Prosecution Insights
Last updated: August 06, 2026
Application No. 17/276,718

METHOD AND KIT FOR PREPARING COMPLEMENTARY DNA

Final Rejection §103
Filed
Mar 16, 2021
Priority
Dec 28, 2018 — SE 1851672-4 +1 more
Examiner
YU, TIAN NMN
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Omid Faridani
OA Round
7 (Final)
55%
Grant Probability
Moderate
8-9
OA Rounds
0m
Est. Remaining
74%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allowance Rate
47 granted / 85 resolved
-4.7% vs TC avg
Strong +19% interview lift
Without
With
+18.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
74 currently pending
Career history
145
Total Applications
across all art units

Statute-Specific Performance

§101
10.8%
-29.2% vs TC avg
§103
30.9%
-9.1% vs TC avg
§102
16.9%
-23.1% vs TC avg
§112
30.7%
-9.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 85 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of claims / Response to Amendment This office action is in response to an amendment filed on June 09, 2026. Claims 22-27, 30-35, 37-38, 40-41, 44-47, 62-80 were previously pending. Applicant amended claims 66, 69 and 74. Claims 22-27, 30-35, 37-38, 40-41, 44-47, 62-80 are currently pending, with claims 27, 31-35, 37-38, 40-41, 44, 47, 62-63, 68, 73, 75, 77-80 withdrawn. Claims 22-26, 30, 45-46, 64-67, 69-72, 74 and 76 are under consideration. Applicant's claim amendments overcame the following objection and rejections: Objection to Claim 69; Rejections of Claims 66 and 74 under 35 U.S.C. 112(b). All other previously presented rejections are maintained for reasons given in the "Response to Arguments" below. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Response to Arguments Applicant's arguments filed on June 9, 2026 have been fully considered. Response to Arguments: Claim Rejections - 35 USC § 103 The following rejections initially presented in the Non-final office action mailed on March 11, 2026 are maintained in this office action: Rejections of Claims 22-26, 30, 45-46, 64-65, 67, 69-70, 74 and 76 under 35 U.S.C. 103 as being unpatentable over Abate, in view of Clement; Batut; Islam; Dunne; as evidenced by Karlsson and van Buggenum. Rejections of Claims 71-72 under 35 U.S.C. 103 as being unpatentable over Abate, in view of Clement with Batut, Islam and Dunne, as applied to claim 70/22 above and further in view of Invitrogen. These rejections are maintained in this Office Action for reasons below. Applicant argues that the rejections above should be withdrawn (Remarks, page 10-20). Applicant's arguments have been fully considered but are not found persuasive. Applicant asserts that the claimed method in claim 22 would not have been obvious. Applicant argues that, because Abate teaches, in Fig. 12, all cDNA products comprise a UMI and conserved sequence (Abate, paragraph [1205]), based on Abate alone, there is no teaching or suggestion of using Abate's conserved TSO sequence as a 5' identification tag, since there is no need to differentiate between 5' fragments and internal fragments as Abate's cDNA pool consists solely of 5' fragments. (Remarks, p. 14) Applicant further argues that the remaining references also do not provide a reason to use a conserved sequence to differentiate between 5' fragments and internal fragments. (Remarks, p. 14-19). This argument is not persuasive because it relies on a feature that is not required by the claim and mischaracterizes the teachings of Abate. First, the core issue is that the asserted step of "differentiating between 5' fragments and internal fragment" is not required by the claim1. Rather, the claim recites a method of generating and tagging a cDNA with an UMI, and requires "identifying reads that belong to the 5' UMI comprising fragments by recognition of the identification tag." Thus, the claimed step encompasses identifying reads that belong to fragments comprising the same UMI used to tag cDNA originated from a specific RNA transcript. To do so, reads sharing a common UMI must be identified. As explained in the rejection, the UMIs are random sequences that are not pre-defined. Therefore, a skilled artisan would have found it obvious to relied on recognition of a conserved anchor sequence within the read, to identify reads containing the relevant UMI. Accordingly, the limitation "identifying reads that belong to the 5' UMI comprising fragments by recognition of the identification tag" would have been obvious. Second, Applicant's argument mischaracterizes Abate, which expressly teaches sequencing reads that do not contain a UMI. Applicant relies on Fig. 12, but Fig. 12 represents only part of the method of Abate, specifically whole transcriptome amplification and mRNA barcoding with UMI. The method does not end there. As explained in the rejection (Non-Final Office Action - 03/11/2026, p. 11-12), Abate further teaches fragmentating the UMI labeled DNA and barcoding the resulting fragments for sequencing. As summarized in para.[0221], Abate teaches first attaching UMIs to full-length target nucleic acids, encapsulating the UMI-labeled target nucleic acids in discrete entities, and then fragmenting and barcoding the fragments (see also [0222-[0225]). Abate also expressly teaches bioinformatically assembling sequencing reads, including reads that contain the barcode but do not contain a UMI: [0221] Accordingly, in some embodiments the present disclosure provides a method for barcoding nucleic acid target molecules, wherein the method includes: (a) attaching a unique molecular identifier (UMI) molecule to each of a plurality of nucleic acid target molecules to provide UMI-labeled nucleic acid target molecules; (b) enzymatically amplifying the UMI-labeled nucleic acid target molecules to provide amplification products including the sequences of the UMI-labeled nucleic acid target molecules; (c) encapsulating the amplification products in a plurality of discrete entities, e.g., at one molecule or less per discrete entity; (d) fragmenting the amplification products in the plurality of discrete entities; (e) attaching nucleic acid barcode sequences to the fragmented amplification products, wherein the nucleic acid barcode sequences in each discrete entity relate the fragmented amplification products to the discrete entity in which the fragmented amplification products are encapsulated; (f) releasing from the discrete entities the fragmented amplification products including nucleic acid barcode sequences attached thereto; (g) sequencing the fragmented amplification products; and (h) bioinformatically reassembling the fragmented amplification products using the sequences of the UMIs and the nucleic acid barcodes sequences to provide the sequence of the nucleic acid target molecules from which the amplification products originated. It should be noted that during reassembly fragments or amplification products thereof which include a barcode, but which do not contain a UMI may be associated with fragments having the same barcode which do contain a UMI to identify fragments originating from the same droplet and thus the same molecule. Given these reasons, Applicant's arguments are not persuasive. Consequently, the previously set forth rejections of claims 22-26, 30, 45-46, 64-65, 67, 69-72, 74 and 76 under 35 U.S.C. 103 are maintained. Priority The priority date of the instant claims 22-26, 30, 45-46, 64-67, 69-72, 74 and 76 is December 28, 2018, filling date of the Swedish Patent Application Number 1851672-4, to which the present application claims priority. Claim Interpretation In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111. For the purposes of applying prior art, claim 22 has been amended to recite a template switching oligonucleotide (TSO) comprising: "from a 5' end to a 3' end: an amplification primer site, an identification tag, a unique molecular identifier (UMI) and multiple predefined nucleotides." The term "identification tag" is not expressly defined in the application's disclosure. The specification at page 25 (lines 29-35) provides relevant description, noting that the identification tag may also serve as the amplification primer site: "In some embodiments, the TSO comprises, from a 5′ end to a 3′ end, the amplification primer site, the identification tag, the UMI and the multiple predefined nucleotides. In some embodiments, the identification tag may serve as the amplification primer site (i.e., where the identification is employed as both an identification tag and an amplification primer site), such that the TSO includes a novel identification tag, UMI and the multiple predefine nucleotides. In such instances, the TSO does not include separate amplification primer site. As such, in some instances the TSO comprises a unique identification tag that can identify 5′ reads from complex mixtures, a UMI, and multiple predefined nucleotides, such as three rGs, wherein the unique identification tag also serves as a primer site for PCR amplification." [emphasis added] Accordingly, in light of the specification and under BRI, the "identification tag" and "amplification primer site" at the 5' end of a TSO are interpreted as can be the same element or separate elements. For the purposes of applying prior art, claim 22 recites "nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments." The applicant's disclosure does not define the terms "nucleic acid fragments," "first population of 5' UMI comprising fragments," and "second population of internal fragments" with structural detail. In view of Applicant's remarks in Amendments filed on September 30, 2024, the "5' UMI comprising fragment" and "internal fragments" are interpreted as separate, broken-off fragments of a cDNA resulting from fragmentation, and are no longer physically attached to each other. For the purposes of applying prior art, Claim 23 recites the term "reverse amplification primer site," which is not defined in the applicant's disclosure. Page 28 of the specification provides the following description regarding "reverse amplification primer" (page 28, lines16-30): "Fig. 1A shows the reverse transcription and template switching reaction of steps S1 and S2 in Fig. 8. In an embodiment, the method also comprises amplifying the extended cDNA strand using a forward primer (also referred to as first forward primer or first forward amplification primer herein) and a reverse primer (also referred to as first reverse primer or first reverse amplification primer herein), which is schematically illustrated as PCR pre- amplification in Fig. 1A." Thus, in light of the specification and under BRI, the term "reverse amplification primer site" is interpreted as "a site that corresponds to a primer." Maintained Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 22-26, 30, 45-46, 64-65, 67, 69-70, 74 and 76 are rejected under 35 U.S.C. 103 as being unpatentable over Abate (US20170009274A1- Sequencing of Nucleic Acids via Barcoding in Discrete Entities; Published on 2017-01-12), in view of Clement (Clement et al., AmpUMI: design and analysis of unique molecular identifiers for deep amplicon sequencing, Bioinformatics, Volume 34, Issue 13, July 2018, Pages i202–i210, doi.org/10.1093/bioinformatics/bty264); Batut (Batut et al. RAMPAGE: promoter activity profiling by paired-end sequencing of 5'-complete cDNAs. Curr Protoc Mol Biol. 2013 Nov 11;104:Unit 25B.11. doi: 10.1002/0471142727.mb25b11s104. PMID: 24510412; PMCID: PMC4372803); Islam (Islam et al. . Quantitative single-cell RNA-seq with unique molecular identifiers. Nat Methods. 2014 Feb;11(2):163-6. doi: 10.1038/nmeth.2772. Epub 2013 Dec 22. PMID: 24363023); Dunne (Dunne et al. US20170136458A1- Systems and methods for pooling samples from multi-well devices; Pub Date: 2017-05-18); as evidenced by Karlsson (Karlsson et al., Single-cell mRNA isoform diversity in the mouse brain. BMC Genomics 18, 126 (2017). doi.org/10.1186/s12864-017-3528-6); van Buggenum (van Buggenum et al. Immuno-detection by sequencing enables large-scale high-dimensional phenotyping in cells. Nat Commun 9, 2384 (2018). ; doi.org/10.1038/s41467-018-04761-0). A) Abate teaches methods for deep sequencing of long-length molecules, such as full-length mRNA (entire document, see Fig 12 for example). Specifically, Abate discloses performing whole transcriptome amplification using SMARTer technology, which leverages the terminal transferase activity of reverse transcriptase enzymes and a template switching oligo (TSO) to add a unique molecular identifier (UMI) to the 3' end of cDNA, which corresponds to the 5' end of the mRNA transcript (Example 3; [1334]; see also Example 11). This barcodes mRNA at the molecular level. This process generating full-length transcriptome cDNAs with UMI is followed by an approach referred to as "single molecule deep sequencing" (SMDS) ([1346]; [0160]-[0161]; [0169]; [1205]2), which involves enzymatic fragmentation and sequencing library construction for next-generation sequencing (NGS), as demonstrated in Examples 8 and 11 (see [1345-1450] for detailed protocol for SMDS with single DNA templates; see [1461] for single cell whole transcriptome sequencing with UMI). The SMDS approach includes amplification of single molecules in droplets, such as the full-length cDNA generated via SMARTer reverse transcription. After enzymatic fragmentation and ligation ([1374-1391]), barcodes and PCR handles are attached to fragmentated DNA molecules ([1405]-[1434]). Each sequencing read for a fragment carries a barcode, and the 5' end sequencing read for each full-length molecule additionally includes a UMI. These features facilitate the assembly of sequencing reads into the original full-length molecule because fragments originating from the same droplet will share matching barcodes ([1348];[1458]). Additionally, within these fragments, unique molecule reads can be further distinguished by UMIs in cases where multiple cDNA templates are present in a single droplet ([0124]). Abate further highlights the benefit of its SMDS method, such as capability of performing deep sequencing of long, individual molecules using available, low cost technologies, "while still having the ability to aggregate reads corresponding to long single molecules without having to rely on assembly algorithms prone to failure." ([1346]) Regarding claim 22, Abate teaches a method for preparing nucleic acid fragments, the method comprising: producing a population of double stranded cDNAs(Fig. 12; [1205]), wherein the double stranded cDNAs in the population of double stranded cDNAs are formed by: hybridizing a cDNA synthesis primer to a ribonucleic acid (RNA) molecule and synthesizing a cDNA strand complementary to at least a portion of the RNA molecule to form an RNA-cDNA intermediate (Fig. 12; [1205 - 1208]); performing a template switching reaction by contacting the RNA-cDNA intermediate with a template switching oligonucleotide (TSO) under conditions suitable for extension of the cDNA strand (Fig. 12; [1227]) using the TSO as a template to form an extended cDNA strand complementary to the at least a portion of the RNA molecule and the TSO (Fig. 12), wherein the TSO comprises from a 5' end to a 3' end: an amplification primer site (Fig. 12; [1205] lines 21-22), an identification tag (Fig. 12; [1205] lines 20-22, conserved sequence identifying 5’ end of RNA transcript in cDNA), a unique molecular identifier (UMI) (Fig. 12; [1205]; lines 13-17) and multiple predefined nucleotides (Fig. 12; [1205] riboguanosines at 3’ end ) that function as a template for the template switching reaction ;and producing double-stranded cDNA from the extended cDNA strand (Fig. 12); fragmenting the population of double-stranded cDNA to produce nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments([0160]-[0161]; [0169]; [0157-0158]; [1205]; [0210] ; [1374] fragmentation of cDNA produced in example 3 from Fig. 12, thereby producing produce nucleic acid fragments comprising a first population of 5' UMI comprising fragments and a second population of internal fragments, see Fig 16); sequencing (Fig. 21) the first population of 5' UMI comprising fragments([1461]) and the second population of internal fragments (Fig. 21-22; [0221]). Claim 22 further recites "wherein the TSO comprises from a 5' end to a 3' end: an amplification primer site, an identification tag, a unique molecular identifier (UMI) and multiple predefined nucleotides that function as a template for the template switching reaction." Abate in Fig. 12 illustrates template switch oligo comprising a 5’ sequence, UMI, and “GGG” on the 3’ end. Description for Fig. 12 in para. [1205] indicates TSO serve as templet for reverse transcription (lines 7-12) also comprises conserved sequences which is “added to all cDNA it can be used as a common priming site for whole transcriptome amplification by PCR” (lines 20-23). Therefore, the skilled artisan in view of these teachings would readily understand that the TSO sequence depicted at the 5’ end of TSO in Fig. 12 of Abate are the described conserved sequences, also comprising priming site for PCR. Also, template switching oligos comprising, from 5’ end to 3’ end, a conserved sequence comprising primer site, UMI, and predefined nucleotides, such as three rGs, cannot be a point of novelty as it is well-known and commonly used in the field of cellular RNA-sequencing, this is supported by Batut, Islam and Dunne. Batut teaches Template switching oligos designed with a sequence structure comprising a conserved pcr handle sequence and UMI (“5′-TAGTCGAACTGAAGGTCTCCAGCANNNNNNrGrGrG” ) (page 4). Islam similarly teaches Template switching oligos having sequence “Bio-AAUGAUACGGCGACCACCGAUNNNNNGGG” (supplementary table 2), where “AAUGAUACGGCGACCACCGAU” is a conserved PCR primer binding site. Dunne also teaches in its single-cell sequencing system, TSO comprises: A) a 3′ poly-G region, B) a unique molecular identifier (UMI), and C) a second 5′ tail region, wherein the second 5′ tail region binds to first index primer ([0010]). Therefore, as discussed above, sequencing methods using TSOs comprising, from 5' to 3', a conserved sequence comprising a primer site, a UMI, and multiple predefined nucleotides are taught by Abate and were well-known in the art. As currently interpreted under BRI, the claimed "identification tag" may be the same as the amplification primer site (see claim interpretation section above for detailed discussion). Regarding the limitation "identifying reads that belong to the 5' UMI comprising fragments by recognition of the identification tag," Abate does not explicitly recite this step. However, this UMI read-identification approach would have been obvious in view of Abate in combination with well-known sequencing data analysis techniques, particularly those relating to UMI identification. As discussed above, Abate teaches generating sequencing reads that include a 5' UMI and a known conserved sequence adjacent to the UMI, such as an amplification primer site (Fig. 12; [1205]). A person of ordinary skill in the art would have recognized that this conserved sequence could serve as an identification tag for locating UMI in the reads and identifying the UMI containing sequencing reads. The use of regular expression-based approach (i.e., sequence matching) in sequencing data analysis is well-established, including for UMI identification. In typical practice, a known, conserved sequence within a read serves as an anchor or identification tag, to determine the sequence and position of an adjacent variable UMI sequence, which has a fixed relative position. For example, in a read design such as "CCAGCANNNNNN," (the six random N-mers representing UMI), the conserved sequence "CCAGCA" in a hypothetical read comprising "CCAGCAATCGGA" identifies that the following six nucleotides "ATCGGA" correspond to the UMI 3. The commonality of this practice in sequencing data analysis is evidenced by Karlsson and van Buggenum. Karlsson discloses identifying UMIs in RNA sequencing reads based on their relative position to a known Illumina adapter sequence, which functions as an amplification primer site (page 8, right-hand col, para 2, lines 7-16). van Buggenum teaches parsing sequencing reads using a common anchor sequence to identify the position of a UMI (page 9, right-hand col, para. 4, liens 5-7). Accordingly, a person of ordinary skill in the art would have readily appreciated that the conserved amplification primer site sequence at the 5' position of the UMI in Abate's teaching, could also be used as "identification tag" to identify UMI-containing reads. Tools for carrying out such read-identification steps were also available prior to the effective filling date. Clement teaches an open-source software tool, "AmpUMI," based on regular expression principles for flexible UMI identification in sequencing data (Abstract; page i204, right hand col, para 1, lines 2-9). Clement further highlights advantages of AmpUMI, including flexibility allowing researchers to adapt the software to their specific UMI and sequencing design; reducing noise and sequencing errors; and duplicate reads removal for easy integration with downstream analysis (page i209, right-hand col, para. 3). Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to apply UMI identification in the sequencing methods of Abate, using the conserved primer amplification site at the 5' position of the UMI from TSO sequence as the identification tag, in combination with the flexible UMI-identification tool taught in Clement. The skilled artisan would have been motivated to do so because the use of a conserved sequence at fixed position for UMI identification in sequencing reads was commonly practiced, and Clement provides a software tool for such practice, with clear advantages such as flexibility, error reduction, and compatibility with downstream analysis. The person of ordinary skill would have had a reasonable expectation of success in making this modification because Clement expressly teaches that its AmpUMI is flexible and can be adapted to specific UMI sequencing designs. Thus, a skilled artisan would have reasonably expected that this tool could be applied to sequencing data generated according to the teachings of Abate. B) Regarding claim 23, Abate teaches the cDNA synthesis primer comprises a reverse amplification primer site ([1208], [1215]). Regarding claim 24, Abate teaches the cDNA synthesis primer comprises an oligo-dT RNA binding site (Fig. 12; [1208]). Regarding claim 25, Abate teaches producing double-stranded cDNA comprises amplifying ([1205]; Fig. 12). Regarding claim 26, Abate teaches amplifying comprises employing a forward primer that hybridizes to the TSO amplification primer site and a reverse primer that hybridizes to the cDNA synthesis primer comprising a reverse amplification primer site (Fig. 12; [1235]). Regarding claim 30, Abate teaches enzymatic fragmentation ([1374). Regarding claim 45, Abate teaches wherein hybridizing the cDNA synthesis primer comprises hybridizing the cDNA synthesis primer to the RNA molecule and synthesizing the cDNA strand by reverse transcription to form the RNA-cDNA intermediate; and performing the template switching reaction comprises performing the template switching reaction by contacting the RNA-cDNA intermediate with the TSO under conditions suitable for extension of the cDNA strand by reverse transcription to form the extended cDNA strand (Fig 12; [1205]). Regarding claim 46, Abate teaches the reverse transcription is conducted in the presence of guanine ribonucleotides ([1231]). Regarding claim 64, Abate teaches the identification tag is a nucleotide sequence (Fig. 12; [1205] lines 20-22, conserved sequence identifying 5’ end of RNA transcript in cDNA). Regarding claim 65, Batut teaches using human RNA samples (page 18, line 10), and teaches Template switching oligos designed with a sequence structure comprising a conserved pcr handle sequence and UMI (“5′- TAGTCGAACTGAAGGTCTCCAGCANNNNNNrGrGrG” ) (page 4). The conserved sequence “TAGTCGAACTGAAGGTCTCCAGCA” does not exist in human cell transcriptome, as it does not align with any human transcriptome sequence with 100% identity. Regarding claim 67, Abate teaches short-read sequencing method (Fig. 7). Regarding claim 69, Abate teaches wherein the multiple predefined nucleotides are three guanine ribonucleotides (Fig. 12; [1205] riboguanosines at 3’ end). Regarding claim 70, Abate teaches oligo-dT primer (Fig. 28). Regarding claim 74, Abate teaches the forward primer hybridizes to TSO amplification primer site and the identification tag (Fig. 12; [1205] “the conserved sequence in the TSO oligo is added to all cDNA it can be used as a common priming site for whole transcriptome amplification by PCR (4).”). Regarding claim 76, Abate teaches amplifying is performed simultaneously to the template switching reaction ([0270] lines 6-12, cDNA synthesis, barcoding, and amplification in a single step). Claims 71-72 are rejected under 35 U.S.C. 103 as being unpatentable over Abate, in view of Clement with Batut, Islam and Dunne, as applied to claim 70/22 above and further in view of Invitrogen (Anchored Oligo(dT)20 Primer; 2003). A) The teachings of Abate, Clement with Batut, Islam and Dunne are recited above and applied as for base claims 22 and 70. Regarding claim 71, it recites "wherein the cDNA synthesis primer is an anchored oligo-dT primer." Abate teaches using oligo-dT primer (e.g., Fig. 28). While the combined teachings of Abate, in view of Clement with Batut, Islam and Dunne does not explicitly teach anchored oligo-dT primer, this limitation is obvious in view of Invitrogen. Invitrogen teaches anchored Oligo-dT primer consisting of a string of 20 deoxythymidylic acid (dT) residues followed by two additional nucleotides represented by VN, where V is dA, dC, or dG and N is dA, dC, dG or dT (page 1). Invitrogen further highlights benefit of its anchored Oligo-dT primer, such as more efficient cDNA synthesis: “The VN anchor allows the primer to anneal only at the 5′ end of the poly(A) tail of mRNA, providing more efficient cDNA synthesis for labeling, first-strand synthesis, and RT-PCR applications.” (page 1, Description, lines 4-6) Therefore, motivated by the potential improvement in cDNA synthesis using anchored Oligo-dT primer, as suggested by Invitrogen, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to substitute the Oligo-dT primer used in the combined teachings of Abate, in view of Clement with Batut, Islam and Dunne, with the anchored Oligo-dT primer disclosed in Invitrogen. b) Regarding claim 72, Invitrogen teaches the anchored oligo-dT primer comprises from a 5' end to a 3' end: a primer site, Tp, V, and N, wherein V is selected from the group consisting of A, C and G, N is selected from the group consisting of A, C, G and T, and p is a positive number selected from within an interval from 10 to 50 (page 1). Subject Matter Not Taught/Suggested in Prior Art Claim 66 is objected to as being dependent upon a rejected base claim 22, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The following subject matter is not taught or suggested in the prior art: Regarding claim 66, the prior art fails to teach or suggest all the claimed limitations. Specifically, no prior art teaches or fairly suggests a template switching oligonucleotide comprising SEQ ID NO: 11, as required by claim 66. Conclusion Claim 66 is objected to, claims 22-26, 30, 45-46, 64-65, 67, 69-72, 74 and 76 are rejected. No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681 1 It is further noted that, even if considered, this unclaimed feature would have been obvious in view of Abate. Abate teaches 5' labeling of cDNA using a UMI (Fig. 12), fragmenting the UMI labeled DNA within a droplet, and then labeling the internal fragments with droplet-specific barcodes, wherein the internal fragments do not contain the UMI ([0161] teaches fragmenting and barcode UMI-labeled cDNA; see also [0221] describing processing UMI labeled DNA for sequencing, including fragmenting and barcoding). Thus, a skilled artisan would readily understand that all fragments from the same full-length cDNA share the same barcode, while the 5' fragment additionally includes a UMI indicating a unique molecule. This combinatorial barcoding scheme is used to identify reads that originate from a single full-length transcript. As explained in more detail below, internal fragment reads that include a barcode but do not contain a UMI can be associated with fragments containing the same barcode and additionally a UMI. This allows reads from the droplet and same molecule to be identified and assembled into full-length transcripts. Thus, a skilled artisan would have found it obvious to identify and distinguish UMI-containing reads from non-UMI-containing reads during data analysis. Otherwise, the barcode and UMI information taught by Abate could not be used for its intended purpose of associating reads with the full-length single transcript. 2 [0161] explicitly describes fragmenting cDNA comprising UMI, wherein the cDNA is generated by SMART technology, referred to as SMART-Tag or SMART-Tag 2. [0169] further describes SMART-Tag cDNA synthesis followed by fragmentation in partitions. TSO is included by the SMART Technology by Clontech (now Takara), which relies on TSO for template switching. Support for this are in [0157-0158]; [1205]. 3 For more example see github.com/pinellolab/AmpUMI
Read full office action

Prosecution Timeline

Show 12 earlier events
Sep 16, 2025
Request for Continued Examination
Oct 02, 2025
Response after Non-Final Action
Nov 10, 2025
Final Rejection mailed — §103
Feb 12, 2026
Request for Continued Examination
Feb 12, 2026
Response after Non-Final Action
Mar 11, 2026
Non-Final Rejection mailed — §103
Jun 09, 2026
Response Filed
Jul 02, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698536
ROTAVIRUS GENOTYPE DETECTION METHOD, AND GENE AMPLIFICATION PRIMER SET USED IN SAME
4y 9m to grant Granted Aug 04, 2026
Patent 12686891
SILICA-BASED CHROMATOGRAPHIC PROCESSES FOR ISOLATING NUCLEIC ACID-PROTEIN COMPLEXES AND DETECTING TARGET NUCLEIC ACIDS
3y 1m to grant Granted Jul 21, 2026
Patent 12662702
SEQUENCING POLYNUCLEOTIDES USING NANOPORES
3y 9m to grant Granted Jun 23, 2026
Patent 12644150
MEMBRANE-BASED, IN-GEL LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) SYSTEM AND METHOD FOR DETECTING MICROBES
4y 7m to grant Granted Jun 02, 2026
Patent 12630884
METHOD OF SELECTING RUMINATING ANIMALS FOR A DESIRABLE HEREDITABLE TRAIT
6y 3m to grant Granted May 19, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

8-9
Expected OA Rounds
55%
Grant Probability
74%
With Interview (+18.7%)
3y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 85 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month