DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on February 10, 2026 has been entered.
Status of Claims / Response to Amendment
This office action is in response to an amendment filed on February 10, 2026.
Claims 1-2, 8-11, 13-27, 30-35, 37-38, 40-41, 44-47, 51, and 56-64 were previously pending. Applicant amended claims 22, 32-33, 37; cancelled claims 1-2, 8-11, 13-21, 51 and 56-61; claims 65-80 are newly added.
Claims 22-27, 30-35, 37-38, 40-41, 44-47, 62-80 are currently pending, with claims 27, 31-35, 37-38, 40-41, 44, 47, 62-63, 68, 73, 75, 77-80 withdrawn.
Claims 22-26, 30, 45-46, 64-67, 69-72, 74 and 76 are under consideration.
All of the amendment and arguments have been thoroughly reviewed and considered. All of the previously presented rejections have been withdrawn as being obviated by the amendment of the claims.
Applicant's amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
This office action contains new grounds for rejection necessitated by amendment.
Election/Restrictions
Applicant's prior election without traverse of the following species in the reply filed on June 04, 2024 is acknowledged in light of the amended claims filed on February 10, 2026, which added new claims that are directed to non-elected species.
This application contains claims directed to the following patentably distinct species 1:
Species of fragmenting
S) fragmenting comprises tagmenting to produce tagged fragments (claim 27, and new claims 68, 75, 77-80);
T) fragmenting comprises shearing (claim 30);
U) fragmenting comprises sonication (claim 30);
V) fragmenting comprises enzymatic fragmentation (claim 30).
Species of cDNA synthesis primer
P) cDNA synthesis primer comprises a reverse amplification primer site (claim 23);
Q) cDNA synthesis primer comprises an oligo-dT RNA binding site (claim 24);
R) cDNA synthesis primer comprises a gene specific RNA binding site (claims 24, and new claim 73).
Among the listed species above, Applicant has previously elected, without traverse, the species "V) fragmenting comprises enzymatic fragmentation" for "Species of fragmenting" and the species "P) cDNA synthesis primer comprises a reverse amplification primer site" for "Species of cDNA synthesis primer " (Response to Election / Restriction Filed - 06/04/2024).
It is noted that new claims 68, 75 and 77-80 are drawn to the non-elected species S, "fragmenting comprises tagmenting to produce tagged fragments," within the species of fragmenting. 2 Additionally, new claim 73 is drawn to the non-elected species R " cDNA synthesis primer comprises a gene specific RNA binding site" within the species of cDNA synthesis primer.
Accordingly, new claims 68, 73, 75 and 77-80 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions.
Priority
The priority date of the instant claims 22-26, 30, 45-46, 64-67, 69-72, 74 and 76 is December 28, 2018, filling date of the Swedish Patent Application Number 1851672-4, to which the present application claims priority.
Claim Objections
Claim 69 is objected to because of the following informalities:
In claim 69, line 1, "the multiple nucleotides" should read "the multiple predefined nucleotides."
Claim Interpretation -- Updated
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purposes of applying prior art, claim 22 has been amended to recite a template switching oligonucleotide (TSO) comprising: "from a 5' end to a 3' end: an amplification primer site, an identification tag, a unique molecular identifier (UMI) and multiple predefined nucleotides."
The term "identification tag" is not expressly defined in the application's disclosure. The specification at page 25 (lines 29-35) provides relevant description, noting that the identification tag may also serve as the amplification primer site:
"In some embodiments, the TSO comprises, from a 5′ end to a 3′ end, the amplification primer site, the identification tag, the UMI and the multiple predefined nucleotides. In some embodiments, the identification tag may serve as the amplification primer site (i.e., where the identification is employed as both an identification tag and an amplification primer site), such that the TSO includes a novel identification tag, UMI and the multiple predefine nucleotides. In such instances, the TSO does not include separate amplification primer site. As such, in some instances the TSO comprises a unique identification tag that can identify 5′ reads from complex mixtures, a UMI, and multiple predefined nucleotides, such as three rGs, wherein the unique identification tag also serves as a primer site for PCR amplification." [emphasis added]
Accordingly, in light of the specification and under BRI, the "identification tag" and "amplification primer site" at the 5' end of a TSO are interpreted as can be the same element or separate elements.
For the purposes of applying prior art, claim 22 recites "nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments." The applicant's disclosure does not define the terms "nucleic acid fragments," "first population of 5' UMI comprising fragments," and "second population of internal fragments" with structural detail.
In view of Applicant's remarks in Amendments filed on September 30, 2024, the "5' UMI comprising fragment" and "internal fragments" are interpreted as separate, broken-off fragments of a cDNA resulting from fragmentation, and are no longer physically attached to each other.
For the purposes of applying prior art, Claim 23 recites the term "reverse amplification primer site," which is not defined in the applicant's disclosure. Page 28 of the specification provides the following description regarding "reverse amplification primer" (page 28, lines16-30):
"Fig. 1A shows the reverse transcription and template switching reaction of steps S1 and S2 in Fig. 8. In an embodiment, the method also comprises amplifying the extended cDNA strand using a forward primer (also referred to as first forward primer or first forward amplification primer herein) and a reverse primer (also referred to as first reverse primer or first reverse amplification primer herein), which is schematically illustrated as PCR pre- amplification in Fig. 1A."
Thus, in light of the specification and under BRI, the term "reverse amplification primer site" is interpreted as "a site that corresponds to a primer."
Claim Rejections - 35 USC § 112(b) -- New
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 66 and 74 is rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A) Regarding claim 66, it recites "wherein the identification tag comprises a nucleotide sequence comprising ATTGCGCAATG (SEQ ID NO: 3)," which is indefinite because it is unclear what nucleotide sequence the identification tag is required to comprise.
The issue arise because "ATTGCGCAATG" and SEQ ID NO: 3 correspond to entirely different sequences that do not share sequence similarity.
According to the sequence listing, SEQ ID NO: 3 is a 33-nucleotide sequence that does not comprise or overlap with "ATTGCGCAATG."
Title: US-17-276-718-3
Sequence: 1 acactctttccctacacgacgctcttccgatct 33
It is therefore unclear whether the claim requires the identification tag to comprise the sequence "ATTGCGCAATG," the sequence set forth in SEQ ID NO: 3, or some other sequence.
Because the claim language presents inconsistent nucleotide sequence and identifier, the metes and bounds of the claimed subject matter cannot be determined with reasonable certainty and without applying considerable speculation and assumption. Consequently, claim 66 is excluded from prior art search in this examination, as any rejection based on prior art cannot be based on speculations and assumptions, see In re Steele, 305 F.2d 859, 862 (CCPA 1962).
B) Regarding claim 74, it recites "wherein the forward primer comprises the TSO amplification primer site and the identification tag." This claim language is indefinite because it is unclear whether the recited forward primer comprises sequences that are structurally identical to the "amplification primer site" and "identification tag" of the TSO, or whether it comprises sequences complementary to those regions.
According to base claim 26/25/22, the TSO is a separate oligonucleotide to which the forward primer is expected to hybridize. For hybridization to occur, complementary sequences are required rather than identical sequences. As written, the claim suggests that the forward primer comprises the same "amplification primer site" and "identification tag" of the TSO, which would not ordinarily permit hybridization unless the sequence is palindromic.
Accordingly, it is unclear whether the limitation requires the forward primer to include sequences identical to those of the TSO, sequence complementary thereto, or palindromic sequences. As such, the scope of this claim is indefinite.
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, the forward primer is interpreted to encompass sequences complementary to the TSO amplification primer site and identification tag.
Claim Rejections - 35 USC § 103 -- New
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 22-26, 30, 45-46, 64-65, 67, 69-70, 74 and 76 are rejected under 35 U.S.C. 103 as being unpatentable over Abate (US20170009274A1- Sequencing of Nucleic Acids via Barcoding in Discrete Entities; Published on 2017-01-12), in view of
Clement (Clement et al., AmpUMI: design and analysis of unique molecular identifiers for deep amplicon sequencing, Bioinformatics, Volume 34, Issue 13, July 2018, Pages i202–i210, doi.org/10.1093/bioinformatics/bty264);
Batut (Batut et al. RAMPAGE: promoter activity profiling by paired-end sequencing of 5'-complete cDNAs. Curr Protoc Mol Biol. 2013 Nov 11;104:Unit 25B.11. doi: 10.1002/0471142727.mb25b11s104. PMID: 24510412; PMCID: PMC4372803);
Islam (Islam et al. . Quantitative single-cell RNA-seq with unique molecular identifiers. Nat Methods. 2014 Feb;11(2):163-6. doi: 10.1038/nmeth.2772. Epub 2013 Dec 22. PMID: 24363023);
Dunne (Dunne et al. US20170136458A1- Systems and methods for pooling samples from multi-well devices; Pub Date: 2017-05-18);
as evidenced by
Karlsson (Karlsson et al., Single-cell mRNA isoform diversity in the mouse brain. BMC Genomics 18, 126 (2017). doi.org/10.1186/s12864-017-3528-6);
van Buggenum (van Buggenum et al. Immuno-detection by sequencing enables large-scale high-dimensional phenotyping in cells. Nat Commun 9, 2384 (2018). ; doi.org/10.1038/s41467-018-04761-0).
A) Abate teaches methods for deep sequencing of long-length molecules, such as full-length mRNA (entire document, see Fig 12 for example).
Specifically, Abate discloses performing whole transcriptome amplification using SMARTer technology, which leverages the terminal transferase activity of reverse transcriptase enzymes and a template switching oligo (TSO) to add a unique molecular identifier (UMI) to the 3' end of cDNA, which corresponds to the 5' end of the mRNA transcript (Example 3; [1334]; see also Example 11). This barcodes mRNA at the molecular level. This process generating full-length transcriptome cDNAs with UMI is followed by an approach referred to as "single molecule deep sequencing" (SMDS) ([1346]; [0160]-[0161]; [0169]), which involves enzymatic fragmentation and sequencing library construction for next-generation sequencing (NGS), as demonstrated in Examples 8 and 11 (see [1345-1450] for detailed protocol for SMDS with single DNA templates; see [1461] for single cell whole transcriptome sequencing with UMI).
The SMDS approach includes amplification of single molecules in droplets, such as the full-length cDNA generated via SMARTer reverse transcription. After enzymatic fragmentation and ligation ([1374-1391]), barcodes and PCR handles are attached to fragmentated DNA molecules ([1405]-[1434]). Each sequencing read for a fragment carries a barcode, and the 5' end sequencing read for each full-length molecule additionally includes a UMI.
These features facilitate the assembly of sequencing reads into the original full-length molecule because fragments originating from the same droplet will share matching barcodes ([1348];[1458]). Additionally, within these fragments, unique molecule reads can be further distinguished by UMIs in cases where multiple cDNA templates are present in a single droplet ([0124]).
Abate further highlights the benefit of its SMDS method, such as capability of performing deep sequencing of long, individual molecules using available, low cost technologies, "while still having the ability to aggregate reads corresponding to long single molecules without having to rely on assembly algorithms prone to failure." ([1346])
Regarding claim 22, Abate teaches a method for preparing nucleic acid fragments, the method comprising:
producing a population of double stranded cDNAs(Fig. 12; [1205]),
wherein the double stranded cDNAs in the population of double stranded cDNAs are formed by:
hybridizing a cDNA synthesis primer to a ribonucleic acid (RNA) molecule and synthesizing a cDNA strand complementary to at least a portion of the RNA molecule to form an RNA-cDNA intermediate (Fig. 12; [1205 - 1208]);
performing a template switching reaction by contacting the RNA-cDNA intermediate with a template switching oligonucleotide (TSO) under conditions suitable for extension of the cDNA strand (Fig. 12; [1227]) using the TSO as a template to form an extended cDNA strand complementary to the at least a portion of the RNA molecule and the TSO (Fig. 12),
wherein the TSO comprises from a 5' end to a 3' end: an amplification primer site (Fig. 12; [1205] lines 21-22), an identification tag (Fig. 12; [1205] lines 20-22, conserved sequence identifying 5’ end of RNA transcript in cDNA), a unique molecular identifier (UMI) (Fig. 12; [1205]; lines 13-17) and multiple predefined nucleotides (Fig. 12; [1205] riboguanosines at 3’ end ) that function as a template for the template switching reaction ;and
producing double-stranded cDNA from the extended cDNA strand (Fig. 12);
fragmenting the population of double-stranded cDNA to produce nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments([0160]-[0161]; [0169]; [0157-0158]; [1205]; [0210] ; [1374] fragmentation of cDNA produced in example 3 from Fig. 12, thereby producing produce nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments, see Fig 16);
sequencing (Fig. 21) the first population of 5' UMI comprising fragments([1461]) and the second population of internal fragments (Fig. 21-22; [0221]).
Claim 22 has been amended to recite "wherein the TSO comprises from a 5' end to a 3' end: an amplification primer site, an identification tag, a unique molecular identifier (UMI) and multiple predefined nucleotides that function as a template for the template switching reaction."
Abate in Fig. 12 illustrates template switch oligo comprising a 5’ sequence, UMI, and “GGG” on the 3’ end. Description for Fig. 12 in para. [1205] indicates TSO serve as templet for reverse transcription (lines 7-12) also comprises conserved sequences which is “added to all cDNA it can be used as a common priming site for whole transcriptome amplification by PCR” (lines 20-23). Therefore, the skilled artisan in view of these teachings would readily understand that the TSO sequence depicted at the 5’ end of TSO in Fig. 12 of Abate are the described conserved sequences, also comprising priming site for PCR.
Also, template switching oligos comprising, from 5’ end to 3’ end, a conserved sequence comprising primer site, UMI, and predefined nucleotides, such as three rGs, cannot be a point of novelty as it is well-known and commonly used in the field of cellular RNA-sequencing, this is supported by Batut, Islam and Dunne.
Batut teaches Template switching oligos designed with a sequence structure comprising a conserved pcr handle sequence and UMI (“5′-TAGTCGAACTGAAGGTCTCCAGCANNNNNNrGrGrG” ) (page 4).
Islam similarly teaches Template switching oligos having sequence “Bio-AAUGAUACGGCGACCACCGAUNNNNNGGG” (supplementary table 2), where “AAUGAUACGGCGACCACCGAU” is a conserved PCR primer binding site.
Dunne also teaches in its single-cell sequencing system, TSO comprises: A) a 3′ poly-G region, B) a unique molecular identifier (UMI), and C) a second 5′ tail region, wherein the second 5′ tail region binds to first index primer ([0010]).
Therefore, as discussed above, sequencing methods using TSOs comprising, from 5' to 3', a conserved sequence comprising a primer site, a UMI, and multiple predefined nucleotides are taught by Abate and were well-known in the art.
As currently interpreted under BRI, the claimed "identification tag" may be the same as the amplification primer site (see claim interpretation section above for detailed discussion).
Regarding the limitation "identifying reads that belong to the 5' UMI comprising fragments by recognition of the identification tag," Abate does not explicitly recite this step. However, this UMI read-identification approach would have been obvious in view of Abate in combination with well-known sequencing data analysis techniques, particularly those relating to UMI identification.
As discussed above, Abate teaches generating sequencing reads that include a 5' UMI and a known conserved sequence adjacent to the UMI, such as an amplification primer site (Fig. 12; [1205]). A person of ordinary skill in the art would have recognized that this conserved sequence could serve as an identification tag for locating UMI in the reads and identifying the UMI containing sequencing reads.
The use of regular expression-based approach (i.e., sequence matching) in sequencing data analysis is well-established, including for UMI identification. In typical practice, a known, conserved sequence within a read serves as an anchor or identification tag, to determine the sequence and position of an adjacent variable UMI sequence, which has a fixed relative position. For example, in a read design such as "CCAGCANNNNNN," (the six N-mers representing UMI), the conserved sequence "CCAGCA" in a hypothetical read comprising "CCAGCAATCGGA" identifies that the following six nucleotides "ATCGGA" correspond to the UMI 3. The commonality of this practice in sequencing data analysis is evidenced by Karlsson and van Buggenum.
Karlsson discloses identifying UMIs in RNA sequencing reads based on their relative position to a known Illumina adapter sequence, which functions as an amplification primer site (page 8, right-hand col, para 2, lines 7-16).
van Buggenum teaches parsing sequencing reads using a common anchor sequence to identify the position of a UMI (page 9, right-hand col, para. 4, liens 5-7).
Accordingly, a person of ordinary skill in the art would have readily appreciated that the conserved amplification primer site sequence at the 5' position of the UMI in Abate's teaching, could also be used as "identification tag" to identify UMI-containing reads.
Tools for carrying out such read-identification steps were also available prior to the effective filling date. Clement teaches an open-source software tool, "AmpUMI," based on regular expression principles for flexible UMI identification in sequencing data (Abstract; page i204, right hand col, para 1, lines 2-9).
Clement further highlights advantages of AmpUMI, including flexibility
allowing researchers to adapt the software to their specific UMI and sequencing design; reducing noise and sequencing errors; and duplicate reads removal for easy integration with downstream analysis (page i209, right-hand col, para. 3).
Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to apply UMI identification in the sequencing methods of Abate, using the conserved primer amplification site at the 5' position of the UMI from TSO sequence as the identification tag, in combination with the flexible UMI-identification tool taught in Clement.
The skilled artisan would have been motivated to do so because the use of a conserved sequence at fixed position for UMI identification in sequencing reads was commonly practiced, and Clement provides a software tool for such practice, with clear advantages such as flexibility, error reduction, and compatibility with downstream analysis.
The person of ordinary skill would have had a reasonable expectation of success in making this modification because Clement expressly teaches that its AmpUMI is flexible and can be adapted to specific UMI sequencing designs. Thus, a skilled artisan would have reasonably expected that this tool could be applied to sequencing data generated according to the teachings of Abate.
B) Regarding claim 23, Abate teaches the cDNA synthesis primer comprises a reverse amplification primer site ([1208], [1215]).
Regarding claim 24, Abate teaches the cDNA synthesis primer comprises an oligo-dT RNA binding site (Fig. 12; [1208]).
Regarding claim 25, Abate teaches producing double-stranded cDNA comprises amplifying ([1205]; Fig. 12).
Regarding claim 26, Abate teaches amplifying comprises employing a forward primer that hybridizes to the TSO amplification primer site and a reverse primer that hybridizes to the cDNA synthesis primer comprising a reverse amplification primer site (Fig. 12; [1235]).
Regarding claim 30, Abate teaches enzymatic fragmentation ([1374).
Regarding claim 45, Abate teaches wherein hybridizing the cDNA synthesis primer comprises hybridizing the cDNA synthesis primer to the RNA molecule and synthesizing the cDNA strand by reverse transcription to form the RNA-cDNA intermediate; and performing the template switching reaction comprises performing the template switching reaction by contacting the RNA-cDNA intermediate with the TSO under conditions suitable for extension of the cDNA strand by reverse transcription to form the extended cDNA strand (Fig 12; [1205]).
Regarding claim 46, Abate teaches the reverse transcription is conducted in the presence of guanine ribonucleotides ([1231]).
Regarding claim 64, Abate teaches the identification tag is a nucleotide sequence (Fig. 12; [1205] lines 20-22, conserved sequence identifying 5’ end of RNA transcript in cDNA).
Regarding claim 65, Batut teaches using human RNA samples (page 18, line 10), and teaches Template switching oligos designed with a sequence structure comprising a conserved pcr handle sequence and UMI (“5′- TAGTCGAACTGAAGGTCTCCAGCANNNNNNrGrGrG” ) (page 4). The conserved sequence “TAGTCGAACTGAAGGTCTCCAGCA” does not exist in human cell transcriptome, as it does not align with any human transcriptome sequence with 100% identity.
Regarding claim 67, Abate teaches short-read sequencing method (Fig. 7).
Regarding claim 69, Abate teaches wherein the multiple nucleotides are three guanine ribonucleotides (Fig. 12; [1205] riboguanosines at 3’ end).
Regarding claim 70, Abate teaches oligo-dT primer (Fig. 28).
Regarding claim 74, Abate teaches the forward primer comprises sequence complementary to TSO amplification primer site and the identification tag (Fig. 12; [1205] “the conserved sequence in the TSO oligo is added to all cDNA it can be used as a common priming site for whole transcriptome amplification by PCR (4).”).
Regarding claim 76, Abate teaches amplifying is performed simultaneously to the template switching reaction ([0270] lines 6-12, cDNA synthesis, barcoding, and amplification in a single step).
Claims 71-72 are rejected under 35 U.S.C. 103 as being unpatentable over Abate, in view of Clement with Batut, Islam and Dunne, as applied to claim 70/22 above and further in view of Invitrogen (Anchored Oligo(dT)20 Primer; 2003).
A) The teachings of Abate, Clement with Batut, Islam and Dunne are recited above and applied as for base claims 22 and 70.
Regarding claim 71, it recites "wherein the cDNA synthesis primer is an anchored oligo-dT primer."
Abate teaches using oligo-dT primer (e.g., Fig. 28). While the combined teachings of Abate, in view of Clement with Batut, Islam and Dunne does not explicitly teach anchored oligo-dT primer, this limitation is obvious in view of Invitrogen.
Invitrogen teaches anchored Oligo-dT primer consisting of a string of 20 deoxythymidylic acid (dT) residues followed by two additional nucleotides represented by VN, where V is dA, dC, or dG and N is dA, dC, dG or
dT (page 1).
Invitrogen further highlights benefit of its anchored Oligo-dT primer, such as more efficient cDNA synthesis:
“The VN anchor allows the primer to anneal only at the 5′ end of the poly(A) tail of mRNA, providing more efficient cDNA synthesis for labeling, first-strand synthesis, and RT-PCR applications.” (page 1, Description, lines 4-6)
Therefore, motivated by the potential improvement in cDNA synthesis using anchored Oligo-dT primer, as suggested by Invitrogen, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to substitute the Oligo-dT primer used in the combined teachings of Abate, in view of Clement with Batut, Islam and Dunne, with the anchored Oligo-dT primer disclosed in Invitrogen.
b) Regarding claim 72, Invitrogen teaches the anchored oligo-dT primer comprises from a 5' end to a 3' end: a primer site, Tp, V, and N, wherein V is selected from the group consisting of A, C and G, N is selected from the group consisting of A, C, G and T, and p is a positive number selected from within an interval from 10 to 50 (page 1).
Conclusion
Claim 69 is objected to; Claims 22-26,30,45-46,64-67,69-72,74 and 76 are rejected. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 The species are independent or distinct because they are presented as alternatives that do not depend form each other, thus there is no disclosure of relationship between species (see MPEP § 806.04(b)). In addition, these species are not obvious variants of each other based on the current record. The species necessitate separate searches, leading to serious search and/or examination burden (see MPEP § 808.01(a)) because the species of fragmenting reflect different method for fragmentation, requiring separate searches; the species of cDNA synthesis primer reflect the different structures and functions of these cDNA synthesis primer.
There is a serious search and/or examination burden for the patentably distinct species as set forth above because at least the following reason(s) apply: The species require a different field of search (e.g., searching different classes/subclasses or electronic resources, or employing different search queries); and/or the prior art applicable to one species would not likely be applicable to another species; and/or the species are likely to raise different non-prior art issues under 35 U.S.C. 101 and/or 35 U.S.C. 112, first paragraph.
2 Evidence supporting the primer structures in claims 68 and 75 as specifically for embodiment using tagmentation fragmentation, can be found in the specification on page 26, lines 1-11 and page 29.
3 For more example see github.com/pinellolab/AmpUMI