DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on September 15, 2025 has been entered.
Application Status
Applicant’s remarks, and amendments to the claims and specification filed September 15, 2025 are acknowledged. Applicant amended claims 23, 28-29, 31, and 36, and canceled claims 24-27, and 30. Accordingly, claims 23, 28-29, and 31-36 are pending and under examination herein.
The terminal disclaimer, also filed September 15, 2025, disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of any patent granted on pending Application No. 17/288,574, has been approved.
Withdrawn Rejections
Applicant’s remarks and the amendments to the claims have been thoroughly considered. The amendments to the claims resolve the § 112(b) and § 112(d) rejections raised in the prior action. The amendments also limit the 5’ UTR of the rhodopsin transgene so as to overcome the § 112(a) Written Description rejections described in the prior action. Finally, the approved terminal disclaimer obviates the nonstatutory double patenting rejections over co-pending Application No. 17/288,574. The aforementioned rejections are withdrawn, accordingly.
Applicant’s remarks and the amendments to the claims have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 28-29, and 31 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by Applicant’s amendments to the claims.
Claim 28 recites that the rhodopsin transgene “comprises a coding region comprising the sequences of SEQ ID NO: 24 and SEQ ID NO: 25.” Claim 23 previously recites a coding region of the rhodopsin transgene. It is not clear whether the term “a coding region” in claim 28 refers to the previously recited coding region in claim 23, or another, separate coding region. Accordingly, the structure of the coding region(s) within the rhodopsin transgene, and the resultant gene therapy vector encompassed by claim 28 are unclear.
Claim 29 is rejected for depending from claim 28 and failing to remedy the indefiniteness. It is further noted that claim 29 also recites that the rhodopsin transgene “comprises a coding region consisting of….” It is not clear whether the limitations in claim 29 apply to the previously recited coding region in claim 23, or the possible, additional coding region recited in claim 28, or another, separate coding region relative to the previously mentioned coding region(s). Thus, claim 29 also renders the structure of the coding region(s) within the rhodopsin transgene and the resultant gene therapy vector unclear.
In the interest of compact prosecution, the term “a coding region” in claims 28-29 is interpreted hereinafter as referring to the previously recited coding region of the rhodopsin transgene in claim 23.
Claim 29 recites that the “rhodopsin transgene comprises a coding region consisting of the sequence of nucleotides 20 to 2866 of SEQ ID NO: 28.” As shown in the attached alignments, nucleotides 20 to 2866 of SEQ ID NO: 28 comprise the 5’ UTR sequence set forth in SEQ ID NO: 27. The structure of the rhodopsin transgene’s coding region is unclear, therefore, because it appears to require a 5’ untranslated region (UTR) sequence, which I) is a separate region of the transgene based on the limitations of claim 23, and II) by virtue of being untranslated, does not encode a gene product, and therefore, would not be considered a part of a “coding region” by one of ordinary skill.
Furthermore, based on the attached alignments, nucleotides 20 to 2866 of SEQ ID NO: 28 comprise sequences 100% reversely complementary to SEQ ID NOs: 5 and 7. The term “gene therapy vector” encompasses double-stranded DNA vectors. Therefore, a vector comprising a sequence corresponding to nucleotides 20 to 2866 of SEQ ID NO: 28 would comprise the sequences of SEQ ID NOs: 5 and 7, such that claim 29 no longer comprises a coding region lacking SEQ ID NOs: 5 or 7 as required of claim 23. See Fig. A below. Taken together, the structure of the coding region within the rhodopsin transgene and the resultant gene therapy vector are unclear.
Figure A
5’ GTAGATGACAAAAGACTCGTT 3’ SEQ ID NO: 28 (nts 1675-1695)
3’ CATCTACTGTTTTCTGAGCAA 5’ complement to nts 1675-1695
3’ CATCTACTGTTTTCTGAGCAA 5’ SEQ ID NO: 7
5’ GTGAGGAAGTTGATGGGGAAG 3’ SEQ ID NO: 28 (nts 1505-1525)
3’ CACTCCTTCAACTACCCCTTC 5’ complement to nts 1505-1525
3’ CACTCCTTCAACTACCCCTTC 5’ SEQ ID NO: 5
Claim 31 recites that the 5’ UTR of the rhodopsin transgene “has the sequence of SEQ ID NO: 27” (emphasis added). Based on alignments between SEQ ID NO: 27 and the features recited in claim 23, SEQ ID NO: 27 corresponds to the 5’ UTR encompassed by option (i) of claim 23. However, claim 23 recites that the “5’ UTR of the rhodopsin transgene consists of” the recited features (emphasis added). The term “has” in claim 31 is open, whereas the term “consists of” in claim 23 is closed. Thus, the scope claim 31 is confusing because, while SEQ ID NO: 27 corresponds to the 5’ UTR encompassed by option (i) of claim 23, claim 31 now appears to allow for the 5’ UTR to comprise additional features by virtue of the open “has” language. It is not clear whether the term “has” intends to require the 5’ UTR encompassed by option (i) of claim 23, or whether it intends to allow for a 5’ UTR comprising additional features to those recited in claim 23.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 29 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is a new rejection necessitated by Applicant’s amendments to the claims.
Claim 29 recites that the “rhodopsin transgene comprises a coding region consisting of the sequence of nucleotides 20 to 2866 of SEQ ID NO: 28.” As described above, based on the attached alignments, a gene therapy vector comprising nucleotides 20 to 2866 of SEQ ID NO: 28 comprises SEQ ID NOs: 5 and 7, such that claim 29 no longer comprises a coding region lacking SEQ ID NOs: 5 or 7 as required of claim 23. Thus, the claim fails to include all the limitations of the claim from which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 23, 28-29, and 31-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection necessitated by Applicant’s amendments to the claims.
MPEP 2163.06(I) provides that “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph – written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).”
Claim 23 has been amended to recite a 5’ UTR which “consists of a 5’ end consisting of the sequence of nucleotides 1 to 423 of SEQ ID NO: 39; a 3’ end consisting of the sequence of nucleotides 424 to 439 of SEQ ID NO: 39; and a sequence inserted between nucleotides 1 to 423 and 424 to 439 of SEQ ID NO: 39; wherein said inserted sequence consists of… (ii) in a 5’ to 3’ direction: (a) SEQ ID NO: 26, (b) ATC, (c) SEQ ID NO: 37, (d) SEQ ID NO: 12, and (e) SEQ ID NO: 38.” Applicant’s remarks indicate that support for the amendments to claim 23 can be found “in the subject matter of claim 31 and Example 13 of the application as filed, at page 42 lines 3 to 9 (PCT/GB2019/053037/WO 2020/084319).” Applicant indicates that support for “an additional copy of the sequences is also found at page 18 line 30 to page 19 line 27, particularly page 19 lines 24 to 27 of the PCT application as filed.”
Based on the specification, SEQ ID NO: 26 corresponds to a sequence comprising two mirtrons (M3 and M5) in tandem flanked by ESE-rich sequences corresponding to SEQ ID NOs: 37-38. SEQ ID NO: 12 corresponds to mirtron M3. Thus, the 5’ UTR encompassed by option (ii) comprises three specific mirtons in tandem flanked by specific sequences, i.e., “ATC,” and the ESE-rich sequences corresponding to SEQ ID NOs: 37-38, in a specific orientation. A thorough review of Applicant’s proffered locations and the disclosure as a whole failed to uncover any basis for this specific species of 5’ UTR.
Instant claim 31 corresponds to the sequence of SEQ ID NO: 27, which corresponds to the 5’ UTR encompassed by option (i) recited in claim 23, in which mirtrons M3 and M5 are in tandem (see pg. 10, lines 19-20). Example 13 describes construction of vectors in which a single mirtron (M2, M3, or M5) flanked by the ESE-rich sequences of SEQ ID NOs: 37-38 was cloned into an EcoRV blunt restriction site “(GAT|ATC)”(Examples 13-14, pg. 45, line 3 to pg. 47, line 17). WO 2020/084319, pg. 42, lines 3-9 was also reviewed. This location corresponds to a portion of Example 13, the contents of which is discussed immediately above. Examples 13-14, while describing construction of 5’ UTRs comprising single mirtrons flanked by SEQ ID NOs: 37-38, and providing a basis for the sequence “ATC,” do not appear to correspond to either 5’ UTRs encompassed by options (i) or (ii) recited in claim 23. WO 2020/084319, pg. 18, line 30 to pg. 18, line 27 was also reviewed, as this location is alleged to provide support for the “additional copy of the sequences” in the insert sequence recited in option (ii). This location corresponds to a section titled “Vectors comprising multiple mirtrons,” in which vectors comprising a 5’ UTR with “multiple mirtrons” or “two or more” mirtrons are generically described. Based on a thorough review, none of Applicant’s proffered locations provide a basis for the specific species of 5’ UTR encompassed by option (ii) of claim 23.
The entire disclosure was reviewed. The review failed to uncover any examples of 5’ UTRs with more than two mirtrons, let alone the specific species of 5’ UTR encompassed by option (ii) of claim 23. The disclosure’s examples are limited to 5’ UTRs comprising two mirtrons in tandem, in very specific combinations (i.e., M3/M5, M3/M3, see at least Examples 15-17, and 22). The review also failed to find any specific contemplation of “triple” mirtron-containing 5’ UTRs as Applicant’s remarks later assert (see pg. 11 of the remarks). As stated above, the specification generically describes vectors comprising a 5’ UTR with “multiple mirtrons” or “two or more” mirtrons; however, this generic disclosure does not provide a basis for the very specific 5’ UTR currently encompassed by option (ii) in claim 23. Taken together, neither Applicant’s proffered locations or the disclosure as a whole, provide explicit, implicit, or inherent support for the specific species of 5’ UTR encompassed by option (ii) of claim 23, and the claim is rejected as incorporating new matter.
Dependent Claims
Claims 28-29, and 31-36 are rejected for depending from claim 23 and failing to remedy the deficiencies described above.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600