DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
The claim set received 17 March 2026 has been entered into the application.
Claims 11 and 24 are amended.
Claims 15 and 28 are cancelled.
Claim(s) 1-14, 16-27, and 29-37 are pending.
Election/Restrictions
Applicant has elected Group I, claims 1-10, drawn to a kit. However, upon further search and consideration, the restriction requirement is being withdrawn because the separate inventions of the claims do not appear to provide an undue search burden.
Claims 1-14, 16-27, and 29-37 are under examination.
Priority
Acknowledgment is made of applicant’s claim to priority to PCT/US2019/053966 filed on 01 October 2019 which claims further priority to U.S Provisional Application 62/739,558 filed 01 October 2018.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 19 May 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 112
35 U.S.C § 112(b)
The instant rejection is maintained for reason for record in the Office Action mailed 17 November 2025 and modified in view of the amendments filed 17 March 2026.
The rejection of claims 11-14, 16-27, and 29-37 under 35 U.S.C § 112(b) in the Office Action mailed 17 November 2025 is withdrawn in view of the argument received 17 March 2026.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “wherein exposing the excitable cell to the target light intensity result in an ion current”. The claimed element renders the claim indefinite because it is not clear what is being limited as claim 1 is drawn to a kit and not a method of exposing a cell to light.
Claims 2-10 are further rejection because they depend on claim 1 and do not provide limitations to overcome the deficiencies of claim 1.
Response to Arguments
Applicant's arguments and amendments, filed 17 March 2026, have been fully considered but the rejection is maintained.
The Applicant states claim 1 is drawn to kit comprising two components, an excitable cell and CRM, does not require a device [remarks, page 10].
In response, it is noted that the 35 U.S.C § 112(b) rejection above provided rationale for the rejection. It is acknowledged claim 1 is drawn to a kit. However, the “wherein exposing…” element of claim 1 requires a device or machine for exposing the cell to light and that element is not provided in claim 1 or its dependent claims. Here, the “wherein exposing…” element renders the claim indefinite because it is not clear how the “wherein exposing…” element is to limit an “exposing” step or instruction when the kit of claim 1 and the dependent claims does not contain or utilize a device or machine and/or provide instructions to use a device or machine such that a cell(s) can be exposed light, and claim 1 is also drawn to a kit and not a method of exposing a cell to light. Therefore, because the claim element was not amended from the claim and/or because an exposing step was not amended into the claims, claim 1 remains rejected.
Claim Rejections - 35 USC § 101
The instant rejection is maintained for reason for record in the Office Action mailed 17 November 2025 and modified in view of the amendments filed 17 March 2026.
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-14, 16-27, and 29-37 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter.
Claims Analysis
Under broadest reasonable interpretation, claim 1-10 is drawn to a kit comprising an excitable cell expressing a light sensitive protein method and computer readable media comprising instructions for performing an optical dynamic clamp on the cell, so a manufacture.
Following the flowchart of the MPEP 2106
Step I - Process, Machine, Manufacture or Composition
Claims 1-10 are drawn to instructional kit encompassing an excitable cell and computer instructions for measuring a light sensitive protein expressed of the excitable cell, so a composition. However, it is noted the CRM contains instructions for measuring a light sensitive protein expressed of the excitable cell which reads on abstract ideas as described below in Step 2A Prong II of the 35 U.S.C § 101 analysis.
Claims 11-15 and 16-23 are drawn to a method, so a process.
Claims 24-27 and 29-37 are drawn to a method, so a process.
2A Prong I
Markedly Different Characteristics Analysis
Claim 1 requires an excitable cell comprising an exogenous nucleic acid encoding at least one light-sensitive protein, where n the exogenous light sensitive protein is expressed in the cell. Here, it is known that the excitable cells of claim 3 (i.e., neuron, a muscle cell and an excitable cell derived from an induced Pluripotent Stem Cell (iPSC)) do not naturally express light-sensitive proteins. Therefore, the excitable cell of claim 1 is markedly different than the natural occurring neurons, a muscle cells and an excitable-cells derived from an induced Pluripotent Stem Cell (iPSC) because the cells are modified to express an exogenous light sensitive that does not naturally occur in said cells.
Identification of an Abstract Idea
Claim 1 recites
instructions for performing an optical dynamic clamp on the cell
This step can be performed in the human mind by following instructions to perform an optical dynamic clamp on the cell and is therefore an abstract idea.
wherein the instructions comprise calculating a target ion current based on a measured membrane potential (Vm) using a predetermined relationship between a time-dependent Vm and an ion current
This step can be performed in the human mind by following instruction for measuring membrane potential (Vm) using a predetermined relationship between a time-dependent Vm and an ion current to further calculate a target ion current and is therefore an abstract idea. This step encompasses performing calculations to calculate a target ion current using measured membrane potential (Vm) between a time-dependent Vm and an ion current and is therefore an abstract idea.
calculating a target light intensity based on the target ion current
This step can be performed in the human mind by observing and evaluating target ion current to calculate a target light intensity and is therefore an abstract idea. This step encompasses performing calculations to calculate a target light intensity and is therefore an abstract idea.
Claims 2-3, 7-9, and 10 are further drawn to limitations that describe the abstract ideas of claim 1 and are therefore also abstract ideas.
Claim 11 recites:
(iv) calculating a target ion current based on the measured V musing a predetermined relationship between a time-dependent V m and an ion current and further calculating a target light intensity based on the target ion current calculated.
This step can be performed in the human mind by following instructions to calculate a target ion current based on the measured V musing a predetermined relationship between a time-dependent Vm and is therefore an abstract idea. This step encompasses performing mathematical computations to calculate a target ion current which reads on abstract ideas/mathematical concepts. This is can be further performed in the human mind by following instructions to calculate a target light intensity based on the target ion current and is therefore an abstract idea. This step encompasses performing mathematical computations to calculate a target light intensity based on the target ion current which reads on abstract ideas/mathematical concepts.
Claims 12-14, 16-17, and 21-23 are further drawn to limitations that describe the abstract ideas of claim 11 and are therefore also abstract ideas.
Claim 24 recites:
(iii) calculating a target ion current based on the measured V musing a predetermined relationship between a time-dependent V m and an ion current and further calculating a target light intensity based on the target ion current calculated
This step can be performed in the human mind by following instructions to calculate a target ion current based on the measured V musing a predetermined relationship between a time-dependent Vm and is therefore an abstract idea. This step encompasses performing mathematical computations to calculate a target ion current which reads on abstract ideas/mathematical concepts. This is can be further performed in the human mind by following instructions to calculate a target light intensity based on the target ion current and is therefore an abstract idea. This step encompasses performing mathematical computations to calculate a target light intensity based on the target ion current which reads on abstract ideas/mathematical concepts.
Claims 25-27, 29-30, and 34-36 are further drawn to limitations that describe the abstract ideas of claim 24 and are therefore also abstract ideas.
2A Prong II - Consideration of Practical Application
Claim 1
Claim 1 does not recite any additional element to which integrates the recited judicial exception into a practical application. Claim 1 recites a kit comprising an excitable cell expressing at least one light-sensitive protein from an exogenous source, and a computer readable media comprising instructions for performing an optical dynamic clamp on a cell. Here, in the instant case, the claims merely set for an instructional method of data analysis for calculating a target ion current and calculating a target light intensity based on the target ion current. As such, practicing the claim merely results in generating numerical values (i.e., a target ion current and a target light intensity). Such a result only produces information (i.e., quantitative data) and does not provide for a practical application in the physical-realm of physical things and acts, i.e., the claims do not utilize the data generated by the judicial exception to affect any type of change. See MPEP 2106.04(a)(2)(A)(iv).
Claims 11 and 24
Claims 11 and 24 do not recite any additional elements that integrate the recited judicial exception into a practical application because claims 11 and 24 do not utilize the calculated ion current and light intensity based on target for adjusting the light intensity or the light wavelength for controlling the measured and target ion currents. Here, the judicial exception is disjointed from the additional element of “adjusting the light intensity or light wavelength and the calculated target light intensity based on target ion current” because the target light intensity based on the target ion current calculated is not utilized for adjusting the light intensity or the wavelength for controlling the measured and target ion currents. As such, the claimed steps are not integrated into adjusting the light intensity or the light wavelength for controlling the measured and target ion currents until there are equal. Thus, the “adjusting” is equivalent to the words “apply it”. See MPEP 2106.05(f). Therefore, claims 11 and 24 are not eligible under Step 2A Prong II of the 35 U.S.C. § 101 analyses.
This judicial exception is not integrated into a practical application because the claims do not meet any of the following criteria:
An additional element reflects an improvement in the functioning of a computer, or an improvement to other technology or technical field;
an additional element that applies or uses a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition;
an additional element implements a judicial exception with, or uses a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim;
an additional element effects a transformation or reduction of a particular article to a different state or thing; and
an additional element applies or uses the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such that the claim as a whole is more than
a drafting effort designed to monopolize the exception.
2B Analysis - Consideration of Additional Elements and Significantly More
The claimed method also recites "additional elements" that are not limitations drawn to an abstract idea.
The recited additional element of using computer readable storage medium (CRM) of claim 1 does not add significantly more to the judicial exception because using computer components and equipment to store abstract idea is well-known and conventional. See MPEP 2106.05(b) and 2106.05(d).
The additional element of using computer for performing calculations and adjusting light intensity and light wavelength of claims 1, 13, and 26 does not add significantly more than the recited judicial exception because using computer processes and equipment to perform abstract ideas (i.e., performing calculations and adjusting light intensities and wavelength) is well-known and conventional. See MPEP 2106.05(b) and 2106.05(d).
The recited additional element of using light sensitive protein selective for an ion of claim 1-2, 16, and 29 does not add significantly more than the recited judicial exception because using excited cells for testing electrophysiology is well-known and conventional. To provide conventionality of the light sensitive protein, Entcheva et al. (Entcheva) teaches actuation mechanism using channelrhodopsin2 (ChR2) opsins protein with proton, sodium, potassium, and calcium cation channels [page H11183]. Entcheva teaches using chloride pumps [page H1182 fig 2] (Am J Physiol Heart Circ Physiol. 2013 May;304(9):H1179-91).
The recited additional element of using excitable cells of muscle and neuron origin claim 3, 17, and 30 does not add significantly more than the recited judicial exception because using excited cells for testing electrophysiology is well-known and conventional. To provide conventionality of the light sensitive protein, Entcheva et al. (Entcheva) teaches optogenetics of neuroscience using neuron [page H1183 right col]. Entcheva teaches using cardiac electrophysiology and optogenetics cardiac action potential and myocytes [page H1184 left col].
The recited additional element of using excitable cells of muscle and induced Pluripotent stem cell origin claims 3-5, 17-19, and 30-32 does not add significantly more than the recited judicial exception because using excited cells for testing electrophysiology is well-known and conventional. To provide conventionality of the light sensitive protein, Lapp teach optogenetic stimulation of human iPSC-derived cardiomyocytes [abstract] (Scientific reports, 2017-08, Vol.7 (1), p.9629-9629, Article 9629).
The recited additional element of using light-sensitive protein of claims 6, 20, and 33 does not add significantly more than the recited judicial exception because using light-sensitive proteins for testing electrophysiology is well-known and conventional. To provide conventionality of the light sensitive protein, Guru et al. (Guru) teaches using channelrhodopsins [page 3 left col]. Guru teaches using opsins for chloride channels (i.e., anion channels) [page 2 figure1]. Guru teaches using opsin-receptor chimeras called OptoXr [page 5 left optogenetic control of intracellular signaling] (The international journal of neuropsychopharmacology, 2015-10, Vol.18 (11), p.pyv079).
The recited additional element of using light sensitive protein of claims 7, 21, and 34 does not add significantly more than the recited judicial exception because using light sensitive protein for testing electrophysiology is well-known and conventional. To provide conventionality of the light sensitive protein, Guru teaches using ChR1 [page 4 spectrally shifted excited excitatory opsins]. Guru teaches using ChR2 [page 4 spectrally shifted excited excitatory opsins]. Guru teaches using Volvox channelrhodopsins (VChR1) [page 4 spectrally shifted excited excitatory opsins]. Guru teaches using step function or bi-stable opsins [page 3 right col].
The recited additional element of using light sensitive protein of claim 8, 22, and 35 does not add significantly more than the recited judicial exception because using light sensitive proteins for testing electrophysiology is well-known and conventional. To provide evidence of conventionality of using light sensitive protein, Matties et al. (Mattis) teaches using Natromonas pharaonis halorhodopsin (NpHR), a yellow light-activated chloride pump [page 12 last paragraph]. Mattis teaches using eNpHR 2.0 [page 13 first paragraph]. Mattis teaches using eNpHR 3.0 [page 13 first paragraph]. Mattis teaches using archaerhodopsin (Arch) [page 13 first paragraph]. Mattis teaches using MAC [page 13 first paragraph]. Mattis teaches using Leptosphaeria maculans (MAC) [page 13 first paragraph]. Mattis teaches using eBR (from Halobacterium) [page 13].
The additional element of using an excitable cell expressing two different light-sensitive proteins of claims 9, 23, and 37 does not add significantly more than recited judicial exception because using excitable cells with at least two different light-sensitive proteins is well-known and conventional. To provide evidence of conventionality of using excitable cell expression two different light sensitive proteins, Mattis teaches using an opsin-fluorophore fragments were PCR-amplified to add AscI and NheI, using gtggcgcgccctattacttgtacagctcgtccatg (for all), tatgctagccaccatggactatggcggcgc (for ChR2 mutants), and gttatg ctagcgccaccatgtcgcggaggccatggc (for ChIEF), and then ligated to an AAV-Ef1α-DIO backbone [page 20 molecular cloning] (Nature methods, 2012-02, Vol.9 (2), p.159-172).
The recited additional elements of using light sensitive proteins that depolarize and hyperpolarize of claim 10 does not add significantly more than recited judicial exception because using light sensitive proteins that hyperpolarize and depolarize is well-known and conventional. To provide evidence of conventionality, Mattis teaches using NpHR with hyperpolarizing tools [page 12 last paragraph]. Mattis teaches using ChR2 and depolarizing tools [page 3 results].
The recited additional elements of providing excitable cell, an electrode, and a light source with a controllable light or controllable light wavelength of claim 11 does not add significantly more than the recited judicial exception because providing excitable cells and controllable light sources and electrodes and using said cell, electrodes, and light source for testing the excitability of said excitable cells expressing a light sensitive proteins to collect excitable cell data that is subsequently analyzed by the abstract idea is well-known and conventional. See MPEP 2106.05(d)(II)(iii) and 2106.05(g).
The recited additional element of using optogenetic sensors of claims 24 and 36 do not add significantly more than the recited judicial exception because using optogenetic sensors is well-known and conventional. To provide evidence of conventionality of using optogenetic sensors, Yao et al. teach using arc lamp as a lighting source [page 519 left col light source] (Int J Ophthalmol. 2012; 5(4): 517–522). To provide further evidence of conventionality of using optogenetic sensors, Butler et al. teach using D3cpVenus which is one such genetically encoded calcium indicators (GECI) that fluoresces in response to an increase in Ca2+ and has been successfully used, both in vitro and in vivo, to detect single action potential spiking [page 5 left col] (Bioscience horizons, 2012-12, Vol.5, p.hzr020-hzr020). To provide further evidence of conventionality of using optogenetic sensors, Rost et al. teach using prototypic VSFP1.2 as well as VSFP-Butterfly, Arclight, and ASAP1[page 582 right col second paragraph] (Neuron (Cambridge, Mass.), 2017-11, Vol.96 (3), p.572-603).
The recited additional element of measuring data (i.e., membrane potential of claim 11 step (iii) and signal of claim 24 step (ii)) with an electrode (claim 11 step (iii)) and/or optical detector (claim 24 step (ii)) does not add significantly more than the recited judicial exception because measuring membrane potential with an electrode and measuring signal with optical detector to provide membrane potential and signal data that is subsequently analyzed by abstract ideas is well-known and conventional. See MPEP 2106.05(d)(II)(iii) and 2106.05(g).
To provide evidence of conventionality of using optical detectors, Entcheva et al. (Entcheva) teaches an all-optical sensing, actuation, and control of cardiac function [page H1187 figure 6]. The all-optical system contains a light source and a computer controls the LED driver and the acquisition by the photodetectors which allows for a closed-loop feedback control [page H1187 figure 6]. Entcheva teaches Entcheva teaches the optical sensing can detect Vm of voltage at a light pulse of 50ms at 0.2 mWmm-2 [page 1187 figure 6] (Scientific reports, 2014-07, Vol.4 (1), p.5838-5838, Article 5838). To provide conventionality of using electrodes, Kornreich et al. (Kornreich) teaches a schematic using electrodes [page 33 figure 8 and 34 figure 9] (Journal of veterinary cardiology, 2007-05, Vol.9 (1), p.25-37).
The recited additional element of adjusting the light intensity or light wavelength for controlling the ion current of claims 11 step (v) and 24 step (iv) does not add significantly more than the recited judicial exception because adjusting the light intensity or light wavelength to control ion current is well known and conventional.
In conclusion, and when viewed as a whole, these additional claim element(s) do not provide meaningful limitation(s) to transform the abstract idea recited in the instantly presented claims into a patent eligible application of the abstract idea such that the claim(s) amounts to significantly more than the abstract idea itself. Therefore, the claim(s) are rejected under 35 U.S.C. 101 as being directed to non-statutory subject matter.
Response to Arguments
Applicant's arguments, filed 17 March 2026, have been fully considered and the rejection is maintained.
The Applicant disagrees with the Examiner finding that the claims contain abstract ideas, contain instructions and claims 1-10 do not recite a practical application [remarks, page 10]. The Applicant states the claims are patent eligible according to the PTO Notice, 1505 CNOG 1040, December 27, 2022. The Applicant states since the claim, claim 1, is now drawn to a non-transitory computer readable media (CRM) it overcomes the 101 rejection according to the PTO Notice, 1505 CNOG 1040, December 27, 2022 [remarks, page 11].
The argument is not persuasive because using CRM to store instruction does not preclude form encompasses abstract ideas. As noted above in Step 2A Prong I, the CRM merely contains instructions (i.e.., abstract ideas) stored in a computing environment. Here, a product (i.e., computer-readable medium (CRM)) can still recite mental processes such a computer readable medium containing program instructions for detecting fraud, and computer readable storage media comprising computer instructions to implement a method for determining a price of a product offered to a purchasing organization, for example. See MPEP 2106.04(a)(2)(III)(C-D). With respect to the PTO Notice, 1505 CNOG 1040, December 27, 2022, the notice states “A claim drawn to such a computer readable medium that covers both transitory and non-transitory embodiments may be amended to narrow the claim to cover only statutory embodiments to avoid a rejection under 35 U.S.C. § 101 by adding the limitation "non-transitory" to the claim.” Here, the notice pertains to amending a claim with “non-transitory” elements such that the elements is to contain statutory limitations and not non-statutory limitations such as “signal per se”, for example. See MPEP 2106.03(I). Thus, amending a claim with non-transitory computer elements such that a claim can be classified as one of the three statutory categories (machines, manufactures and compositions of matter) does not obviate the rejection under 35 US.C § 101.
Thus, claim 1, as noted in Step 2A Prong I of the 101 analysis above, encompasses abstract ideas (i.e., calculating target ion current, calculating target light intensity based on target current ion current, organizing information for performing calculations). Regarding claim 1 encompassing a practical application, practical applicability is evaluated under Step 2A Prong II of the 101 analyses. Furthermore, as noted in Step 2A Prong II of the 101 analyses above, claim 1 does not encompasses any additional elements that integrate the recited judicial exception into a practical application. Here, claim 1 is drawn to instructions for calculating target ion current and target light intensity for performing optical dynamic clamp which merely results in generating numerical values (i.e., a target ion current and a target light intensity). As such, practicing the claims merely results in the generation quantitative data (i.e., a target ion current and a target light intensity). Such a result only produces information (i.e., quantitative data) and does not provide for a practical application in the physical-realm of physical things and acts, i.e., the claims do not utilize the data generated by the judicial exception to affect any type of change. See MPEP 2106.04(a)(2)(A)(iv). Therefore, claim 1 is not patent eligible.
The Applicant disagrees with the Examiners assertion that claims 11-14, 16-27 and 29-37 are drawn to abstract ideas, and the claims do not integrate the judicial exception into a practical application [remarks, page 11]. The Applicant states claim 11 requires measuring a Vm with is a time-dependent parameter and the measurement cannot be performed in the human mind [remarks, page 12]. The Applicant states the recitation of the abstract ideas alone is not enough to conclude that a claim as a whole is directed to a judicial exception. The Applicant states the results of the calculation of step (v) is used to adjust the light. The Applicant states the calculation target ion current is used in the subsequent step to adjust the light intensity or wavelength - that is, one needs to adjust the light until the measured ion current is equal to the target ion current calculated in step (iv). The Applicant states “That is, the calculation, which is considered by the Examiner to be a mental process, has been integrated into a practical application by adjusting the light.” [remark, page 12].
In response, and as noted above in Step 2B of the 101 analyses, measuring data is consideration a data gathering that is well-known and conventional. In further response, the claimed steps of claims 11 and 24 were found to be disconnected/disjointed from the adjusting step because the target light intensity based on the target ion current calculated is not utilized for adjusting the light intensity or the wavelength for controlling the measured and target ion currents. Here, although the target light intensity is based on the target ion current, the target light intensity is not used for adjusting the light intensity or the light wavelength of the light source for controlling an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current calculated in step (iv) of claim 11. Therefore, because the target light intensity based on the target ion current in conjunction with the target ion current is not utilized for adjusting the light intensity or light wavelength, the “adjusting” steps of claims 11 (v) and 24 (iv) are equivalent to the words “apply it”. See MPEP 2106.05(f). Therefore, claims 11 and 24 are not eligible under Step 2A Prong II of the 35 U.S.C. § 101 analyses.
Regarding the judicial exception itself alone if not enough to conclude the claims as a whole is directed to a judicial exception, the MPEP 2106.04(d)(III) [first paragraph] states “The Prong Two analysis considers the claim as a whole. That is, the limitations containing the judicial exception as well as the additional elements in the claim besides the judicial exception need to be evaluated together to determine whether the claim integrates the judicial exception into a practical application. Because a judicial exception alone is not eligible subject matter, if there are no additional claim elements besides the judicial exception, or if the additional claim elements merely recite another judicial exception, that is insufficient to integrate the judicial exception into a practical application.” Therefore, to provide a practical application, the judicial exception of the claims should be integrated with an additional element.
The Applicant states even if the present claims are considered as directed to a judicial exception, the claims as a whole, still recite additional elements that are significantly more than the judicial exception, as evidenced by that the method, which performs optical dynamic clamp, is novel and nonobvious [remarks, page 12].
In response, and as noted in Step 2B of the 101 analyses above, the recited additional element, as a whole, do not provide an inventive concept that add significantly more than the recited judicial exception because the recited additional elements were found to be well-understood, routine, and conventional.
Regarding novel and nonobvious, The MPEP 2106.05(I) [paragraph 4] states “Although the courts often evaluate considerations such as the conventionality of an additional element in the eligibility analysis, the search for an inventive concept should not be confused with a novelty or non-obviousness determination. See Mayo, 566 U.S. at 91, 101 USPQ2d at 1973. As made clear by the courts, the "‘novelty’ of any element or steps in a process, or even of the process itself, is of no relevance in determining whether the subject matter of a claim falls within the § 101 categories of possibly patentable subject matter." Intellectual Ventures I v. Symantec Corp.,” The MPEP further states “the search for a § 101 inventive concept is thus distinct from demonstrating § 102 novelty."). In addition, the search for an inventive concept is different from an obviousness analysis under 35 U.S.C § 103”. ("The inventive concept inquiry requires more than recognizing that each claim element, by itself, was known in the art. . . . [A]n inventive concept can be found in the non-conventional and non-generic arrangement of known, conventional pieces."). Specifically, lack of novelty under 35 U.S.C § 102 or obviousness under 35 U.S.C § 103 of a claimed invention does not necessarily indicate that additional elements are well-understood, routine, conventional elements. Because they are separate and distinct requirements from eligibility, patentability of the claimed invention under 35 U.S.C § 102 and 103 with respect to the prior art is neither required for, nor a guarantee of, patent eligibility under 35 U.S.C § 101. The distinction between eligibility (under 35 U.S.C § 101) and patentability over the art (under 35 U.S.C § 102 or 103) is further discussed in MPEP § 2106.05 (d).
Examiner’s Note
It noted the claims were not amended to utilize the target light intensity based on the target ion current calculated for adjusting the light intensity or the wavelength for controlling the measured and target ion currents. It is noted claim 1 recites “exposing the excitable cell to the target light intensity results…”. To illustrate, claim 1 exposes the excitable cell to the target light in intensity. Here, because claim 1 utilizes the target light in intensity based on ion current/ion current calculated (claims 11 and 24) (i.e., adjusting the exposure of the target light intensity such that results in ion current), it is it recommended to amend claims 11 and 24 using similar language as claim 1. For example, claim 11 step (v) and claim 24 step (iv) could be amended to recite “adjusting the light intensity or the light wavelength of the light source to the target light intensity based on the target ion current calculated, thereby controlling an ion current from the light sensitive protein until the measured ion current is equal to the target ion current calculated.” It is noted that any amendments will require further search and consideration. Additionally, any amendments should be consistent with and supported by the specification. Furthermore, the Applicant is invited to contact to the Examiner to discuss possible Applicant amendments and/or possible Examiner amendments such that the claims can be amended into eligible subject matter.
Claim Rejections - 35 USC § 103
The instant rejection is maintained for reason for record in the Office Action mailed 17 October and modified in view of the arguments filed 17 March 2026.
Claim(s) 1-2, 4, 10-11, 14, 16, 18, 24, 27, 29, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Entcheva et al. (Am J Physiol Heart Circ Physiol. 2013 May;304(9):H1179-91) in view of Kornreich et al. (Journal of veterinary cardiology, 2007-05, Vol.9 (1), p.25-37) in view of Berglund et al. (Proceedings of the National Academy of Sciences - PNAS, 2016-01, Vol.113 (3), p.E358-E367) in view of Deisseroth et al. (Patent Pub US2016/0045599, Patent Pub Date: 18 Feb 2016) in view of Kogo (All-optical dynamic clamp VisionNeuroSceintist) in the Office Action mailed 17 November 2025 is withdrawn in view of the arguments received 17 March 2026.
The rejection of claim(s) 12-13, 22-23, 25-26, 35, and 37 under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund in view of Deisseroth in view of Kogo, as applied to claims 1-2, 4, 10-11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Mattis et al (Nature methods, 2012-02, Vol.9 (2), p.159-172) in the Office Action mailed 17 November 2025 is withdrawn in view of the arguments received 17 March 2026.
The rejection of claim(s) 3, 5, 17, 19, 30, and 32 under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund in view of Deisseroth in view of Kogo, as applied to claims 1-2, 4, 10-11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Lapp et al (Scientific reports, 2017-08, Vol.7 (1), p.9629-9629, Article 9629) in the Office Action mailed 17 November 2025 is withdrawn in view of the arguments received 17 March 2026.
The rejection of claim(s) 6-7, 20-21, and 33-34 under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund in view of Deisseroth in view of Kogo, as applied to claims 1-2, 4, 10-11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Guru et al (The international journal of neuropsychopharmacology, 2015-10, Vol.18 (11), p.pyv079) in the Office Action mailed 17 November 2025 is withdrawn in view of the arguments received 17 March 2026.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 11, 14, 16, 18, 24, 27, 29, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Entcheva et al. (Am J Physiol Heart Circ Physiol. 2013 May;304(9):H1179-91) in view of Kornreich et al. (Journal of veterinary cardiology, 2007-05, Vol.9 (1), p.25-37) in view of Berglund et al. (Proceedings of the National Academy of Sciences - PNAS, 2016-01, Vol.113 (3), p.E358-E367).
Claim 11
Claim 11 is drawn to a method for modulating electrophysiology of a cell. Claim 11 step (i) recites providing an excitable cell with at least one light-sensitive ion channel or a light-sensitive ion pump from an exogenous nucleic acid, an electrode, and a light source with a controllable light intensity. Claim 11 step (ii) recites forming a high resistance electrical seal between electrode and a membrane of the cell. Claim 11 step (iii) recites measuring the membrane potential (Vm). Claim 11 step (iv) recites calculating target ion current using a predetermined relationship between time-dependent (Vm) and calculating a target light intensity based on the target ion current calculated. Claim 11 step (v) recites adjusting the light intensity or light wavelength to control an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current calculated in step (iv).
Entcheva teaches an optogenic toolbox with available optogenetic tools for manipulation of membrane potential include excitatory/depolarizing ion channels, e.g., channelrhodopsins and derivative mutants and inhibitory/hyperpolarizng pumps from 2 major classes: proton pumps like bacteriorhodopsin (BR), archaerhodopsin (AR), and Leptosphaeria maculans (Mac) and chloride pumps like halorhodopsin (HR) [page H1182 Fig 2]. Entcheva teaches different methods for inscribing light sensitivity into cardiac tissue [page H1185]. Entcheva teaches a light source. Entcheva teaches using an “optical AP clamp” where a cell’s response to light is measured. The current in response to the light source is mentioned throughout the paper. Additionally, Entcheva teaches delivering light pulses at various wavelengths (i.e., 470nm and 540nm) [page H1183 table 1], as in claim 11 step (i) providing an excitable cell with at least one light-sensitive ion channel or a light-sensitive ion pump from an exogenous nucleic acid and providing a light source step (i). Here, it is inherent to utilize light sources for measuring light intensity and/or light wavelength. It is obvious that a light source would contain controls for choosing specific light wavelength or intensities.
Entcheva teaches using ChR2 for producing voltage- and light-dependent current and shows ChR2 current under different voltage clamps (top) and irradiance levels (bottom). Entcheva teaches measuring Vm, membrane potential using a scale of 100 milliseconds [page H1181 Fig 1B], as in claim 11 step (iii) and step (iv) calcualting target ion current based on.
Entcheva does not teach using electrodes of claim 11 step (i).
Kornreich et al. (Kornreich) teaches a schematic using electrodes [page 34 figure 9], as in claim 11 step (i).
Entcheva does not teach claim 11 step (v).
Berglund et al. (Berglund) teaches “determining light intensity required for inducing action potential by using luminopsin based on Volvox channelrhodopsin 1 (VChR1) that generates subthreshold depolarizations upon application of coelenterazine (CTZ), a substrate for GLuc (3). To determine the light intensity required for the VChR1 moiety within luminescent opsin or luminopsin (LMO) to induce action potential firing, we illuminated a neuron with blue light (465–495 nm, which covered most of the emission spectrum of GLuc) (Fig. 1A)” [page E358-E359], as in claim 11 step (v) adjusting the light intensity or the light wavelength of the light source thereby controlling an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current. It is obvious that the light source (i.e., 465–495 nm) is adjusted and measured because Berglund teaches to determine the light intensity required for the VChR1 moiety within luminescent opsin or luminopsin (LMO) to induce action potential firing (i.e., measured and target ion current), a neuron was illuminated with blue light (i.e., from 465 nm to 495 nm), which covered most of the emission spectrum of GLuc) (Fig. 1A) [page E358 bottom of right col. to E359 top of left col.]. Here, it is obvious the light source was adjusted from 465nm to 495nm (i.e., light wavelength or light intensity) to induce action potential firing (i.e., target ion current). Therefore, Entcheva and Berglund make obvious adjusting the light intensity or the light wavelength of the light source thereby controlling an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current.
With respect to claim 11 step (ii), the step is rendered obvious because one of ordinary skill in the art would understand that forming a seal with an electrode and cell membrane is an inherent step for measuring membrane potential of a cell.
Claim 24
Claim 24 step (i) recites providing an excitable cell with at least one light-sensitive ion channel or a light-sensitive ion pump from an exogenous nucleic acid that further expresses an optogenic light sensor that produces a signal for indicating membrane potential and an optical detector. Claim step (ii) recites measuring the membrane potential (Vm) by measuring the signal from the optogenic sensor with the optical detector. Claim 24 step (iii) recites calcualting target ion current based on Vm using a predetermined relationship between time-dependent (Vm) and calculating a target light intensity based on the target ion current calculated. Claim 24 step (iv) recites adjusting the light intensity or light wavelength to control an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current calculated in step (iii).
Entcheva teaches an optogenic toolbox available optogenetic tools for manipulation of membrane potential including excitatory/depolarizing ion channels, e.g., channelrhodopsins and derivative mutants and inhibitory/hyperpolarizng pumps from 2 major classes: proton pumps like bacteriorhodopsin (BR), archaerhodopsin (AR), and Leptosphaeria maculans (Mac) and chloride pumps like halorhodopsin (HR) [page H1182 Fig 2]. Entcheva teaches different methods for inscribing light sensitivity into cardiac tissue [page H1185]. Entcheva teaches voltage and biochemical actuators and using different spectrums of light such as 450, 470, and 540 nm [page H1183 table 1]. Entcheva teaches an all-optical sensing, actuation, and control of cardiac function [page H1187 figure 6]. The all-optical system contains a light source and a computer controls the LED driver and the acquisition by the photodetectors which allows for a closed-loop feedback control [page H1187 figure 6]. Entcheva teaches the optical sensing can detect Vm of voltage at a light pulse of 50ms at 0.2 mWmm-2 [page 1187 figure 6], as in claim 24 step (i) providing an excitable cell with at least one light-sensitive ion channel or a light-sensitive ion pump from an exogenous nucleic acid, a light source with controllable light intensity of light wavelength, and optical detector. Here, it is obvious that a light source would contain controls for choosing specific light wavelength or intensities.
Entcheva teaches using ChR2 for producing voltage- and light-dependent current and shows ChR2 current under different voltage clamps (top) and irradiance levels (bottom). Entcheva teaches measuring Vm, membrane potential using a scale of 100 milliseconds [page H1181 Fig 1B]. Entcheva teaches the optical sensing can detect Vm of voltage at a light pulse of 50ms at 0.2 mWmm-2 [page 1187 figure 6], as in claim 24 step (ii) and step (iii) calcualting target ion current using time-dependent (Vm). Here, Entcheva teaches that the Vm has already been calculated to provide the data contained within the figures.
Entcheva does not teach claim 24 step (iv).
Berglund et al. (Berglund) teaches “determining light intensity required for inducing action potential by using luminopsin based on Volvox channelrhodopsin 1 (VChR1) that generates subthreshold depolarizations upon application of coelenterazine (CTZ), a substrate for GLuc (3). To determine the light intensity required for the VChR1 moiety within luminescent opsin or luminopsin (LMO) to induce action potential firing, we illuminated a neuron with blue light (465–495 nm), which covered most of the emission spectrum of GLuc) (Fig. 1A)” [page E358-E359], as in claim 24 step (iv) adjusting the light intensity or the light wavelength of the light source thereby controlling an ion current from the light-sensitive protein until the measured ion current is equal to the target ion current. Here, the light source (i.e., 465–495 nm) is adjusted and measured until the LMO reaches an action potential threshold (i.e., measured and target ion current).
With respect to claims 11 step (iv), and 24 step (iii), calculating a target light intensity based on the target ion current is rendered obvious because one of ordinary skill in the art would recognize that one cannot directly calculate light intensity from ion current, as they are distinct measurements. Instead. ion current is used to infer the effectiveness of a known light intensity. Furthermore, to find light intensity, measure the total power and divide it by the area of the light beam at the target, often using formulas like Intensity
P
o
w
e
r
π
r
2
. Entcheva teaches “ChR2 produces voltage- and light-dependent current. The resultant current is predominantly inward/excitatory with a fast peak and sustained component, ChR2 exhibits strong inward rectification with a reversal potential around 0 mV [current-voltage relationship for the sustained component], shown is also a current-irradiance relationship and selected traces for ChR2 current under different voltage clamps (top) and irradiance levels (bottom). Vm, membrane potential.” [page 1181 Fig 1B]. See MPEP 2144.03. Therefore, it would be obvious to one of ordinary skill in the art to utilize the known formulas for calculating light intensity from ion current and the using the data variables (i.e., 5.5
m
W
m
m
2
,
V
m
,
470
n
m
m
,
p
A
/
p
F
) of Entcheva for calculating a target light intensity based on a target ion current. It is noted the specification does not provide a specific formula or provide an embodiment or an example exemplifying calcualting a target light intensity based on target ion current. Therefore, the limitation is obvious over Entcheva and the prior art.
Dependent claim 14, 16, 18, 27, 29, and 31
Entcheva teaches cation and anion analysis [page H1183 table 1], as in claims 16, and 29.
Entcheva teaches using cardiomyocytes [page H1183 right col], as in claims 18, and 31.
With respect to claims 14 and 27, the claims are rendered obvious because one of ordinary skill in the art would recognize that controls are utilized to provide base data (e.g., predetermined relationship) that is used for comparisons to/of experimental data. Thus, it is obvious that a predetermined relationship will be determined from a control excitable cell.
It would be obvious to one of ordinary skill in the art by the effective filing date of the claimed invention to modify Entcheva in view of Kornreich because Kornreich teaches general patch clamp techniques. One of ordinary skill in the art would be motivated to combine Entcheva in view of Kornreich because Kornreich teaches various configurations of patch clamp techniques that involves forming a gigaohm seal [page 33 fig 8]. Here, substituting the sealing techniques of Kornreich into the methods Entcheva would produce a high resistance electrical seal between an electrode and a cell membrane.
It would be obvious to one of ordinary skill in the art by the effective filing date of the claimed invention to modify Entcheva in view of Kornreich in view of Berglund because Berglund teaches utilizing physical and biological light sources for opsin activation using luminopsin [title]. One of ordinary skill in the art would be motivated to combine Entcheva in view of Kornreich in view of Berglund because Berglund teaches determining the light intensity required for the VChR1 moiety within LMO to induce action potential firing by illuminating a neuron with blue light of 465-495 nm. Here, substituting the light intensity thresholds to induce action potential (i.e., ion current) of Berglund into the methods of Entcheva and Kornreich would yield a predictable system that can control and induce an ion current (i.e., action potential) in excitable cells by adjusting the light intensity or light wavelength to meet a specific range or threshold.
Claim(s) 12-13, 22-23, 25-26, 35, and 37 are rejected under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund, as applied to claims 11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Mattis et al (Nature methods, 2012-02, Vol.9 (2), p.159-172).
Entcheva in view of Kornreich in view of Berglund teach claims 11, 14, 16, 18, 24, 27, 29, and 31.
Entcheva in view of Kornreich in view of Berglund teach a method for modulating the electrophysiology of a cell using an excitable cell expressing a light sensitive protein, electrode, and a controllable light source (claim 11) and teach a method for modulating the electrophysiology of a cell using an excitable cell, controllable light source, and an optical detector (claim 24).
Entcheva in view of Kornreich in view of Berglund do not teach claims 12-13, 22-23, 25-26, 35, and 37.
Mattis teaches hyperpolarizing tool shown to be efficacious in neurons was the Natromonas pharaonis halorhodopsin (NpHR) [page 167 left col hyperpolarizing tools], modified for enhanced membrane targeting in mammalian neurons, termed eNpHR2.0 [page 167 right col], teach using eNpHR3.0 [page 167 right col], Mattis teaches using Arch (from Halorubrum strain TP009) [page 167 right col]. Mattis teaches using Mac (from Leptosphaeria maculans) [page 167 right col]. Mattis teaches eBR33 (from Halobacterium) [page 167], as in claims 22 and 35.
Mattis teaches opsin-fluorophore fragments were PCR-amplified to add AscI and NheI, using gtggcgcgccctattacttgtacagctcgtccatg (for all), tatgctagccaccatggactatggcggcgc (for ChR2 mutants), and gttatgctagcgccaccatgtcgcggaggccatggc (for ChIEF), and then ligated to an AAV-Ef1α-DIO backbone [page 20 molecular cloning first paragraph], as in claims 23 and 37.
With respect to claims 12 and 25 repeat steps (iii)-(v) of claim 11 and steps (ii)-(iv) of claim 24, the claims are rendered obvious because one of ordinary skill in the art would recognize that the methods Entcheva in further view of Mattis can be applied to different light sensitive proteins and cells which would require repeating each test per different protein or cell.
With respect to claims 13 and 26, the claims are rendered obvious because Mattis teach using the software, ClampFit, for data analysis [page 23 data analysis]. Entcheva teaches using computer controls the LED driver and the acquisition by the photodetectors [page H1187 fig 6]. Here, using the software ClampFit of Mattis and the computer controls of Entcheva make obvious using a computer for analyzing optogenetic sensors.
It would have been obvious to one of ordinary skill in the art by the effective filing date of the claimed invention to modify the methods of Entcheva in view of Kornreich in view of Berglund, and in further view of Mattis because Mattis teaches methods for applying optogenetic tools and comparative analysis of different microbial opsins which is in the same field of endeavors as Entcheva, Kornreich, and Berglund expand on using various opsins compared to Entcheva, Kornreich, and Berglund. One of ordinary skill in the art would be motivated to combined Entcheva in view of Kornreich in view of Berglund, and in further view of Mattis because Mattis provides guidance with respect to utilizing Matlab and ClampFit software for analyzing electrophysiological results that could be utilized to process the data of Entcheva, Kornreich, and Berglund. Here, there is a reasonable expectation of success combining the method of Entcheva in view of Kornreich in view of Berglund, and in further view of Mattis because Mattis teaches methods for using an excitable cell comprising two different exogenous light proteins that are analyzed using Matlab and ClampFit. Therefore, the system of Mattis could be substituted into the teachings of Entcheva, Kornreich, and Berglund to construct a method for analyzing the electrophysiology of cell membranes.
Claim(s) 17, 19, 30, and 32 are rejected under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund, as applied to claims 11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Lapp et al (Scientific reports, 2017-08, Vol.7 (1), p.9629-9629, Article 9629).
Entcheva in view of Kornreich in view of Berglund teach claim 11, 14, 16, 18, 24, 27, 29, and 31.
Entcheva in view of Kornreich in view of Berglund teach a method for modulating the electrophysiology of a cell using an excitable cell expressing a light sensitive protein, electrode, and a controllable light source (claim 11) and teach a method for modulating the electrophysiology of a cell using an excitable cell, controllable light source, and an optical detector (claim 24).
Entcheva in view of Kornreich in view of Berglund do not teach claims 17, 19, 30, and 32.
Lapp et al. (Lapp) teach Frequency-dependent drug screening using optogenetic stimulation of human iPSC-derived cardiomyocytes [title], as in claims 19 and 32.
With respect to claims 17, and 30, the claims are rendered obvious because Entcheva teaches optogenetics in neuroscience [page H1182 right col last paragraph]. Here, the teachings of Entcheva and Lapp would construct of group of excitable cells consisting of a neuron, a muscle cell and an excitable cell derived from an induced Pluripotent Stem Cell (iPSC) because Entcheva teaches researching cardio optogenetics, Berglund teaches using neurons [page E359 fig 1], and Lapp teaches stimulating human iPSC-derived cardiomyocytes [title].
It would have been obvious to one of ordinary skill in the art by the effective filing date of the claimed invention to modify the methods of Entcheva in view of Kornreich in view of Berglund, and in further view of Lapp because Lapp teaches utilizing human induced pluripotent stem cell-derived cardiomyocytes or (iPSC)-derived cardiomyocytes. One of ordinary skill in the art would be motivated to combined Entcheva in view of Kornreich in view of Berglund, and in further view of Lapp because Lapp provides further software tools for optogenetic analysis such as using the cardiac AP analysis module of LabChart software (AD Instruments) with respect to analyzing (iPSC)-derived cardiomyocytes [page 3 patch clamp experiments]. One of ordinary skill in the would expect a reasonable success in the combining Entcheva in view of Kornreich in view of Berglund, and in further view of Lapp because Lapp provides simple optogenetic screening tools for measuring extracellular field potentials (FP) from paced cardiomyocytes to identify drug effects over the whole physiological heart range, which is essential given the rate-dependency of ion channel function and drug action [abstract]. Here, the teachings of Entcheva in view of Kornreich in view of Berglund, and in further view of Lapp would construct a group of excitable cells consisting of neuron, muscle cell, and excitable cell derived from induced pluripotent stem cells (iPSC) for measuring electrophysiology.
Claim(s) 20-21, and 33-34 are rejected under 35 U.S.C. 103 as being unpatentable over Entcheva in view of Kornreich in view of Berglund, as applied to claims 11, 14, 16, 18, 24, 27, 29, and 31 above, and in further view of Guru et al (The international journal of neuropsychopharmacology, 2015-10, Vol.18 (11), p.pyv079).
Entcheva in view of Kornreich in view of Berglund teach claims 11, 14, 16, 18, 24, 27, 29, and 31.
Entcheva in view of Kornreich in view of Berglund teach a method for modulating the electrophysiology of a cell using an excitable cell expressing a light sensitive protein, electrode, and a controllable light source (claim 11) and teach a method for modulating the electrophysiology of a cell using an excitable cell, controllable light source, and an optical detector (claim 24).
Entcheva in view of Kornreich in view of Berglund do not teach claims 20-21, and 33-34.
Guru et al. (Guru) teach using the channel rhodopsin ChR2 [page 2 figure 1]. Guru teaches using eNpHR [page 2 figure 1]. Guru teaches a family of opsin-receptor chimeras called optoXRs [page 5 left col optogenetic control of intracellular signaling], as in claims 20 and 33.
Guru teaches utilizing C1V1 (a variant generated by fusing the N-terminal sequence of ChR1 [page 4 left col spectrally shifted excitatory opsins]. Guru teaches Chr2 [page 2 figure 1]. Guru teaches first red-shifted opsin, VChR1, was identified in Volvox carteri and had an excitation maximum at 535 nm [page 4 left col spectrally shifted excitatory opsins]. Guru teaches step function or bi-stable opsins (SFOs) are useful tools for achieving this purpose, and were created by modifying ChR2 to stabilize the open conducting state [page 3 step-function opsins], as in claims 21 and 34.
It would have been obvious to one of ordinary skill in the art by the effective filing date of the claimed invention to modify the methods of Entcheva in view of Kornreich in view of Berglund, and in further view of Guru because Guru teaches a review of different methods of optogenetics with respect to positive and negative ion channels and pumps. One of ordinary skill in the art would be motivated to combine the methods Entcheva in view of Kornreich in view of Berglund, and in further view of Guru because Guru teaches methods for analyzing different channelrhodopsins with respect to optogenetics. One of ordinary skill in the art would expect reasonable success utilizing the methods Entcheva in view of Kornreich in view of Berglund, and in further view of Guru because Guru teaches processing iPSC-derived cardiomyocytes that contain channelrhodopsin-2 (ChR2) which is an opsin utilize in Entcheva. Thus, combining the light sensitive proteins and channel rhodopsins of Guru with the light sensitive proteins and channel rhodopsin’s of Entcheva, Kornreich, and Berglund would construct a group consisting of different light sensitive proteins and channel rhodopsin’s.
Response to Arguments
Applicant's arguments, filed 17 March 2026, have been fully considered but the rejection is maintained.
The Applicant states Kogo does not qualify as prior art. The Applicant states the website used in the Office Action mailed 17 November 2025 [page 20] does not provide support that Kogo was using an optical dynamic clamp. The Applicant points to the specification paragraph [0053]. The Applicant states all the rejections under 35 U.S.C § 103 should be withdrawn based on Kogo [remarks, pages 13-14].
In response, the rejection has been modified such that exclude Kogo from the rejection. As noted in the 35 U.S.C § 103 of the Office Action mailed 17 November 2025 [page 20], Kogo was utilized to teach the optical dynamic clamp of claim 1. Thus, because Kogo was not relied upon for teaching the other elements of the instant claims, Entcheva, Kornreich, Berglund, Mattis, Lapp, and Guru address the limitations of the instant claims (i.e., 11-14, 16-27, and 29-37). Therefore, the rejection under 35 U.S.C § 103 is maintained.
Conclusion
Claims 1-14, 16-27, and 29-37 are rejected.
No claims are allowed.
Finality
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Inquiries
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH C PULLIAM whose telephone number is (571)272-8696. The examiner can normally be reached 0730-1700 M-F.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Karlheinz Skowronek can be reached at (571) 272-9047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/J.C.P./Examiner, Art Unit 1687
/Anna Skibinsky/
Primary Examiner, AU 1635
Prosecution Insights