Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Receipt is acknowledged of amendment, filed 04/30/2025.
It is noted that the amendment to the claims filed on 04/30/2025 does not comply with the requirements of 37 CFR 1.121(c) because the proper status identifiers were not proved for claims 2, 3 and 5. However, in the interest of compact prosecution, the amendment to the claims has been entered.
In this case, it does not comply because each claim was not provided with a proper status identifier. Claim 2 should have the status identifier “Currently amended,” and claims 3 and 5 should have the status identifier “Previously presented.”
Therefore, claim 2, 3, 5 and 7 are currently under examination.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Acknowledgment is made of applicant’s claim for priority based on a PCT 371 application filed as PCT/CN2019/112556 on 10/22/2019.
Due to the foreign priority documents not being in English, all claims are given the priority date of 10/22/2019.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency #1 – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specific deficiency of the Specification sequence compliance is the following:
“PJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC), 19-nt repeat sequence (AATTTCTACTCTTGTAGAT) and two Bsa I cleavage sites (GGAGACCGAGGTCTCA) are connected in series and assembled on pEZ15a vector” on page 13 (2nd paragraph) of the specification does not include sequence identifiers within the current sequence listing.
Specific deficiency #2 – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
The specific deficiencies of are noted of the following figures:
Figure 2 contains nucleic acid sequences not identified with a sequence identifier within the figure of the brief description of the drawing. The repeat sequence should be identified as SEQ ID NO: 35; the protospacer sequences of C2S7 should be identified as SEQ ID NOs: 3 and 1, respectively; and the protospacer sequences of C3S4 should be identified as SEQ ID NOs: 7 and 5, respectively.
Figure 7 shows UFZMO0038 where part of sequence 19 are included but not identified and DFZMO0038 where part of sequence 14 is include but not identified.
Figure 8 shows the UFZMO0038 protospacer sequence which corresponds to SEQ ID NO: 19 but it is not identified as such. The figure also includes the UFZMO0038 nucleic acid sequence which corresponds to SEQ ID NO: 23.
The sequence(s) shown in figures 10, 11, 19, 24, 27 and 30 are not present in the sequence listing.
Figure 13 corresponds to SEQ ID NO: 31 but is not identified.
Figure 18 corresponds to SEQ ID Nos: 44, 48 and 52 respectively but are not identified.
Figure 21 corresponds to SEQ ID NO: 65 but is not identified.
Claim Objections
Claim 2 is objected to because of the following informalities: the phrase "an nuclease Cas12a" should be amended to recite "a gene encoding nuclease Cas12a." It is clear from reading the disclosure that the gene encoding the Cas 12a nuclease is present in the genome at the indicated locus and not the nuclease itself. Appropriate correction is required.
Claim 5 is objected to because of the following informalities: the claim recites the abbreviation PAM. The abbreviation should be spelled out in the first appearance of the claims and should be followed by the abbreviation in parentheses. Appropriate correction is required.
Claim 7 is objected to because of the following informalities: each occurrence of the phrase "setting forth" should be replaced with "set forth" to improve the grammar of the claim.
Appropriate correction is required.
Response to Arguments – Claim Objections
The previous objections to claims 1, 11 and 12 have been withdrawn in view of Applicant’s cancellation of the claims in the reply filed 04/30/2025.
Applicant's arguments filed 04/30/2025 have been fully considered but they are not persuasive.
Applicant states the objected claims 3 and 5 are canceled without prejudice or disclaimer as well as objected claim 7 is currently amended.
Regarding objected claim 7, Applicant only corrected one of the three instances where “setting forth” was stated. Regarding objected claims 2 and 5, Applicant states the claims have been canceled however, the claims are not cancelled on the new claim sheet. Therefore, the claim is still pending and the objection maintained.
The previous objections to claims 2, 5 and 7 have been maintained.
Response to Arguments - Claim Rejections - 35 USC § 112(b)
The previous rejection of claims 9, 12 and 14 under 35 U.S.C. 112, second paragraph, has been withdrawn in view of Applicant’s cancellation of the claims in the reply filed on 04/30/2025.
The previous rejection of claim 5 under 35 U.S.C. 112, second paragraph, has been maintained. Applicant argues the rejection should be withdrawn due to the cancellation of claim 5, however, the claim is not cancelled on the new claim sheet. Therefore, the claim is still pending and the rejection maintained.
Claim Rejections - 35 USC§ 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (preAIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 5 recites the limitation "the PAM sequence of said guide sequence" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. The specification teaches "The sequence of 23 bp downstream of the TTTN is used as the target guide sequence for constructing the gRNA in the target plasmid to guide the cleavage of the target site by the nuclease." See the last full sentence of page 13. Claim 5 depends from claim 2, which requires "an editing plasmid comprising a guide sequence, an expression unit, and a donor DNA sequence." Claim 5 does not provide antecedent basis for the PAM sequence. Yamano et al (Cell, Volume 165, Issue 4, 949 - 962) teach that Cpfl (a.k.a. Cas12a) is what recognizes the TTTN protospacer adjacent motif (PAM) in a target nucleic acid (e.g., Abstract; Page 949). The claim does not require the presence of a target nucleic acid. The claims do not provide inherent support or antecedent basis for the presence of a PAM sequence. It is unclear whether the claim is reciting an inherent property of Cas 12a, which is the recognition of a TTTN PAM sequence, or whether the claim requires a target sequence comprising TTTN to be present in the composition.
Response to Arguments - Claim Rejections - 35 USC § 112(a)
The previous rejection of claim 12 under 35 U.S.C. 112, first paragraph, has been withdrawn in view of Applicant’s cancellation of the claim in the reply filed on 04/30/2025.
The previous rejection of claim 3 under 35 U.S.C. 112, first paragraph, has been maintained. Applicant argues the rejection should be withdrawn due to the cancellation of claim 3; however, the claims are not cancelled on the new claim sheet. Therefore, the claims are still pending and the rejection maintained.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 3 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
On 09/01/2024, claim 3 was amended to recite, "Zymomonas mobilis ZM4 ATCC 31821". The reply filed 09/01/2024 does not provide any reasoning or remarks on the new matter provided by the addition of the term added to the claims.
The original disclosure was reviewed and no support could be found for Zymomonas
mobilis ZM4 ATCC 31821. While the specification provides support for Zymomonas mobilis ZM4 (e.g., page 3, 2nd paragraph; page 5, last paragraph; page 11, Example 2, 1st paragraph), disclosure of this strain does not provide implicit support for Zymomonas mobilis ZM4 ATCC 31821, because more than one source of Zymomonas mobilis ZM4 was known in the art (Kim et al. Physiology and Biotechnology, Vol. 66, No. 1, pages 186-193, January 2000, cited in a prior action; e.g., page 186, right column, Organism and culture maintenance).
The original specification, drawings and claims were thoroughly reviewed and no support could be found for the amendment. Accordingly, the amendment is a departure from the disclosure as originally filed, and Applicant has not pointed to a specific portion of the original disclosure that provides support.
Response to Arguments - Claim Rejections - 35 USC § 112(d)
The previous rejection of claim 8 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, fourth paragraph, has been withdrawn in view of Applicant’s cancellation of the claim in the reply filed on 04/30/2025.
Response to Arguments - Claim Rejections - 35 USC § 101
The previous rejection of claim 1 under 35 U.S.C. 101, has been withdrawn in view of Applicant’s cancelation of the claim in the reply filed on 04/30/2025.
Response to Arguments - Claim Rejections - 35 USC § 102
The previous rejection of claims 1, 6, 9, 11, 12 and 14 under 35 U.S.C. 102, has been withdrawn in view of Applicant’s cancelation of the claims in the reply filed on 04/30/2025
The previous rejection of claim 2, 3 and 5 under 35 U.S.C. 102, has been maintained. Applicant argues the rejection should be withdrawn due to the cancellation of claims 2, 3 and 5; however, the claims are not cancelled on the new claims sheet. Therefore, the claims are still pending and the rejection maintained.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 2, 3 and 5 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shen et al (Microb Cell Fact; October 3, 2019; 18:162, 1-11, cited in a prior action). This rejection was made in the action mailed 2/10/2025. The evidence provided by Dong et al and GenBank Accession No. AAV89305.2 was not relied upon for the rejection of claims 2, 3 and 5 and has been removed from the rejection statement to address the amendment to the claims in the reply filed 4/30/2025.
Regarding claims 2 and 3, Shen teaches a recombinant Zymomonas mobilis ZM4 ATCC
31821 strain with the ZMO0038 loci replaced with a nucleotide sequence comprising a tetracycline-inducible promoter linked to a sequence encoding Cas12a, where the recombinant strain comprises a plasmid comprising a guide sequence, an expression unit comprising a promoter and mCherry coding sequence, and a donor DNA of the claim (e.g., Page 3; Column 1, full paragraph; paragraph bridging Pages 5-6; Pages 8-9, Generation of Cas Ila-Targeting gRNA constructs; Page 10; Column 1, box; Table l; Fig. 4).
Regarding claim 5, Shen teaches that Casl2a recognizes a TTTN PAM (e.g., Page 9;
Column 1, 1st paragraph).
Response to Arguments - Claim Rejections - 35 USC § 103
The previous rejection of claims 11 and 12 under 35 U.S.C. 103, has been withdrawn in view of Applicant’s cancelation of the claims in the reply filed on 04/30/2025.
The previous rejection of claims 2, 3 and 5 under 35 U.S.C. 103, has been maintained. Applicant argues the rejection should be withdrawn due to the cancellation of claims 2, 3 and 5; however, the claims are not cancelled on the new claims sheet. Therefore, the claims are still pending and the rejection maintained.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2 and 5 are rejected under 35 U.S.C. 103 as being unpatentable over Smith et al (WO 2018/049168 Al) in view of Yang et al (US 2014/0342421 Al) and Yan et al (Applied and Environmental Microbiology; Vol 83, Iss 17; 2017).
Smith teaches a CRISPR-Retron system comprising plasmid vector comprising a retron comprising a donor DNA sequence and a guide RNA (gRNA) coding region (e.g., paragraphs [0077], [0098] and [0105). Smith teaches the vector further comprising a reverse transcriptase (RT) coding sequence operably linked to a promoter (e.g., paragraph [0108]). Smith teaches the CRISPR-Retron system further comprising a nuclease expressed from the genome of a cell or on a separate plasmid (e.g., paragraph [0027]). Smith teaches the nuclease is Cpfl (e.g., paragraph [0027]). Smith teaches that Cpflis used to recognize a target DNA sequence 3' ofa 5'-TTTN-3' PAM sequence (e.g., paragraph [0129]). Smith teaches a bacterial host cell comprising the CRISPR-Retron system (e.g., paragraph [0150]). Smith teaches that the host cell is capable of expressing a nuclease, such as a Cpfl nuclease, prior to transforming the host cell with the vector, where the nuclease is encoded in a sequence integrated into the host cell genome (e.g., paragraph [0027]).
Regarding claims 2 and 5, Smith teaches the CRISPR-Retron system further comprising a
nuclease expressed from the genome of a cell or on a separate plasmid (e.g., paragraph [0027]).
Smith teaches the nuclease is Cpfl (e.g., paragraph [0027]). Smith teaches that Cpflis used to recognize a target DNA sequence 3' ofa 5'-TTTN-3' PAM sequence (e.g., paragraph [0129]). Smith does not teach a recombinant Zymomonas mobilis strain comprising a gene encoding Casl2a nuclease in its ZMO0038 Ioci.
Yang teaches that genetic modification that increases the growth rate or biofuel production rate of the modified microorganism in the presence of a feedstock inhibitor compound [0008]. Yang teaches that the genetic modification worked within the Zymomonas mobilis ZMO0038 Ioci [0038].
Yang does not teach the use of the Casl2a nuclease controlled by a tetracycline-inducible promoter.
Yan teaches that compared to the CRISPR-Cas9 system, the CRISPR-Cas12a system is a
dual nuclease that only requires initial recognition of a PAM, a short DNA sequence adjacent to
the protospacer site that is complementary to the crRNA spacer segment (Page 1, Introduction).
Yan teaches that the Cas12a system recognizes thymidine-rich PAM sequences and the Cas12a
system is involved in crRNA processing, target-site recognition and DNA cleavage (Page 1; Introduction). Yan teaches the use of CRISPR-Cas12a genome editing system showed efficient
genetic manipulation (Page 9; Paragraph 1). Yan teaches that the cas12a is capable of efficiently
generating point mutations and deletions as well as it can be used to insert DNA fragments into
chromosomes (Page 9; Paragraph 2). Yan teaches that anhydrotetracycline was used in the case
of M. smegmatis culture to induce the function of the Cas 12a with a tetO promoter, tetracycline
inducible promoter (Page 10; Materials and Methods). Yan teaches that the Cas12a is highly
specific and confirms that nonhomologous end-joining (NHEJ) mutants are unlikely to be generated (Page 10; Paragraph 1). Yan teaches that the use of Cas12a gene editing is important due to it being able to be used when the toxicity of the Cas9 system is too great (Page 10; Paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing
date of the claimed invention to modify the teachings of Smith to include the Zymommonas mobilis bacteria and the specific loci known as ZMO0038 as well as the ability for insertion of gene editing at this loci taught by Yang and to include the Cas 12a system for gene editing and modification taught by Yan because Smith teach it is within the ordinary skill in the art to use the cas9 system for gene editing with bacteria for the purpose of gene modification, Yang teaches that it is possible to accomplish gene editing at the specific loci, ZMO0038, in order to produce expression of a different DNA sequence and Yan teaches that Cas 12a is often better than Cas9 for gene editing in bacteria. Further, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Smith, Yang and Yan to produce the invention of the instant claims 2 and 5 such that Smith teaches the gene editing plasmid itself with the Cas9 system, Yang teaches the increased benefit of genetically modifying the bacteria known as Z. mobilis and Yan teaches the added benefit of the Casl2a system over the Cas9 system.
One would have been motivated to make such a modification in order to receive the expected benefit of increased production rate of biofuel using the bacteria, Z. mobilis, at a specific locus as taught by Yang as well as more efficient Casl2a system that is time-efficient, cost effective, less toxicity and lower error mutation rate than displayed in the cas9 system as taught by Yan.
Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Smith et al (WO
2018/049168 Al) in view of Yang et al (US 2014/0342421 Al) and Yan et al (Applied and Environmental Microbiology; Vol 83, Iss 17; 2017) as applied to claim 2 above, and further
in view of Wang et al (Metabolic Engineering, 50, 57-73; 2018).
The combined teachings of Smith, Yang and Yan are described above and applied as before.
Further, Yan teaches expression of the Cas 12a nuclease is controlled by a tetracycline inducible promoter (Page 10; Materials and Methods).
Smith, Yang and Yan do not teach the specific ATCC 31821 Z. mobilis strain.
Wang teaches the Zymomonas mobilis strain ATCC 31821 for genome editing (Page 59, Column 1 & Table 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Smith, Yang and Yan to include the specific strain of A TCC 31821 of the Z. mobilis taught by Wang because Smith teach it is within the ordinary skill in the art to use the cas9 system plasmid construct for gene editing with bacteria for the purpose of gene modification, Yang teaches that it is possible to accomplish gene editing at the specific loci, ZMO0038, in order to produce expression of a different DNA sequence, Yan teaches that Cas 12a is often better than Cas9 for gene editing in bacteria and Wang teaches the specific strain as ATCC 31821 ZM4 Z. mobilis bacteria. Further, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Smith, Yang, Yan and Wang to produce the invention of the instant claim 3 such that Smith teaches the gene editing plasmid itself with the Cas9 system, Yang teaches the increased benefit of genetically modifying the bacteria known as Z. mobilis, Yan teaches the added benefit of the Cas 12a system over the Cas9 system and Wang teaches the specific Z. mobilis strain ATCC 31821.
One would have been motivated to make such a modification in order to receive the expected benefit of increased production rate of biofuel using the bacteria, Z. mobilis strain ATCC 31821 as taught by Wang.
Allowable Subject Matter
Claim 7 is allowable over the prior art in view of amendments filed on 04/30/2025.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA ROSE LIPPOLIS whose telephone number is (703)756-5450. The examiner can normally be reached Monday-Friday, 8:00am to 5:00pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEXANDRA ROSE LIPPOLIS/ Examiner, Art Unit 1637
/Jennifer Dunston/ Supervisory Patent Examiner, Art Unit 1637