DETAILED ACTIONNotice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 7/18/25 has been entered.
Application Status
Claims 1, 30, 44, 46-47, 49, 56, 73, 77, and 79 are currently pending.
Claims 1 and 46 are amended.
No new claims have been added. Examination on the merits commences on claims 1, 30, 44, 46-47, 49, 56, 73, 77, and 79.
Applicants are informed that the rejections and/or objections of the previous Office action not stated below have been withdrawn from consideration in view of the Applicant' s arguments and/or amendments. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 112(a) – Written Description - NEW
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 1, 30, 44, 46-47, 49, 56, 73, 77, and 79 is/are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.”
For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species’ means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.”
The claims are drawn to “single-stranded oligonucleotide of 10-30 linked nucleosides in length, wherein the oligonucleotide comprises a region of at least 10 contiguous nucleobases having at least 90% complementarity to an OGG1 gene, wherein the oligonucleotide comprises the nucleobase sequence of any one of SEQ ID NOs: 106-108, and wherein the oligonucleotide comprises:(a) a DNA core sequence comprising linked deoxyribonucleosides;(b) a 5' flanking sequence comprising linked nucleosides; and(c) a 3' flanking sequence comprising linked nucleosides; wherein the DNA core comprises a region of at least 10 contiguous nucleobases positioned between the 5' flanking sequence and the 3' flanking sequence; wherein the 5' flanking sequence and the 3' flanking sequence each comprises at least two linked nucleosides; and wherein at least one nucleoside of each flanking sequence comprises an alternative nucleoside comprising at least one alternative nucleobase selected from 5'-methylcytosine, pseudouridine, and 5-methoxyuridine, and at least one alternative sugar moiety selected from 2'-O-methyl, and a bicyclic nucleic acid; and wherein all cytosines within the DNA core are 5'-methyl-2'-O-methoxyethyl-dCytosine, and wherein all thymidines in the flanking sequences are 5'-methyl-2'-O-methoxyethyl-Uracil,and wherein the oligonucleotide exhibits at least 85% mRNA inhibition at a 20 nM oligonucleotide concentration, and wherein the oligonucleotide exhibits at least 60% mRNA inhibition at a 2 nM oligonucleotide concentration, when determined using a cell assay when compared with a control cell.”
The specification has not adequately described the entire genus of “oligonucleotides” for the following reasons.
Size and Breadth of the Genus
The claims are drawn to a single stranded oligonucleotide. However, given the amended functional limitations, the claimed language does not sufficiently limit the structure of the oligonucleotides in length, specific modification, secondary/tertiary structure, or further function, and therefore could encompass any means, directly or indirectly, for targeting an OGG1 gene in the treatment of the subject with a trinucleotide expansion disorder. The genus of “oligonucleotides” is broad and diverse in the art. Oligonucleotides can be of variable length, partly DNA or partly RNA, modified with 2’, 5’, and 3’ modifications, etc. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others.
In this case, the claims encompass the genus of oligonucleotides with broad functional limitations, where there is substantial variation within the genus, even upon the further structural limitations of claim 1. As such, the genus of “oligonucleotides” is extensive and diverse.
Species disclosed in the Specification
The Specification discloses a variety of nucleic acids (pg 7) that can serve as oligonucleotides that target the OGG1 gene, including lengths of up to 30 nucleotides and wherein the oligonucleotide exhibits at least 85% mRNA inhibition at a 20 nM oligonucleotide concentration, and wherein the oligonucleotide exhibits at least 60% mRNA inhibition at a 2 nM oligonucleotide concentration (pg 4). However, in the working Examples, the Specification (pg 65 Example 1) describes the activity of only 20-mer oligonucleotide sequences of specific 2'-MOE residues and phosphorothioate chemical modification patterns, including the claimed 20-mer SEQ ID NOs 106-108.
Although the specification describes several embodiments of “oligonucleotide,” the specification fails to teach representative species of oligonucleotides of the claimed length with the claimed core DNA and flanking sequence modification which sufficiently describe the full genus capable of targeting an OGG1 gene in the treatment of the subject with a trinucleotide expansion disorder.
Species Disclosed in the Art
The genus of “oligonucleotide” is broad and diverse in the art. Oligonucleotides can be single stranded or double stranded, DNA or RNA, modified with 2’, 5’, and 3’ modifications. Single stranded oligonucleotides may have a double stranded region, and double stranded oligonucleotides may have a single stranded region. Some oligonucleotides include structural genes, genes containing control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNA and other RNA interference reagents (RNAi or iRNA agents), shRNA, antisense oligos. Nucleotide, ribozyme, microRNA, microRNA mimetic, supermir, aptamer, antimir, antagomir, Ul adapter, triplex-forming oligonucleotide, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligo, and decor oligonucleotides, among others.
Regarding nucleic acid oligonucleotides as gene modulators, Wang teaches that the ability to predict nucleic acid hybridization (i.e., via “rational design”) is generally limited to the use of unmodified nucleic acids, and that many broadly employed chemical modifications to DNA and RNA have not been included in predictive models (pg. 2, para. 1 and pg. 14, para. 1; Wang et al., 2022, PLOS ONE, 17(5), e0268575). Wang teaches thermodynamic models of hybridization for nucleic acid molecules with phosphorothioate linkages, where each linkage modification decreases duplex stability (pg. 13, para. 4) Wang teaches that backbone and sugar ring modifications, in conjunctions with nucleotide sequence, would likely require a combinatorially large (and synthetically intractable) set of duplexes to fully characterize (pg. 13, para. 3). Therefore, it is unpredictable that nucleic acid hybridization without a rational design incorporating thermodynamics, phosphorothioate linkages or backbone/sugar ring modifications would successfully promote nucleic acid binding.
Regarding oligonucleotide gene modulators of OGG1, Butler (Butler, US 9982257 B2, published 5/29/2018) teaches single stranded gene expression influencing oligonucleotides for subject delivery to treat various diseases conditions (22 line 60). Butler teaches the oligonucleotide as a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges with internucleotidic linkages (22 line 60) and be of various length including 20 nucleosides (23 line 25) .
As the prior art establishes, there is substantial variation within the genus of oligonucleotides. Applicant fails to adequately describe a sufficient variety of species to reflect the variation within the genus. Furthermore, the description of a representative number of species from the specification is not representative of the entire genus. Given the lack of guidance in the art and specification regarding common structural characteristics shared by members of the genus of “oligonucleotide” and lack of predictability of undefined modifications, secondary structure, or function, the specification disclosure is not sufficient to show that the Applicant was in possession of the claimed “oligonucleotides” at the time the invention was filed.
Dependent claims
The dependent claims of claim 1 do not further limit the genus so as to resolve the issues above, and therefore lack adequate written description for the reason outlined for claim 1.
Claim Rejections - 35 USC § 103 - New
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 30, 44, 46, and 47 is/are rejected under 35 U.S.C. 103 as being unpatentable over Butler (Butler, US 9982257 B2, published 5/29/2018) in view GenBank1 of record (GenBank1, NM_016828, https://www.ncbi.nlm.nih.gov/nuccore/197276614?sat=46&satkey=117780796, Revision Sept 25 2017, retrieved July 30 2024, printed as pages 1/4 to 4/4) and Chan (Chan, Jasmine HP, Shuhui Lim, and WS Fred Wong. "Antisense oligonucleotides: from design to therapeutic application." Clinical and experimental pharmacology and physiology 33.5‐6 (2006): 533-540) and Aartsma-Rus of record (Aartsma-Rus, Annemieke, et al. Molecular Therapy 17.3 (2009): 548-553.) and Pan of record (Pan M, Ni J, He H, Gao S, Duan X. New paradigms on siRNA local application. BMB Rep. 2015 Mar;48(3):147-52.) and Hardee of record (Hardee, G., US 20120322851 A1) and Jones of record (Jones, Madeleine, Robert Wagner, and Miroslav Radman. "Mismatch repair of deaminated 5-methyl-cytosine." Journal of molecular biology 194.1 (1987): 155-159.).
Regarding claim 1, Butler teaches single stranded gene expression influencing oligonucleotides for subject delivery to treat various diseases conditions (22 line 60). Butler teaches the oligonucleotide as a polymer or oligomer of nucleotide monomers, containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges with internucleotidic linkages (22 line 60) and be of various length including 20 nucleosides (23 line 25) . Butler teaches single stranded oligonucleotides of the invention may contain double stranded regions as well as the double stranded oligonucleotides may contain single stranded regions (23 line 1). Butler teaches the oligonucleotides include control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNAs and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, (23 line 5). Butler also teaches 2′-MOE gapmer phosphorothioate linked oligonucleotides within a DNA core (551 line 30). Butler further teaches the oligonucleotides where each cytosine can be replaced with 5-methylcytosine (120 line 24) and where DNA was prepared with 2'-OMethoxyethyl (MOE) phosphoramidites (461 line 1).
Butler does not teach the specific 20-mer oligonucleotide with base sequence of SEQ ID NO: 106 from claim 1, however Butler teaches the OGG1 targeting oligonucleotide sequence SEQ ID NO: 498 5'-GUAUGGACACUGACUCAGAUU-3' (Accession number NM 016829) (col 586) with 100% identity to human OGG1.
PNG
media_image1.png
234
899
media_image1.png
Greyscale
Furthermore, GenBank1 teaches Homo sapiens 8-oxoguanine DNA glycosylase (OGG1), full transcript variant 2d, mRNA known in the art with 100% identity to Applicant’s SEQ ID NO: 106.
PNG
media_image2.png
260
989
media_image2.png
Greyscale
Chan teaches computational algorithms systems in single stranded ASO design where the ASO is not only a useful experimental tool in protein target identification and validation, but also a highly selective therapeutic strategy for diseases with dysregulated protein expression (Summary). Chan teaches screening strategies to obtain potent ASO, such as mRNA walking, oligonucleotide array, and RNase H mapping but suggests rational design of ASO based on computational algorithms that are freely available in the public domain is the most economical approach to ASO design and very often generates potent ASO from a handful of candidates (pg 533 col 2, para 2). Chan teaches chemical modifications and delivery modalities which further enhance ASO efficacy (pg 533 col 2, para 2). Chan further teaches the necessary information needed for rational ASO design which includes; (i) prediction of the secondary structure of the RNA; (ii) identification of preferable RNA secondary local structures; (iii) motifs searching and GC content calculation; and (iv) binding energy (ΔG°37) prediction (pg 534 col 1 para 1). Chan teaches newer generations of ASOs have been designed to circumvent side-effect by exclusion of the CpG motif or by methylation of cytosine to reduce the immune stimulatory effects such as introduction of LNA into the PS-ASO which has been shown to reduce, and even eliminate, CpG dinucleotide-mediated immunestimulation (pg 537 col 2 para 2). Regarding flanking modifications, Chan teaches LNA monomer can be freely incorporated into RNA and DNA to form chimeric oligonucleotides resulting in restoration of RNase H-mediated cleavage of mRNA such as LNA/DNA/LNA gapmers with seven to 10 PS-modified DNA central gaps flanked by three to four LNA oligomers on both ends which provides highly efficient mRNA cleavage, in addition to high ASO potency, target accessibility and nuclease resistance. (pg 536 col 2 para 1).
Aartsma-Rus teaches general antisense Oligonucleotide requirements (pg. 548-549). Specifically, Aartsma-Rus teaches that gene knockdown through RNase H cleavage requires stable and efficient binding of the oligonucleotide to its target RNA sequence (“Each antisense mechanism requires stable and efficient binding of the AON to its target sequence”, pg. 548, right col.). Aartsma-Rus teaches that secondary structures of the target RNA, as well as the stability and binding energy of the oligonucleotide to its target RNA sequence influence knockdown efficiency (pg. 548, right col.) Aartsma-Rus teaches that software programs can be used to facilitate oligonucleotide design, but no program is “100% conclusive or predictive” and thus, “in general a trial and error procedure is still involved to identify potent” oligonucleotides (pg. 548, right col.). Therefore, even with computer design algorithms, trial and error procedure is still required to identify potent sequence candidates, further establishing the need to “try” the sequences to find optimal candidates.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try a single stranded oligonucleotide sufficiently similar to Applicant’s SEQ ID NO: 106 using the oligo design system of Chan and guidance from Aartsma-Rus along with the GenBank1 mRNA sequence in order to target OGG1. Before the effective filing date of Applicant’s invention, Chan taught a design need for nucleic acid sequences which can influence target gene expression in multiple species. ASO systems rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and nucleotide length less than 30nt but ideally between 19 and 25nt, with a finite number of identified, predictable sequences. The length of human OGG1 mRNA is ~2000 nucleotides long and antisense oligonucleotides vary between 19-25 nucleotides. Thus, there are ~2980 possible 20-mers that can target a gene with 100% identity. As such, there are finite number of identified solutions evidenced by the GenBank sequences. The large, but finite number of possible solutions becomes much smaller and their function even more predictable once the skilled artisan makes use of the known algorithm screening tools taught in Chan. It would have been obvious to try oligonucleotides with SEQ ID NO: 106 to target OGG1 because 1) Chan demonstrates that given a known target, ASO sequences can be generated within their design system with routine experimentation of testing and identification such that the ASO could predictably influence gene expression with a measured and expected outcome and because 2) Aartsma-Rus teaches even with computer design algorithms, trial and error procedure is still required to identify potent candidates, further establishing the need to “try” the nucleic acid sequences to find optimal “hit” candidates. The skilled artisan would have had a reasonable expectation of succuss in identifying single stranded oligonucleotides that work using Chan’s ASO design system to make ASO targets for SEQ ID NO: 106 of the OGG1 gene because Chan teaches the known parameters of successful gene targeting. Thus, Chan’s ASO design system to generate a sufficiently similar ASO sequence to SEQ ID NO: 106 from a known OGG1 target would yield ASO which predictably inhibits the OGG1 gene.
Regarding the chemical modification patterns of claim 1, Butler teaches the single stranded oligonucleotides of the invention contain double stranded regions as well as the double stranded oligonucleotides contain single stranded regions (23 line 1). Butler teaches the oligonucleotides with 2′-MOE gapmer phosphorothioate linked oligonucleotides within a DNA core (551 line 30). Butler further teaches the oligonucleotides where each cytosine can be replaced with 5-methylcytosine (120 line 24).
Pan teaches advantages of oligonucleotide chemical modifications that improve the in vivo stability and specificity, reduce toxicity, increase cellular uptake, and avoid immune and off-target responses, chemical and structural modifications of siRNA molecules are used widely without decreasing the silencing efficiency and wherein such examples include ribose modifications, base modifications, and modifications within the phosphate backbone (S14-S15) (pg 148 para 1). Pan further teaches siRNA do not have to be double stranded and that single-stranded siRNA (ss-siRNA) can be a potent alternative RNAi mechanism (pg 148, col 1 para 2) and used in treating Huntington Disease models to selectively silence the HTT gene through single-strand guided interference intraventricularly (pg 149 col 2 para 6).
Pan does not teach specific core and flanking chemical modification patterns for RNAi oligonucleotides. However, Jones teaches methylation of cytosine residues to form 5-methyl-cytosine is the most common form of DNA modification (pg 155 col 1 para 1) and Butler, as described above, employs the use of 5-methyl-cytosine modifications in any of the cytosine bases (120 line 24).
Furthermore related to modification strategy, Hardee teaches specific modified oligonucleotides in a method for targeted delivery of RNAi therapeutics [0007] with focus on single stranded oligonucleotides [0075] where the therapeutic LNA oligomer may, in various embodiments, target either i) target nucleic acids, for example mRNAs (antisense oligomers) or microRNA (antimiRs) or ii) target proteins in the subject (aptamers and spiegelmers) (0074). Hardee teaches oligos can be modified and variously positioned in each nucleotide location with 2′-methoxyethyl (2′MOE) and 2′ fluoro modifications [0209]. Hardee teaches selection of patterns of nucleotide modifications such as a nucleotide mixmer of a contiguous nucleotide sequence which consists of nucleotides independently selected from any pattern of X selected from the group consisting of, 2′-MOE, 2′ fluoro or 2′OMe [0134]. Hardee teaches modification of the nucleotide include modifying the sugar moiety to provide a 2′-substituent group which enhances binding affinity and may also provide increased nuclease resistance [0350]. Hardee further teaches the cytosine residues of the oligomer, such as the nucleotide analogues and/or nucleotides, may be methylated—such as comprise a 5-methyl [0076] and in another embodiment teaches an RNAi oligonucleotide where all cytosines are methylated with 5-methyl cytosine (Table 4, [0165].) Hardee further teaches RNA nucleotides with 2′MOE-RNA units where the T residues can be substituted by U residues, and cytosines may be 5-methyl cytosine [0205], i.e. 2′MOE-RNA units of thymine which is equivalent to 5'-methyl-2'-0-methoxyethyl-Uracil and 2′MOE-RNA units of 5-methyl cytosine which is equivalent to 5'-methyl-2'-0-methoxyethyl-cytosine. Hardee also teaches an oligomer pattern map including a 20 nucleotide length oligomer with 2′MOE in each core position which can be modified with 5-methyl as well as an outer “flank” sequence which has 2′MOE modification [0209]. Hardee teaches nucleobases of the invention include thymidine, uracil, and 5-methylcytocine [0356].
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed the OGG1 sequence of SEQ ID NO: 106 targeting oligonucleotide as deemed obvious in the §103 rejection of claim 1 above with the modification teachings of Pan and Hardee combined with the modification teachings of Butler and Chan such that all cytosines within the DNA core are 5'-methyl-2'-0-methoxyethyl-dCytosine, and wherein all thymidines in the flanking sequences are 5'-methyl-2'-0-methoxyethyl-Uracil. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that specific chemical modifications of the oligonucleotide flanking sequences would be effective at targeting OGG1 expression because Pan teaches the advantages of oligonucleotide chemical modifications that improve the in vivo stability and specificity, reduce toxicity, increase cellular uptake, and avoid immune and off-target responses. It would have been predictable that specific position flanking and all core modifications could be effectively employed to target OGG1 expression because Hardee teaches the specific 5’-methyl cytosine and 2’-MOE cap and core modifications in a formula where each nucleotide position is modified with a 2’-MOE including every core position such that the chemically modified oligo is a more effective RNAi agent. The skilled artisan would therefore be motivated to employ those specific flanking and core chemical nucleobase modifications which are well known in the art in OGG1 RNAi for improved targeting efficacy of the interference composition.
Regarding the amendment to claim 1 which discloses nM ranges of efficacy for the oligonucleotide, Butler further teaches as a consequence of starting from a library of vast diversity it is often possible to identify aptamers of nM or sub-nM affinity for the target protein and with selectivity for that target protein over other proteins with a high degree of structural homology (318 line 10). Butler further teaches both DNA and RNA aptamers have been shown to bind their targets in the low picomolar to low nanomolar range and that binding of an aptamer is a highly specific interaction that can even discriminate between related proteins that share common structural domains synthesis however, and they can be easily subjected to a chemical modification that improves their stability and pharmacokinetics (319 line 7). Further related to oligonucleotide concentrations, Hardee found that use of lower dosages or lower concentration of LNA oligomers, higher oral bioavailability could be obtained, especially when used in conjunction with a penetration enhancer. [0009]. Examiner further notes that optimization of doses/concentrations (i.e., effectivity of oligonucleotides at a range of nM concentrations) would have been prima facie obvious to one of ordinary skill in the art at the time of filing: “[W[here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. “ In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955) (see MPEP 2144.05). As set forth at MPEP 2144.05 II. A: “Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical.” Therefore, claim 1 regarding oligonucleotide concentration and efficacy is obvious and is properly rejected under 35 U.S.C. 103.
Regarding claim 30, i.e., Butler teaches internucleoside linkages used as protective groups and may be phosphorothioate internucleoside linkages (14 line 15) i.e., wherein the oligonucleotide comprises at least one alternative internucleoside linkage.
Regarding claim 44, Butler teaches the single stranded oligonucleotides of the experiment can be of various effective lengths including between 15 and 25 nucleotides in length (23 line 26).
Regarding claim 46, Butler teaches the agent and agents of the invention oligonucleotides delivered in a pharmaceutical composition and within a pharmaceutically acceptable carrier and delivered parentally (8 line 41).
Regarding claim 47, Butler teaches RNAi oligonucleotide of the invention complexed for delivery within liposomes (331 line 21).
Claim(s) 1, 49, 56, 73, 77, and 79 is/are rejected under 35 U.S.C. 103 as being unpatentable over Butler (Butler, US 9982257 B2, published 5/29/2018) and GenBank1 of record (GenBank1, NM_016828, https://www.ncbi.nlm.nih.gov/nuccore/197276614?sat=46&satkey=117780796, Revision Sept 25 2017, retrieved July 30 2024, printed as pages 1/4 to 4/4) and Chan (Chan, Jasmine HP, Shuhui Lim, and WS Fred Wong. "Antisense oligonucleotides: from design to therapeutic application." Clinical and experimental pharmacology and physiology 33.5‐6 (2006): 533-540) and Pan of record (Pan M, Ni J, He H, Gao S, Duan X. New paradigms on siRNA local application. BMB Rep. 2015 Mar;48(3):147-52.) and Hardee of record (Hardee, G., US 20120322851 A1) and Jones of record (Jones, Madeleine, Robert Wagner, and Miroslav Radman. "Mismatch repair of deaminated 5-methyl-cytosine." Journal of molecular biology 194.1 (1987): 155-159.) and Aartsma-Rus of record (Aartsma-Rus, Annemieke, et al. Molecular Therapy 17.3 (2009): 548-553.) as applied to claim 1, and in further in view of and Lin of record (Lin, Y., & Wilson, J. H. (2007). Molecular and cellular biology, 27(17), 6209–6217.) and McMurray of record (McMurray, C., US 20070219155 A1).
The teachings of Butler, Pan, Chan, Hardee, GenBank1, Jones, and Aartsma-Rus as applied above for claims 1 are incorporated here.
Although Butler teaches single stranded antisense oligonucleotide systems for treating disorders, Butler does not specifically apply the invention’s compositions to treating a trinucleotide repeat expansion disorder.
However, Lin teaches an OGG1 human siRNA GAGUGGUGUACUAGCGGAUCAAGUA with 100% identity to human OGG1 mRNA used in the investigation of CAG expansions in Huntington’s disease models (pg 6210, table 1). As described above, Pan further teaches siRNA do not have to be double stranded and that single-stranded siRNA (ss-siRNA) can be a potent alternative RNAi mechanism (pg 148, col 1 para 2).
Lin does not teach administering the single stranded specifically modified OGG1 oligonucleotide in newly amended claim 1 in a method of treating, preventing, or delaying the progression a trinucleotide repeat expansion disorder in a subject in need thereof.
However, regarding claim 49, McMurray teaches reducing progression of a trinucleotide CAG repeat condition in a mammal by administering an inhibitor of an OGG1 polypeptide activity to the mammal under conditions where progression of symptoms of the CAG repeat condition is reduced as compared to progression of symptoms in a control mammal having the CAG repeat condition and not having been administered the inhibitor [0009]. McMurray teaches the OGG1 inhibitor can reduce the level of mRNA that encodes an OGG1 polypeptide in the mammal wherein the inhibitor can induce RNA interference [0009] as in antisense oligonucleotides and siRNA [0018]. McMurray teaches oligonucleotides of the invention can contain a backbone modification to increase their resistance to serum nucleases and increase their half-life in the circulation [0020].
Regarding claim 56, McMurray teaches the above applied to claim 49, i.e., wherein the subject is identified as having a trinucleotide repeat expansion disorder.
Regarding claim 73, McMurray teaches the methods and agents can be used for treating a trinucleotide repeat condition, e.g. fragile X syndrome, fragile XE syndrome, Friedreich ataxia, myotonic dystrophy, spinocerebellar ataxia (SCA) type 8, spinobulbar muscular atrophy, Huntington disease, dentatorubral-pallidoluysian atrophy (DRPLA), and the SCA types 1, 2, 3, 6, 7, and 12 [0017].
Regarding claim 77, McMurray teaches multiple OGG1 inhibitors can be used with the composition for treatment [0020], i.e., further comprising administering a second therapeutic agent.
Regarding claim 79, McMurray teaches delayed disease progression by at least 120 days where OGG1 inhibition decreases the degree of expansion of CAG repeats in Huntington’s disease in transgenic mice, shown in FIGS. 3A and 3B, with traces of CAG repeat distributions in tissues (wild type for OGG1) and hHD/OGG1(−/−) mice at 25 weeks (175 days) of age (Fig 3, [0015]). McMurray teaches hHD mice were crossed with mice lacking OGG1, and the expansion profile at CAG repeats was measured in tissues of these mice at different age [0052]. McMurray teaches loss of this single glycosylase significantly suppressed or delayed age-dependent expansion in vivo (FIGS. 3A-3D) where at comparable ages, expansions were absent or suppressed in hHD/OGG (−/−) animals (FIG. 3B) relative to their littermate controls (FIG. 3A), despite the fact that all other glycosylases were present and might be used to repair the oxidative lesions [0052].
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed the modified OGG1 of Butler, as described in the §103 rejection above applied to claim 1, with sequence of SEQ ID NO: 106 with specific 5’ and 3’ flanking alternatively modified bases according to the guidance of Butler, Chan, Pan and Hardee and as deemed obvious in the §103 rejection of claim 1 above, within McMurray’s method of treating the CAG trinucleotide expansion disorder in a subject with Huntington’s disease. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that Butler’s single stranded oligonucleotide targeting OGG1 as modified to the sequence of SEQ ID NO: 106 could be similarly effective at inhibiting OGG1 expression within McMurray’s combination method of treating a subject with a trinucleotide repeat expansion disorder such as Huntington’s disease because Lin establishes nucleic acid inhibitors as effective for targeting OGG1 in conditions of CAG repeats; 2) Butler establishes modified single stranded oligonucleotides could effectively target OGG1; 3) McMurray teaches antisense oligonucleotides as effective inhibitors of OGG1 within the disclosed treatment method for trinucleotide repeat expansion disorders; 4) Pan teaches the advantages of single stranded oligonucleotides with chemical modifications to enhance efficacy; and 5) Butler and Hardee teaches single stranded oligonucleotides with specific modification patterns of core and flanking oligonucleotides which include 5-methyl cytosine and 2-Moe modification at specific locations and 4) GenBank1 teaches the specific mRNA as a target for OGG1 oligonucleotide inhibition. It would have been predictable that ASO as modified with chemical modifications could effectively inhibit OGG1 within McMurray’s method of treatment because Pan teaches the advantages of modified single stranded oligonucleotides for gene targeting expression inhibition and because McMurray teaches RNAi as effective inhibitors which can be applied to multiple trinucleotide repeat expansion disorders such as Huntington’s disease. The skilled artisan would therefore be motivated to employ the modified OGG1 nucleic acid inhibitor as a single therapy or co-therapy with other OGG1 inhibitors within McMurray’s method of treating and/or delaying the onset of Huntington’s disease by reducing OGG1 expression because of the therapeutic advantages of targeted modified nucleic acid inhibitors over other systemic gene inhibitors.
Response to Arguments
Applicant’s arguments (Remarks pg 8-12) regarding single stranded oligonucleotides versus siRNA are directed to the withdrawn §§ 103 rejections, therefore, the arguments are moot. Applicant’s amendments necessitate new §§103 and 112 rejections. Examiner notes the teachings above, specifically, Pan teaches siRNA do not have to be double stranded and that single-stranded siRNA (ss-siRNA) can be a potent alternative RNAi mechanism (pg 148, col 1 para 2) and used in treating Huntington Disease models to selectively silence the HTT gene through single-strand guided interference intraventricularly (pg 149 col 2 para 6). It is noted that the features upon which applicant relies (i.e., the oligonucleotides are not siRNA) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
Conclusion
All claims are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOHN CHARLES MCKILLOP whose telephone number is (703)756-1089. The examiner can normally be reached Mon-Fri 8:30-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner' s supervisor, Neil Hammell can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOHN CHARLES MCKILLOP/Examiner, Art Unit 1637
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637