Prosecution Insights
Last updated: August 14, 2026
Application No. 17/274,966

METHODS FOR INCREASING FETAL HEMOGLOBIN CONTENT IN EUKARYOTIC CELLS AND USES THEREOF FOR THE TREATMENT OF HEMOGLOBINOPATHIES

Final Rejection §103§112
Filed
Mar 10, 2021
Priority
Sep 11, 2018 — EU 18306191.0 +1 more
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Fondation Imagine
OA Round
6 (Final)
59%
Grant Probability
Moderate
7-8
OA Rounds
0m
Est. Remaining
98%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
41 granted / 70 resolved
-1.4% vs TC avg
Strong +40% interview lift
Without
With
+39.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
48 currently pending
Career history
132
Total Applications
across all art units

Statute-Specific Performance

§101
6.1%
-33.9% vs TC avg
§103
33.4%
-6.6% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
29.8%
-10.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 70 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 05/15/2026 is acknowledged. Claim 16 was cancelled. Claims 1,12 and 15 were amended. Claims 1,2,6-13,15 and 20-25 are pending and under examination. Priority This application is a 371 of PCT/EP2019/074131, filed 09/10/2019 and claims foreign priority to EP18306191.0, filed 09/11/2018 as reflected by the most recent filing receipt. Withdrawn Objections and Rejections Applicant’s arguments and amendments, see page 6, filed 05/15/2026, with respect to objection to the specification have been fully considered and are persuasive due to the amendments to the specification inserting a proper symbol indicated use in commerce for the term “TALEN”. The objection to the specification has been withdrawn. Applicant’s arguments and amendments, see page 6, filed 05/15/2026, with respect to the 35 U.S.C. 112(b) rejection of claims 1,2,6-13,15,16 and 20-25 have been fully considered and are partially persuasive due to the amendments to claims 1,12 and 15 replacing the tradename “TALEN” with the generic name “transcription activator-liked effector nuclease”, and therefore the rejection is withdrawn for claims 1,2,7-13,15 and 20-25. However, the rejection remains for claim 6 which was not amended and still recites the tradename “TALEN”. Applicant’s arguments and amendments, see page 6, filed 05/15/2026, with respect to the 35 U.S.C. 112(a) New matter rejection of claims 1,2,6-11,16,20 and 23 have been fully considered and are persuasive due to the amendment to claim 1 removing “at the positions -196 and -195 of the HBG1 or HBG2 promoter”. Therefore, the rejection has been withdrawn. Applicant’s arguments and amendments, see page 7, filed 05/15/2026, with respect to the 35 U.S.C. 102(a)(2) rejection of claims 1,2,7-13,15 and 20-25 as anticipated by Mickanin et al. have been fully considered and are persuasive due to the amendment to claim 1 requiring the eukaryotic cell to be embryonic stem cells or induced pluripotent stem cells which were recited in claim 16 which was not included in the rejection and which is now canceled, as Mickanin et al. do not teach this limitation. Therefore, the 35 U.S.C. 102(a)(2) rejection of claims 1,2,7-13,15 and 20-25 as anticipated by Mickanin et al. has been withdrawn. Rejections Necessitated by Amendment Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 6 and 12 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 6 contains the trademark/trade name “TALEN”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a DNA-targeting nuclease which is a transcription activator-like effector nuclease and, accordingly, the identification/description is indefinite. Regarding claim 12, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 12 lines 3-4 recite the broad recitation “contacting a population of eukaryotic cells selected from the group consisting of hematopoietic progenitor cells, hematopoietic stem cells (HSCs) and pluripotent cells”, and the claim also later recites “wherein the population of eukaryotic cells are embryonic stem cells (ES) or induced pluripotent stem cells (iPS)”, which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. For purposes of compact prosecution, the Examiner is interpreting claim 12 to require that the population of eukaryotic cells are embryonic stem cells (ES) or induced pluripotent stem cells to be consistent with claims 1 and 15. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 2 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 1 has been amended to require that the eukaryotic cell is an embryonic stem cell (ES) or induced pluripotent stem cell (iPS). Claim 2 depends on claim 1 and recites wherein the eukaryotic cell is selected from the group consisting of hematopoietic progenitor cells, hematopoietic stem cells (HSCs), and pluripotent cells. As embryonic cells and induced pluripotent cells are specific types of pluripotent cells, the recitation of pluripotent cells in claim 2 is broader in scope than the cells required by claim 1. Therefore, claim 2 does not further limit the cells recited in amended claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Interpretation Regarding claims 1,2,6-13,15 and 20-25, which recite contacting the eukaryotic cell or population of eukaryotic cells with an effective amount of one or more guide RNAs and a DNA-targeting endonuclease whereby the DNA-targeting endonuclease cleaves the genomic DNA of the cell between positions -198 and -197 in the HBG1 or HBG2 promoter wherein positions -198 and -197 correspond to positions 13 and 14 in SEQ ID NO: 1; wherein cleavage of the genomic DNA between the positions -198 and -197 leads to an insertion or deletion (InDel) of at least 1 base pair and thereby disrupts a binding site for LRF in the HBG1 or HBG2 promoter, and wherein a resulting mutation caused by the InDel is not a substitution mutation, the examiner is interpreting all of the above recited “wherein clauses” to be functional limitations that would result by contacting the eukaryotic cell with the one or more guide RNAs having the sequence as set forth in SEQ ID NO: 2 (claims 10,11 and 20-22) and a DNA targeting endonuclease. Therefore, any guide RNA that has the identical sequence to that of instant SEQ ID NO: 2, would have the function of recruiting the DNA-targeting endonuclease to the HBG1 and HBG2 promoters and generate double-strand breaks between positions -198 and -197 which correspond to positions 13 and 14 in SEQ ID NO: 1, and would result in an InDel of at least 1 base pair, as well as the functional limitations of disrupting a binding site for LRF in the HBG1 or HBG2 promoter, and wherein a resulting mutation caused by the InDel is not a substitution mutation, as well as the InDel limitations in claims 23-25. Therefore, art that teaches contacting the recited eukaryotic cell(s) (ES or iPS cells) with an effective amount of one or more guide RNAs comprising a sequence as set forth in SEQ ID NO: 2 and a DNA-targeting endonuclease, would read on the instant claim limitations. Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1,2,7-13,15 and 20-25 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2017160890, hereinafter “’890”, Published 21 Sept 2017, cited in a previous office action. See claim interpretation above. Regarding claims 1,7-10,20 and 23, ‘890 recites a method of altering a cell comprising contacting said cell with a gRNA molecule of any one of claims 1-33 and an RNA-guided nuclease (claim 194), further comprising contacting said cell with a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence complementary or partially complementary with a target domain located wholly or partially within an HBG1 or HBG1 regulatory region (claim 195), wherein the RNA-guided nuclease is a Cas9 molecule (claim 196), wherein the second gRNA molecule is a gRNA molecule of any one of claims 1-33. ‘890 recites a gRNA molecule comprising a targeting domain comprising a nucleotide sequence complementary or partially complementary with a target domain located wholly or partially within an HGB1 or HBG2 regulatory region (claim 1), and claim 8 recites the transcriptional regulatory element is a promoter, and claim 12 recites the gRNA molecule wherein the targeting domain comprising a nucleotide sequence identical to the nucleotide sequence set forth in any of SEQ ID NOs: 251-901. The gRNA molecule comprising the targeting domain of SEQ ID NO: 354 of ‘890 is a 100% identical to instant SEQ ID NO: 2. PNG media_image1.png 120 557 media_image1.png Greyscale Claim 218 of ‘890 recites the method comprises introducing an indel into an HBG target position. Regarding the eukaryotic cells which are embryonic stem cells (ES) or induced pluripotent stem cells (iPS), claim 212 recites the cell is from a subject suffering from a beta-hemoglobinopathy, and claim 214 recites the cell is an erythroid cell. ‘890 does not explicitly teach contacting embryonic stem cells (ES) or induced pluripotent stem cells (iPS) with the guide RNA of SEQ ID NO: 354, or that the CRISPR-associated endonuclease is pre-complexed with one or more guide RNA to form a ribonucleoprotein (RNP) complex. However, ‘890 teaches Cas9 molecules and gRNA molecules can be used to alter a target nucleic acid (e.g. HBG1, HBG2) regulatory region in a wide variety of cells, and alteration of a target nucleic acid in a target cell may be performed in vitro, ex vivo, or in vivo (page 125). ‘890 teaches suitable target cells can also include embryonic stem cells or induced pluripotent stem cells (page 127). Regarding claim 11, ‘890 teaches a Cas9 RNP containing gRNA targeting HPFH mutation which supports gene editing in human hematopoietic stem/progenitor cells (Example 2, page 158). Regarding claims 12,13,15,21,22,24 and 25, ‘890 recites a method of treating a beta-hemoglobinopathy selected from SCD and beta-Thal in a subject in need thereof, comprising contacting the subject or cell from the subject with a gRNA molecule of any one of claims 1-33 and an RNA-guided nuclease which is Cas9 (claims 257-259). ‘890 teaches the target cell is manipulated ex vivo by editing a gamma-globin gene regulatory region, then the target cell is administered to the subject (page 126). Claim 279 of ‘890 recites the method comprises introducing an indel into an HBG target position. Regarding the eukaryotic cells being embryonic stem cells (ES) or induced pluripotent stem cells (iPS), ‘890 does not explicitly teach contacting embryonic stem cells (ES) or induced pluripotent stem cells (iPS) with the guide RNA of SEQ ID NO: 354. However, ‘890 teaches Cas9 molecules and gRNA molecules can be used to alter a target nucleic acid (e.g. HBG1, HBG2) regulatory region in a wide variety of cells, and alteration of a target nucleic acid in a target cell may be performed in vitro, ex vivo, or in vivo (page 125). ‘890 teaches suitable target cells can also include embryonic stem cells or induced pluripotent stem cells (page 127). Therefore, it would be obvious to one of ordinary skill in the art to apply the method of ‘890 using a gRNA of SEQ ID NO: 354 and the Cas9 endonuclease to contact embryonic stem cells or induced pluripotent stem cells for the purpose of modifying the cells ex vivo for later administration for treatment. One of ordinary skill in the art would be motivated to contact the gRNA of SEQ ID NO: 354 and Cas9 endonuclease with embryonic stem cells or induced pluripotent stem cells because ‘890 teaches that Cas9 molecules and gRNA molecules can be used to altered a target nucleic acid (HBG1 or HBG2 regulatory region) in a wide variety of cells, including a hematopoietic stem/progenitor cell (page 126), an embryonic stem cell or induced pluripotent stem cell (page 127) and that these modified cells generated ex vivo can be administered to a subject (page 127). See above claim interpretation regarding the wherein clauses recited in claims 1,12 and 15. Although the reference is silent about the cleavage of the genomic DNA between positions -198 and -197 in the HBG1 or HBG2 promoter wherein positions -198 and -197 correspond to positions 13 and 14 in SEQ ID NO: 1, and wherein cleavage between these positions leads to an InDel of at least one base pair at these positions of the HBG1 or HBG2 promoter and thereby disrupts a binding site for LRF and wherein a resulting mutation caused by the InDel is not a substitution mutation, it does not appear that the claim language or limitations result in a manipulative difference in the method steps when compared to the prior art disclosure. See Bristol-Myers Squibb Company v. Ben Venue Laboratories, 58 USPQ2d 1508 (CAFC 2001). “It is a general rule that merely discovering and claiming a new benefit of an old process cannot render the process again patentable.” In re Woodruff, 16 USPQ2d 1934, 1936 (Fed. Cir. 1990). Granting a patent on the discovery of an unknown but inherent function would remove from the public that which is in the public domain by virtue of its inclusion in, or obviousness from, the prior art. In re Baxter Travenol Labs, 21 USPQ2d 1281 (Fed. Cir. 1991). See M.P.E.P. 2145. On this record, it is reasonable to conclude that the same cells are being contacted with the same agents by the same step of contacting the cells with said agents, in both the instant claims and the prior art reference. The fact that Applicant may have discovered yet another beneficial effect from the method set forth in the prior art does not mean that they are entitled to receive a patent on that method. Accordingly, the limitations of claims 1,2,7-10,20 and 23 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would be obvious to one of ordinary skill in the art at the time of the effective filing date, that the CRISPR-associated nuclease is pre-complexed with one or more gRNA to form a ribonucleoprotein (RNP) complex for the purpose of increasing thermostability. One of ordinary skill in the art would be motivated to provide the CRISPR-associated endonuclease and guide RNA of SEQ ID NO: 354 in the form of an RNP complex, as ’890 teaches that Cas9 RNP containing gRNA targeting the HPFH mutation supports gene editing in cells (Example 2 page 158), and would make obvious the limitations of claim 11. It would be obvious to one of ordinary skill in the art at the time of the effective filing date, to use the Cas9 endonuclease and gRNA of SEQ ID NO: 354 of ‘890 to contact a population of embryonic stem cells or induced pluripotent stem cells and administer to the subject a therapeutically effective amount of the population of cells, because ‘890 teaches the alteration of a target nucleic acid in a target cell may be performed ex vivo, or in vivo (page 125), and teaches that Cas9 molecules and gRNA molecules can be used to alter a target nucleic acid (e.g. HBG1, HBG2) regulatory region in a wide variety of cells (page 125) and that suitable target cells can also include embryonic stem cells or induced pluripotent stem cells (page 127). One would have been motivated to do so because ‘890 recites a method of treating a beta-hemoglobinopathy in a subject, including sickle-cell disease or beta-thalassemia by contacting the subject or a cell from the subject with a gRNA molecule and an RNA-guided nuclease which is a Cas9 molecule (claim 259). See above claim interpretation and explanation regarding the wherein clauses recited in claims 12 and 15 Accordingly, the limitations of claims 12,13,15,21,22,24 and 25 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Response to Arguments Applicant’s arguments and amendments, see page 7, filed 05/15/2026, with respect to the rejection(s) of claim(s) 1,7-10,20 and 23 under 35 U.SC. 102(a)(1) as anticipated by WO 2017160890 have been fully considered and are persuasive due to the amendment to claim 1 requiring the eukaryotic cells to be embryonic stem cells or induced pluripotent stem cells. Therefore, the rejection has been withdrawn as this limitation is not anticipated by ‘890. However, upon further consideration a new ground of rejection is made in view of the amendment to claim 1 regarding the recited cells based on a case of obviousness as claims 2,11-13,15,16,21,22 and 24 were previously rejected under 35 U.S.C. 103 as unpatentable over ‘890. Applicant argues on page 7 of response pertaining to the 103 rejections in general that one of ordinary skill in the art would recognize that a double-strand cut or break or break would be required for insertion or deletion of nucleotides within a target sequence and is exemplified by the disclosure in paragraph 0102 describing deletions of 4,6 and 1 nt and an insertion of 1 nt. One of ordinary skill in the art would also recognize that these deletions can be described as 4,6 or 1 bp and an insertion of 1 bp. InDel events were detected in the example of the invention as disclosed in paragraphs 0082-0083. Applicant states that independent claims 1,12 and 15 are amended to limit the cut to a double-stranded break and to add the limitation of “wherein a resulting mutation caused by the InDel is not a substitution mutation”. However, this is not found persuasive because the present claim amendments filed 05/15/2026 did not add the limitation “wherein a resulting mutation caused by the InDel is not a substitution mutation”. This limitation was added to claims 1,12 and 15 in the amendment filed 11/28/2025 so it is not a new claim amendment, and this limitation was addressed in the Non-final Office Action mailed 03/09/2026 in the Claim Interpretation section and 103 rejection on pages 8,13 and 14 of the office action. In addition, it is noted that ‘890 teaches and recites introducing an Indel into an HBG target position (claims 218 and 279). Applicant argues on page 8 that the claims are further amended to limit the DNA-targeting endonuclease cleavage to that occurring between the positions of -198 and -197 of the HBG1 or HBG2 promoters as disclosed in paragraph 0040, and the gRNA comprising the nucleotide sequence of SEQ ID NO: 2 directs cutting between the positions of -198 and -197. Claim 15 now limits the gRNA to one comprising SEQ ID NO: 2 and claim 10 is amended to apply this limit to claim 1. This is also not found persuasive, because the present claim amendments filed 05/15/2026 did not add the limitation regarding the DNA-targeting endonuclease cleavage to that occurring between the positions of -198 and -197 of the HBG1 or HBG2 promoters, claim 15 does not recite SEQ ID NO: 2, and claim 10 was not amended. The claims filed 11/28/2025 added these amendments and they were addressed by the Examiner in the Non-final Office Action mailed 03/09/2026 in the Claim Interpretation section and 103 rejection on pages 8,13 and 14 of the office action. In addition, Applicants arguments above state that “the gRNA comprising the nucleotide sequence of SEQ ID NO: 2 directs cutting between the positions of -198 and -197”. This is the same argument and explanation that the Examiner has provided in the Claim Interpretation and art rejections. A gRNA comprising the same sequence as instant SEQ ID NO: 2 would also direct cutting between the positions of -198 and -197 and would also carry out the other functional limitations without evidence to the contrary or unexpected results. The Examiner would also like to point out that "A 'whereby' clause that merely states the result of the limitations in the claim adds nothing to the patentability or substance of the claim." Texas Instruments, Inc. v. International Trade Comm., 988 F.2d 1165, 1172 (Fed. Cir. 1993). See also Minton v. National Assoc. of Securities Dealers, Inc., 336 F.3d 1373, 1381 (Fed. Cir. 2003) ("A whereby clause in a method claim is not given weight when it simply expresses the intended result of a process step positively recited."). Note MPEP 2111.04. This pertains to the argument that Examiner has made regarding the “wherein clauses” as being carried out as a result of the gRNA of the same structure of instant SEQ ID NO: 2, and is merely expressing a result of the method. Claims 1,2,6-13,15 and 20-25 are rejected under 35 U.S.C. 103 as being unpatentable over Martyn et al. (Nature Genetics, Vol. 50, 2018, pages 498-503) and US 20150056705 (‘705). See above claim interpretation. Regarding claims 1 and 2, Martyn et al. teach that some forms of hereditary persistence of fetal hemoglobin (HPFH) in which individuals express the gamma-globin gene throughout adulthood, are caused by point mutations in the gamma-globin gene promoter at regions residing -115 and 200 bp upstream of the transcription start site and that the major fetal globin gene repressor, ZBTB7A (also known as LRF) directly bound to the sites at -115 and 200 bp (Abstract). Martyn et al. teach that HPFH-associated point mutations are located in the proximal promoters of the duplicated gamma-globin genes, HBG1 and HBG2 (page 498, left column). Regarding the step in claim 1 of contacting the eukaryotic cell with an effective amount of a DNA-targeting endonuclease selected from the group consisting of a TALEN, ZNF or CRISPR-associated endonuclease whereby the DNA-targeting endonuclease cleaves the genomic DNA of the cell between positions -198 and -197 in the HBG1 or HBG2 promoter, as well as claims 7 and 8, Martyn et al. teach the introduction of hereditary persistence of fetal hemoglobin (HPFH)-associated mutations in a human erythroid cell line HUDEP2, using CRISPR-Cas9 genome editing, by introducing homozygous HPFH-associated mutation c.-195 C>G (page 498, right column; Fig 3A) and that these positions are located upstream of the gamma-globin gene in a region bound by LRF (Figure 5). Martyn et al. found that gamma-globin mRNA and HbF levels were elevated in the clonal populations with this mutation (page 498, right column; Fig 3A). Martyn et al. teach the CRISPR-Cas9 sgRNA target sites for introducing the c.-195C>G mutation into HUDEP-2 cells (Fig 3A). Martyn et al. teach that the cluster at -200bp of HPFH-associated mutations disrupts the binding of the zinc fingers of ZBTB7A (Figure 1e), and that the mutations fall into approximately 115 and 200bp upstream of the gamma-globin gene transcriptional start site (page 498, left column, Figure 1A). PNG media_image2.png 164 622 media_image2.png Greyscale Regarding claim 9, Martyn et al. teach CRISPR-Cas9 sgRNA target sites for introducing the c.-195C>G mutation into HUDEP-2 cells (Fig 3A). PNG media_image3.png 105 631 media_image3.png Greyscale Martyn et al. does not teach that the DNA-targeting endonuclease cleaves the genomic DNA of the cell between positions -198 and -197 in the HBG1 or HBG2 promoter wherein positions -198 and -197 correspond to positions 13 and 14 in SEQ ID NO: 1, the guide RNA sequence as set forth in SEQ ID NO: 2, that the eukaryotic cells are embryonic stem cells or induced pluripotent stem cells, or increasing fetal hemoglobin or treating a hemoglobinopathy in a subject. However, before the effective filing date, ‘705 teaches genome engineering by targeted nuclease-mediated genome cleavage at a desired location such as a double-stranded break created by a site-specific nuclease such as a zinc-finger nuclease (ZFN) or TAL effector domain nuclease (TALEN) ([0009]) as well as a CRISPR/Cas system that binds to a target site in a region of interest in an endogenous gene [0016,0017]. ‘705 teaches a method of modifying an endogenous gene which may be a beta globin gene (HBB) or gamma globin gene (HBG1) [0022], and methods for genome engineering to treat a disease including hemoglobinopathies [0041]. ‘705 teaches the target genes include genes involved in hemoglobinopathies and that genetic defects in sequences encoding hemoglobin chains can be responsible for hemoglobinopathies including sickle cell anemia and thalassemia [0042,0043]. ‘705 teaches correction of the human HBB gene that encodes beta globin can be accomplished with the CRISPR/Cas system of the invention [0046]. ‘705 teaches the methods in eukaryotic cells which are embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells [0023]. ‘705 also teaches an approach for treating SCD and beta thalassemia is to increase expression of the gamma-globin with the aim to have HbF functionality replace aberrant adult hemoglobin ([0047]) as well as an approach to increase expression of HbF by identifying genes whose products play a role in regulation of gamma-globin expression [0048]. ‘705 teaches sgRNAs used with the CRISPR/Cas system [0228]. ‘705 teaches Cas9 [0229] and an sgRNA of SEQ ID NO: 157 (Table 1, page 31), having a length of 23 nucleotides and which is 100% identical to the guide RNA of instant SEQ ID NO: 2. See alignment below wherein Qy is SEQ ID NO: 2 and Db is SEQ ID NO: 157: PNG media_image4.png 184 614 media_image4.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the method of Martyn et al. with the teachings of ‘705 using a gRNA of SEQ ID NO: 157 of ‘705 in order to increase HbF levels in embryonic stem cells or induced pluripotent stem cells. There would be a reasonable expectation of success because the structure of the guide RNA of SEQ ID NO: 157 of ‘705 is identical to the guide RNA of instant SEQ ID NO: 2, and would therefore perform the same function of recruiting the CRISPR associated endonuclease to the HBG1 or HBG2 promoters and generating double-strand breaks between positions -198 and -197 which correspond to positions 13 and 14 of instant SEQ ID NO: 1, and leading to an Indel of at least 1 bp at the positions -198 and -197 of the HBG1 or HBG2 promoter, thereby disrupting a binding site for LRF in the HBG1 or HBG2 promoter and wherein a resulting mutation caused by the Indel is not a substitution mutation. One of ordinary skill in the art would be motivated to use a gRNA of SEQ ID NO: 157 to cleave the genomic DNA between positions -198 and -197 in the HBG1 or HBG2 promoter in embryonic stem cells or induced pluripotent stem cells because Martyn et al. teach that hereditary persistence of fetal hemoglobin (HPFH)-associated mutations at positions located upstream of the gamma-globin gene in the HBG1 and HBG2 promoter region bound by LRF (Figure 5a) were associated with elevated HbF in cell populations with the HPFH-associated mutations, and that the cluster at -200bp of HPFH-associated mutations disrupts the binding of the zinc fingers of ZBTB7A (LRF) (Figure 1e). One of ordinary skill in the art would be motivated to provide the CRISPR-associated endonuclease and guide RNA of SEQ ID NO: 157 in the form of an RNP complex, as ’705 teaches Crispr-associated endonuclease with gRNA targeting an HBG1 gene (pages 73-74). Modifying the method of Martyn et al. with the teachings of ’705 using a gRNA of SEQ ID NO: 157 would make obvious the limitations of claims 1,2,7-11, 20 and 23. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the method of Martyn et al. with the teachings of ‘705 using a TALEN or ZFN as the DNA targeting nuclease and gRNA of SEQ ID NO: 157 with a reasonable expectation of success. There would be a reasonable expectation of success because the structure of the guide RNA of SEQ ID NO: 157 of ‘705 is identical to the guide RNA of instant SEQ ID NO: 2, and would therefore perform the same function of recruiting the TALEN or ZFN to the HBG1 and HBG2 promoters and cleave the genomic DNA of the cell between positions -198 and -197 which correspond to positions 13 and 14 of instant SEQ ID NO: 1, and forming an Indel of at least 1 bp, thereby disrupting a binding site for LRF in the HBG1 or HBG2 promoter and wherein a resulting mutation caused by the Indel is not a substitution mutation. One of ordinary skill in the art would have been motivated to use a TALEN or ZFN as the DNA-targeting endonuclease in the method, because ‘705 teaches genome engineering by targeted nuclease-mediated genome cleavage at a desired location such as a double-stranded break created by a site-specific nuclease such as a zinc-finger nuclease (ZFN) or TAL effector domain nuclease (TALEN), and is therefore a known and obvious way to use TALEN and ZNFs, and would make obvious the limitations of claim 6. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the method of Martyn et al. with the teachings of ‘705 using a gRNA of SEQ ID NO: 157 and contact the embryonic stem cells or induced pluripotent stem cells of ‘705 with the gRNA of SEQ ID NO: 157 and the CRISPR-associated nuclease and administering said cells to a subject, for the purpose of treating a hemoglobinopathy in a subject by increasing HbF levels. There would be a reasonable expectation of success because the structure of the guide RNA of SEQ ID NO: 157 of ‘705 is identical to the guide RNA of instant SEQ ID NO: 2, and would therefore perform the same function of recruiting the CRISPR associated endonuclease to the HBG1 and HBG2 promoters and generating double-strand breaks between positions -198 and -197 which correspond to positions 13 and 14 of instant SEQ ID NO: 1, as well as resulting in forming an insertion or deletion of at least 1 base pair, including a 1-bp insertion, a 1-bp deletion or a 2-bp deletion, and would also result in disrupting a binding site for LRF in the HBG1 or HBG2 promoter, and the resulting mutation caused by the Indel would not be a substitution mutation. One of ordinary skill in the art would have been motivated to do so because Martyn et al. teach that hereditary persistence of fetal hemoglobin (HPFH)-associated mutations at positions located upstream of the gamma-globin gene in the HBG1 and HBG2 promoter region bound by LRF (Figure 5a) were associated with elevated HbF in cell populations with the HPFH-associated mutations, and that the cluster at -200bp of HPFH-associated mutations disrupts the binding of the zinc fingers of ZBTB7A (LRF) (Figure 1e) and ‘705 teaches genome editing using CRISPR-Cas systems in the HBG1 gene for treatment of hemoglobinopathies including sickle cell anemia and thalassemia [0042,0043] and ways to increase expression of HbF. Modifying the method of Martyn et al. with the teachings of ‘705 using a gRNA of SEQ ID NO: 157 would make obvious the limitations of claims 12,13,15,21,22,24 and 25. Therefore, the invention as a whole would have been prima facie obvious before the time of the effective filing date. Response to Arguments Applicant’s arguments and amendments, see pages 7-8, filed 05/15/2026 with respect to the rejection(s) of claim(s) 1,2,6-13,15,16 and 20-22 under 35 U.S.C. 103 as unpatentable over Martyn et al. and ‘705 have been fully considered but are not persuasive. The arguments regarding the 103 rejections and the amendments to the claims on pages 7-8 of the response have been provided in the response to arguments above regarding the 35 U.S.C. 103 rejection over ‘890. Applicant further argues on page 8 that Martyn teaches a -195 C>G substitution mutation but fails to teach a double-strand break that could result in an InDel between -198 and -197 as now claimed and Martyn also fails to teach a gRNA having the sequence identity of “ATTGAGATAGTGTGGGGAAGGGG” and the teachings of ‘705 do not cure these defects. The target sequences taught in Martyn and ‘705 overlap with the target sequences disclosed in the present specification, however ‘705 fails to teach a gRNA having the sequence of SEQ ID NO: 29. This is not found persuasive. Regarding the argument that Martyn does not teach a double-strand break that could result in an InDel between -198 and -197 and does not teach a gRNA of the recited sequence, One cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., Inc., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Where a rejection of a claim is based on two or more references, a reply that is limited to what a subset of the applied references teaches or fails to teach, or that fails to address the combined teaching of the applied references may be considered to be an argument that attacks the reference(s) individually. Where an applicant’s reply establishes that each of the applied references fails to teach a limitation and addresses the combined teachings and/or suggestions of the applied prior art, the reply as a whole does not attack the references individually as the phrase is used in Keller and reliance on Keller would not be appropriate. This is because "[T]he test for obviousness is what the combined teachings of the references would have suggested to [a PHOSITA]." In re Mouttet, 686 F.3d 1322, 1333, 103 USPQ2d 1219, 1226 (Fed. Cir. 2012). Applicant’s argument that the teachings of ‘705 do not cure these defects is not true, and Applicant argues that ‘705 fails to teach a gRNA having the sequence of SEQ ID NO: 29. However SEQ ID NO: 29 is not claimed, and therefore the Examiner believes that this was intended to say SEQ ID NO: 2. However, this is also not true because as shown in the rejection above and was also provided in the previous rejection, ‘705 teaches an sgRNA of SEQ ID NO: 157 (Table 1, page 31) having 100% identity to the guide RNA of instant SEQ ID NO: 2. Given the previous and current claim interpretation, the recited functions would be carried out by a guide RNA having the same structure required by instant SEQ ID NO: 2. In addition, Applicants arguments on page 8 state that “the gRNA comprising the nucleotide sequence of SEQ ID NO: 2 directs cutting between the positions of -198 and -197”. This is the same argument and explanation that the Examiner has provided in the Claim Interpretation and art rejections. A gRNA comprising the same sequence as instant SEQ ID NO: 2 would also direct cutting between the positions of -198 and -197 and would also carry out the other functional limitations without evidence to the contrary or unexpected results. Therefore, the rejection is maintained. Conclusion Claims 1,2,6-13,15 and 20-25 are rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Show 9 earlier events
Feb 03, 2025
Non-Final Rejection mailed — §103, §112
Apr 23, 2025
Response Filed
Jul 03, 2025
Final Rejection mailed — §103, §112
Nov 28, 2025
Request for Continued Examination
Dec 02, 2025
Response after Non-Final Action
Mar 09, 2026
Non-Final Rejection mailed — §103, §112
May 15, 2026
Response Filed
Jul 14, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12655432
OLIGONUCLEOTIDES FOR SOD1 MODULATION
3y 7m to grant Granted Jun 16, 2026
Patent 12655461
BIOSENSORS FOR SELECTIVELY IDENTIFYING AZIDE IONS
3y 6m to grant Granted Jun 16, 2026
Patent 12649939
NOVEL PROCESSES FOR THE PRODUCTION OF OLIGONUCLEOTIDES
6y 0m to grant Granted Jun 09, 2026
Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
3y 4m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
4y 10m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
59%
Grant Probability
98%
With Interview (+39.6%)
3y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 70 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month