCTATAAGAGTCAGCATGGAGAGCCCCTGCTAATGGAG 660
Qy 661 TACAGCCGCCAGGAGCTACTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGTTA 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 TACAGCCGCCAGGAGCTACTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGTTA 720
Qy 721 GTACTGGTCCCCTTCTGGGCAACATGGCCCTACCAGACACTGCTGCTGCCCCGTCGGCAT 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 GTACTGGTCCCCTTCTGGGCAACATGGCCCTACCAGACACTGCTGCTGCCCCGTCGGCAT 780
Qy 781 GTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTGATGATCTAGCCTCCATCATGAAG 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 GTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTGATGATCTAGCCTCCATCATGAAG 840
Qy 841 AAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTACTCCATGGGCTGG 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 AAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTACTCCATGGGCTGG 900
Qy 901 CATGGGGCTCCCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCACGCT 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 CATGGGGCTCCCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCACGCT 960
Qy 961 CATTACTACCCTCCGCTCCTGCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAA 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 CATTACTACCCTCCGCTCCTGCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAA 1020
Qy 1021 ATGCTTGCTCAGGCTCAGAGGGACCTCACCCCTGAGCAGGCTGCAGAGAGACTAAGGGCA 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 ATGCTTGCTCAGGCTCAGAGGGACCTCACCCCTGAGCAGGCTGCAGAGAGACTAAGGGCA 1080
Qy 1081 CTTCCTGAGGTTCATTACCACCTGGGGCAGAAGGACAGGGAGACAGCAACCATCGCCTGA 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1081 CTTCCTGAGGTTCATTACCACCTGGGGCAGAAGGACAGGGAGACAGCAACCATCGCCTGA 1140
Human galactose-1-phosphate uridyl transferase (GALT) mRNA, SEQ: 2.
WO2014144196-A1.
Query Match 100.0%; Score 1140; Length 1140;
Best Local Similarity 80.1%;
Matches 913; Conservative 227; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTCGCGCAGTGGAACCGATCCTCAGCAACGCCAGCAGGCGTCAGAGGCGGACGCCGCA 60
|:|:|||||||:||||||||:||:||||||||||||||||||:|||||||||||||||||
Db 1 AUGUCGCGCAGUGGAACCGAUCCUCAGCAACGCCAGCAGGCGUCAGAGGCGGACGCCGCA 60
Qy 61 GCAGCAACCTTCCGGGCAAACGACCATCAGCATATCCGCTACAACCCGCTGCAGGATGAG 120
|||||||||::|||||||||||||||:|||||:|:||||:|||||||||:||||||:|||
Db 61 GCAGCAACCUUCCGGGCAAACGACCAUCAGCAUAUCCGCUACAACCCGCUGCAGGAUGAG 120
Qy 121 TGGGTGCTGGTGTCAGCTCACCGCATGAAGCGGCCCTGGCAGGGTCAAGTGGAGCCCCAG 180
:|||:||:||:|:||||:|||||||:||||||||||:|||||||:||||:||||||||||
Db 121 UGGGUGCUGGUGUCAGCUCACCGCAUGAAGCGGCCCUGGCAGGGUCAAGUGGAGCCCCAG 180
Qy 181 CTTCTGAAGACAGTGCCCCGCCATGACCCTCTCAACCCTCTGTGTCCTGGGGCCATCCGA 240
|::|:||||||||:|||||||||:|||||:|:||||||:|:|:|:||:|||||||:||||
Db 181 CUUCUGAAGACAGUGCCCCGCCAUGACCCUCUCAACCCUCUGUGUCCUGGGGCCAUCCGA 240
Qy 241 GCCAACGGAGAGGTGAATCCCCAGTACGATAGCACCTTCCTGTTTGACAACGACTTCCCA 300
|||||||||||||:|||:||||||:||||:||||||::||:|:::|||||||||::||||
Db 241 GCCAACGGAGAGGUGAAUCCCCAGUACGAUAGCACCUUCCUGUUUGACAACGACUUCCCA 300
Qy 301 GCTCTGCAGCCTGATGCCCCCAGTCCAGGACCCAGTGATCATCCCCTTTTCCAAGCAAAG 360
||:|:||||||:||:||||||||:|||||||||||:||:||:||||::::||||||||||
Db 301 GCUCUGCAGCCUGAUGCCCCCAGUCCAGGACCCAGUGAUCAUCCCCUUUUCCAAGCAAAG 360
Qy 361 TCTGCTCGAGGAGTCTGTAAGGTCATGTGCTTCCACCCCTGGTCGGATGTAACGCTGCCA 420
:|:||:|||||||:|:|:||||:||:|:||::|||||||:||:||||:|:|||||:||||
Db 361 UCUGCUCGAGGAGUCUGUAAGGUCAUGUGCUUCCACCCCUGGUCGGAUGUAACGCUGCCA 420
Qy 421 CTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTCAGTCACAGAGGAG 480
|:||:|:|||:|||:||||:||||||:|::|::||:|||:|||||:|||:||||||||||
Db 421 CUCAUGUCGGUCCCUGAGAUCCGGGCUGUUGUUGAUGCAUGGGCCUCAGUCACAGAGGAG 480
Qy 481 CTGGGTGCCCAGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGCTGT 540
|:|||:||||||:||||::|||:|||||:|:::|||||||||||:||||:||:||||:|:
Db 481 CUGGGUGCCCAGUACCCUUGGGUGCAGAUCUUUGAAAACAAAGGUGCCAUGAUGGGCUGU 540
Qy 541 TCTAACCCCCACCCCCACTGCCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAG 600
:|:|||||||||||||||:||||||:|:||||||||||:::||:||||||:|::||||||
Db 541 UCUAACCCCCACCCCCACUGCCAGGUAUGGGCCAGCAGUUUCCUGCCAGAUAUUGCCCAG 600
Qy 601 CGTGAGGAGCGATCTCAGCAGGCCTATAAGAGTCAGCATGGAGAGCCCCTGCTAATGGAG 660
||:|||||||||:|:|||||||||:|:|||||:|||||:||||||||||:||:||:||||
Db 601 CGUGAGGAGCGAUCUCAGCAGGCCUAUAAGAGUCAGCAUGGAGAGCCCCUGCUAAUGGAG 660
Qy 661 TACAGCCGCCAGGAGCTACTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGTTA 720
:|||||||||||||||:||:||||||||||||:|:||:||:||||||:||||||:||::|
Db 661 UACAGCCGCCAGGAGCUACUCAGGAAGGAACGUCUGGUCCUAACCAGUGAGCACUGGUUA 720
Qy 721 GTACTGGTCCCCTTCTGGGCAACATGGCCCTACCAGACACTGCTGCTGCCCCGTCGGCAT 780
|:||:||:||||::|:||||||||:|||||:|||||||||:||:||:||||||:|||||:
Db 721 GUACUGGUCCCCUUCUGGGCAACAUGGCCCUACCAGACACUGCUGCUGCCCCGUCGGCAU 780
Qy 781 GTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTGATGATCTAGCCTCCATCATGAAG 840
|:||||||||:|||:||||:||||||:||:|||||:||:||:|:||||:|||:||:||||
Db 781 GUGCGGCGGCUACCUGAGCUGACCCCUGCUGAGCGUGAUGAUCUAGCCUCCAUCAUGAAG 840
Qy 841 AAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTACTCCATGGGCTGG 900
||||:|::|||||||:|:|||||||:|:::||||||:||:::|||:||:|||:||||:||
Db 841 AAGCUCUUGACCAAGUAUGACAACCUCUUUGAGACGUCCUUUCCCUACUCCAUGGGCUGG 900
Qy 901 CATGGGGCTCCCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCACGCT 960
||:|||||:|||||||||:|||||||:|||||||||:|||||||::||||||:||||||:
Db 901 CAUGGGGCUCCCACAGGAUCAGAGGCUGGGGCCAACUGGAACCAUUGGCAGCUGCACGCU 960
Qy 961 CATTACTACCCTCCGCTCCTGCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAA 1020
||::||:||||:||||:||:||||:|:|||||:|:|||||||::||:||::|||:|||||
Db 961 CAUUACUACCCUCCGCUCCUGCGCUCUGCCACUGUCCGGAAAUUCAUGGUUGGCUACGAA 1020
Qy 1021 ATGCTTGCTCAGGCTCAGAGGGACCTCACCCCTGAGCAGGCTGCAGAGAGACTAAGGGCA 1080
|:||::||:|||||:||||||||||:||||||:||||||||:||||||||||:|||||||
Db 1021 AUGCUUGCUCAGGCUCAGAGGGACCUCACCCCUGAGCAGGCUGCAGAGAGACUAAGGGCA 1080
Qy 1081 CTTCCTGAGGTTCATTACCACCTGGGGCAGAAGGACAGGGAGACAGCAACCATCGCCTGA 1140
|::||:||||::||::||||||:|||||||||||||||||||||||||||||:||||:||
Db 1081 CUUCCUGAGGUUCAUUACCACCUGGGGCAGAAGGACAGGGAGACAGCAACCAUCGCCUGA 1140