Prosecution Insights
Last updated: April 19, 2026
Application No. 17/304,444

MICROENCAPSULATED AND CHROMOSOME INTEGRATED COMPOSITIONS FOR L-DOPA MICROBIOME THERAPY

Final Rejection §103§DP
Filed
Jun 21, 2021
Examiner
WANG, CHANG YU
Art Unit
1675
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Iowa State University Research Foundation Inc.
OA Round
6 (Final)
34%
Grant Probability
At Risk
7-8
OA Rounds
4y 1m
To Grant
86%
With Interview

Examiner Intelligence

Grants only 34% of cases
34%
Career Allow Rate
287 granted / 850 resolved
-26.2% vs TC avg
Strong +52% interview lift
Without
With
+52.5%
Interview Lift
resolved cases with interview
Typical timeline
4y 1m
Avg Prosecution
93 currently pending
Career history
943
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
26.5%
-13.5% vs TC avg
§102
18.8%
-21.2% vs TC avg
§112
32.5%
-7.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 850 resolved cases

Office Action

§103 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION RESPONSE TO AMENDMENT Status of Application/Amendments/claims 2. Applicant’s amendment filed November 17, 2025 is acknowledged. Claims 1-38, 44-48 and 54-59 are canceled. Claims 39-43, 49 and 51-53 are amended. Claims 39-43 and 49-53 are pending in this application. Applicant timely traversed the restriction (election) requirement in the reply filed on August 23, 2023. 3. Claims 39-43 and 49-53 are under examination with respect to DOPA-decarboxylase inhibitor in this office action. 4. Applicant’s arguments filed on November 17, 2025 have been fully considered but they are not deemed to be persuasive for the reasons set forth below. Claim Rejections/Objections Withdrawn 5. The rejection of claims 39-42 and 51-53 under 35 U.S.C. 103 as being unpatentable over Kramer et al. (US2006/0141587) in view of Loessner et al. (Microbes and Infection, 2009; 11:1097-1105), Wei et al. (Sci. Rept. 2016; 6:30080. DOI:10.1038/srep30080) and Mawad et al. (Applied Microbiol. Biotechnol. 2018; 102:10675-10690), and evidentiary reference: Hudault et al. (Gut, 2001; 49:47-55) is withdrawn in response to Applicant’s amendment to the claims. The rejection of claims 49-50 under 35 U.S.C. 103 as being unpatentable over Kramer et al. (US2006/0141587) in view of Loessner et al. (2009), Wei et al. (2016) and Mawad et al. (2018), and evidentiary reference: Hudault as applied to claims 39-42 and 51-53 above, and further in view of Xie et al. (2014) is withdrawn in response to Applicant’s amendment to the claims. The rejection of claim 43 under 35 U.S.C. 103 as being unpatentable over Kramer et al. (US2006/0141587) in view of Loessner et al. (2009), Wei et al. (2016) and Mawad et al. (2018), and evidentiary reference: Hudault et al. (2001) as applied to claims 39-42 and 51-53 above and further in view of Kanthasamy et al. (US2019262298) is withdrawn in response to Applicant’s amendment to the claims. The rejection of claims 39-43 and 49-53 on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of US11576883 in view of Loessner, Wei, Mawad and Xie is withdrawn in response to Applicant’s amendment to the claims. The provisional rejection of claims 39-43 and 49-53 on the ground of nonstatutory double patenting as being unpatentable over claims 30, 33-34, 36-37, 41 and 47-48 of copending Application No. 18/153739 in view of Loessner, Wei, Mawad and Xie is withdrawn in response to Applicant’s amendment to the claims. New Grounds of Rejection Necessitated by the Amendment The following rejections are new grounds of rejections necessitated by the amendment filed on November 17, 2025. Claim Rejections - 35 USC § 103 6. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 39-43, 49 and 51-53 are rejected under 35 U.S.C. 103 as being unpatentable over Kanthasamy et al. (US2019262298) in view of Falb et al. (US2017/0232043, published Aug 17, 2017, priority Jun 10, 2015) and Mawad et al. (Applied Microbiol. Biotechnol. 2018; 102:10675-10690. doi.org/10.1007/s00253-018-9417-3, as in IDS). Claims 39-43, 49 and 51-53 are drawn to a microencapsulated composition comprising: a core component comprising a recombinant microbial cell that has been pre-induced with rhamnose comprising a heterologous polynucleotide comprising a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter, wherein the polynucleotide lacks an antibiotic selection marker, and wherein the polynucleotide is stably integrated into a chromosome of the cell; and a coating material surrounding the core component; wherein the composition provides a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. Kanthasamy et al. (US20190262298) teach a composition for treating Parkinson's disease (PD) ([0005]-[0007] [0080]-[0083]; [0091]), wherein the composition comprises a recombinant microbial cell including recombinant E. coli Nissle 1917 (EcN) as recited in claims 41-42 or variant thereof comprising a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter as recited in claim 39 (see para.[0148]-[0150]) and wherein the recombinant microbial cell produces L-DOPA as recited in claims 39-40 (see Example 11; [0139]-[0150]; and is capable of colonizing the gut of a mammal including human as recited in claim 40 (see para. [0005]-[0013]; [0040]; [0084];[0099]; [0148]-[0150]; [0139]-[0150], Examples 5-12, [0116]- [0154]; Example 11; paragraphs [065]-[0067]; [0073]-[0074]; [0054]-[0059], [0139]-[0150]; claims 1-29). Kanthasamy teaches that the hpaB and hpaC nucleotide sequence is operably linked to a rhamnose inducible promoter sequence in a plasmid/vector as in claim 39 (see para. [0148]-[0150]). Kanthasamy teaches that the recombinant microbial cell produces L-DOPA and is capable of colonizing the gut of a subject as in claim 40 and wherein the recombinant microbial cell is a probiotic including E. coli Nissle 1917 as in claims 41-42 (see para. [0012]; [0114]; [0139]-[0150], Example 11). Kanthasamy teaches that the hpaB and hpaC nucleotide sequence comprises SEQ ID NO:3, which is 100% identical to instant SEQ ID NO:1 as in claim 43 (see the sequence alignment below; para. [0148]-[0150]).Kanthasamy teaches that the composition further comprises additional agents including a DOPA-decarboxylase inhibitor (see para. [0009]; [0107]-[0108]; claims 11 and 25; [0103]-[0105]). But Kanthasamy does not teach a microencapsulated composition comprising a core component comprising the claimed recombinant microbial cell; and a coating material surrounding the core component, wherein the recombinant microbial cell that has been pre-induced with rhamnose recited in claim 39, or wherein the coating material comprises a polymer, alginic acid or an alginate in claims 51-52 or the composition further comprising a pharmaceutically acceptable carrier in claim 67. Falb et al. (US2017/0232043) teach use of a recombinant microbial cell comprising a rhamnose-inducible expression system, wherein the recombinant microbial cell includes a probiotic or E. coli Nissle 1917, and wherein the rhamnose-inducible system comprises a heterologous gene operably linked to a rhamnose-inducible promoter to express the gene product for treating diseases including neurodegenerative diseases or Parkinson’s disease; and wherein the recombinant microbial cell including a probiotic or E. coli Nissle 1917 is pre-incubated with a rhamnose (see para. [0562]; [0564]; [0573]; [0575]-[0576]; [0580]-[0581]; [0586]; [0520]-[0526]). Mawad teaches benefits of using probiotic Escherichia coli Nissle 1917 (EcN) because probiotic EcN has beneficial effect on many intestinal infections and decreases the level of cholesterol in the blood serum and can also reduce the invasion of human intestinal epithelial cells by important bacterial pathogens (see p. 10676, 1st paragraph). Mawad teaches benefits of microencapsulation of EcN because microencapsulation enhances oral delivery of probiotic bacteria including probiotic EcN and alginate-chitosan microcapsules can provide effectual platform to deliver probiotic EcN and reduce Campylobacter infection in humans (p. 10675, abstract; p. 10676, 2nd col., 2nd paragraph-3rd paragraph). Mawad teaches that EcN was microencapsulated using alginate and chitosan nanoparticles, which relates to the limitations recited in claims 62 and 65-67 (see p. 10676, 2nd col., 2nd paragraph-3rd paragraph; p. 10677, 1st col., 2nd paragraph, section “Microencapsulation of EcN in alginate-chitosan nanoparticles). Mawad teaches that a microencapsulated composition comprising microencapsulated EcN in alginate beads, wherein the microencapsulated EcN in alginate beads comprising a core component comprising EcN and a coating material surrounding the core component wherein the coating material comprises a polymer, alginic acid or an alginate as in claims 51-52 (see p. 10677, 1st col., 2nd paragraph, section “Microencapsulation of EcN in alginate-chitosan nanoparticles). Mawad also teaches that the composition further comprises a pharmaceutically acceptable carrier as in claim 53 because the microencapsulated EcN are in PBS or sodium citrate dihydrate solution or NaCl buffer (see p.10677, 1st col., 3rd paragraph; 2nd col.1st paragraph, p. 10678, 1st col.). A person of ordinary skill in the art would have recognized that selecting and applying the known the recombinant microbial cell that has been pre-incubated with rhamnose wherein the recombinant microbial cell comprises a heterologous gene including a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose-inducible promoter and the known technique of microencapsulating probiotic bacteria disclosed by Falb and Mawad to the Kanthasamy’s composition comprising the probiotic EcN would have yielded the predictable result of the claimed microencapsulated composition comprising a core component comprising the claimed recombinant microbial cell; and a coating material surrounding the core component; wherein the composition provides a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. Using and including the known recombinant microbial cell that has been pre-incubated with rhamnose and the known technique of microencapsulating probiotic bacteria EcN to the Kanthasamy’s composition would better control and provide better expression of hpaB and hpaC induced by rhamnose to produce L-DOPA, and expand application of the Kanthasamy’s composition in therapeutic purposes and for treating PD, and would increase patient’s satisfaction with treatment of PD using probiotic EcN product that produces L-DOPA. Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to select and apply the known the recombinant microbial cell that has been pre-incubated with rhamnose wherein the recombinant microbial cell comprises a heterologous gene including a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose-inducible promoter and the known technique of microencapsulating probiotic bacteria disclosed by Falb and Mawad to the Kanthasamy’s composition comprising the probiotic EcN, and yield the predictable result of the claimed microencapsulated composition comprising a core component comprising the claimed recombinant microbial cell; and a coating material surrounding the core component; wherein the composition provides a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. The sequence search results disclose as follows: SEQ ID NO:1 BGR30350 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) ID BGR30350 standard; DNA; 2149 BP. XX AC BGR30350; XX DT 17-OCT-2019 (first entry) XX DE E. coli HpaBC synthetic gene, SEQ ID 3. XX KW HpaBC gene; amino acid production; antiparkinsonian; anxiety disorder; KW ds; major depressive disorder; parkinsons disease; therapeutic. XX OS Escherichia coli Nissle 1917. OS Synthetic. XX CC PN US2019262298-A1. XX CC PD 29-AUG-2019. XX CC PF 27-FEB-2019; 2019US-00287437. XX PR 27-FEB-2018; 2018US-0635983P. PR 28-DEC-2018; 2018US-0785980P. XX CC PA (IOWA ) UNIV IOWA STATE RES FOUND INC. XX CC PI Kanthasamy AG, Abdalla A, Phillips G, Backes N; XX DR WPI; 2019-74367Y/69. XX CC PT Treating Parkinson's disease, comprises administering composition CC PT comprising recombinant microbial cell capable of producing L-3,4- CC PT dihydroxyphenylalanine, in which the recombinant microbial cell colonizes CC PT gut. XX CC PS Claim 13; SEQ ID NO 3; 84pp; English. XX CC The present invention relates to a method of treating parkinson's CC disease. The method comprises administering to a subject an effective CC amount of a composition comprising a recombinant microbial cell capable CC of producing levodopa (L-DOPA), wherein the said recombinant microbial CC cell colonizes the gut of the said subject, thereby providing L-DOPA in a CC sustained manner. The invention further claims: (1) a method of treating CC depression and/or anxiety and improving motivational performance; and (2) CC a pharmaceutical composition comprising a recombinant microbial cell CC capable of producing L-DOPA and colonizing the gut of a subject, thereby CC providing L-DOPA in a sustained manner. The method is useful for treating CC Parkinson's disease in a subject, and treating depression and/or anxiety CC and improving motivational performance, where the depression and/or CC anxiety is associated with parkinson's disease. XX SQ Sequence 2149 BP; 544 A; 511 C; 559 G; 535 T; 0 U; 0 Other; Query Match 100.0%; Score 2149; Length 2149; Best Local Similarity 100.0%; Matches 2149; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 Qy 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 Qy 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 Qy 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 Qy 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 Qy 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 Qy 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 Qy 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 Qy 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 Qy 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 Qy 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 Qy 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 Qy 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 Qy 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 Qy 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 Qy 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 Qy 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 Qy 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 Qy 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 Qy 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 Qy 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 Qy 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 Qy 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 Qy 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 Qy 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 Qy 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 Qy 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 Qy 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 Qy 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 Qy 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 Qy 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 Qy 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 Qy 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 Qy 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 Qy 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 Qy 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 7. Claims 49-50 are rejected under 35 U.S.C. 103 as being unpatentable over Kanthasamy et al. (US2019262298) in view of Falb et al. (US2017/0232043) and Mawad et al. (2018) as applied to claims39-43, 49 and 51-53 above, and further in view of Xie et al. (Sci. Rept. 2014; 4:7506. DOI: 10.1038/srep07506, as in IDS). Kanthasamy, Falb and Mawad are set forth above but do not teach that the core component further comprises a DOPA-carboxylase inhibitor including carbidopa or benserazide as in claims 49-50. Xie et al. teach benefits of encapsulating L-DOPA and a DOPA-carboxylase inhibitor including benserazide in microspheres because the encapsulated L-DOPA and a DOPA-carboxylase inhibitor including benserazide in microspheres can release L-DOPA/levodopa and benserazide in a sustained manner to continuous stimulate dopaminergic receptors for treatment of Parkinson’s disease (PD) (see p. 1, abstract; p.2, 1st col., 3rd paragraph). A person of ordinary skill in the art would have recognized that selecting and applying the known DOPA-carboxylase inhibitor including benserazide and the known technique of encapsulating L-DOPA and a DOPA-carboxylase inhibitor including benserazide disclosed by Xie to the microencapsulation composition of Kanthasamy, Falb and Mawad would have yielded the predictable result of a microencapsulation composition comprising a core component comprising the pre-incubated probiotic Escherichia coli Nissle 1917 (EcN) producing L-DOPA and a DOPA-carboxylase inhibitor including benserazide, and the use of the microencapsulation composition for treating PD, and resulted in an improved product for treating PD. Encapsulating a DOPA-carboxylase inhibitor including benserazide and a probiotic Escherichia coli Nissle 1917 (EcN) producing L-DOPA in the core component of the microencapsulation composition of Kanthasamy, Falb and Mawad would provide benefits of releasing L-DOPA/levodopa and benserazide in a sustained manner to continuous stimulate dopaminergic receptors for treating PD, and expand application of the microencapsulation composition of Kanthasamy, Falb and Mawad, and would increase patient’s satisfaction with treatment of PD using a probiotic Escherichia coli Nissle 1917 (EcN) producing L-DOPA. Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to select and apply the known DOPA-carboxylase inhibitor including benserazide and the known technique of encapsulating L-DOPA and DOPA-carboxylase inhibitor including benserazide in the core component/microspheres disclosed by Xie to the microencapsulation composition of Kanthasamy, Falb and Mawad, and yield the predictable result of a microencapsulation composition comprising a core component and a coating material surrounding the core component, wherein the core component comprises a probiotic Escherichia coli Nissle 1917 (EcN) that has been pre-incubated with rhamnose to produce L-DOPA and wherein the probiotic EcN comprises a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter and wherein the core component further comprises a DOPA-carboxylase inhibitor including carbidopa or benserazide for treating PD. Double Patenting 8. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 39-43, 49 and 51-53 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of US11576883 or claims 1-9 of US12539287 in view of Falb et al. (US2017/0232043) and Mawad et al. (2018). Claims 1-29 of US11576883 (the ‘883 patent) claim a method for treating PD comprising administering to a subject in need thereof a composition comprising a recombinant microbial cell capable of producing L-DOPA, wherein the recombinant microbial cell colonizes the gut of the subject and provides L-DOPA in a sustained manner; and wherein the microbial cell includes Ecoli Nissle 1917 comprising a hpaB and hpaC nucleotide of SEQ ID NO:1 and 2, or 3 and wherein the hpaB and hpaC nucleotide sequence is operably linked to a promoter comprising one or more SEQ ID NOs: 4-6, which is inducible promoter. Claims 1-9 of US12539287 (the ‘287 patent) claim a pharmaceutical composition comprising: a recombinant E. coli Nissle 1917 (EcN) cell comprising a hpaB and hpaC nucleotide sequence as set forth in SEQ ID NO: 1 and 2 or an hpaBC nucleotide as set forth in SEQ ID NO: 3, wherein the recombinant EcN cell is capable of producing L-DOPA and colonizing the gut of a subject, thereby providing L-DOPA in a sustained manner, wherein L-DOPA produced by the recombinant EcN cell in the gut of the subject crosses the blood-brain barrier and increases dopamine levels in the brain to alleviate neurological symptoms of Parkinson's disease or symptoms of depression and/or anxiety; and a carrier. But the claims of the ’883 patent or the ‘287 patent do not recite that the recombinant microbial cell with a rhamnose inducible promoter and has been pre-incubated with rhamnose and a microencapsulated composition comprising a core component comprising the recombinant microbial cells and a coating material surrounding the core component recited in claim 39 or wherein the coating material comprises a polymer, alginic acid or an alginate or the composition further comprising a pharmaceutically acceptable carrier in claims 51-53. While the claims of the ’883 patent or the ‘287 patent do not recite that the recombinant microbial cell with a rhamnose inducible promoter and has been pre-incubated with rhamnose and a microencapsulated composition comprising a core component comprising the recombinant microbial cells and a coating material surrounding the core component recited in claim 39, or wherein the coating material comprises a polymer, alginic acid or an alginate or the composition further comprising a pharmaceutically acceptable carrier in claims 51-53, Falb and Mawad teach these limitations and provides motivation and an expectation of success for the reasons set forth above under the 103 rejection. Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to select and apply the known the recombinant microbial cell that has been pre-incubated with rhamnose wherein the recombinant microbial cell comprises a heterologous gene including a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose-inducible promoter and the known technique of microencapsulating probiotic bacteria disclosed by Falb and Mawad to the composition comprising the probiotic EcN of the ‘883 patent or the ‘287 patent, and yield the predictable result of the claimed microencapsulated composition comprising a core component comprising the claimed recombinant microbial cell; and a coating material surrounding the core component; wherein the composition provides a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. Double Patenting 9. Claims 49-50 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of US11576883 or claims 1-9 of US12539287 in view of Falb et al. (US2017/0232043), Mawad et al. (2018) and Xie et al. (2014). While the claims of the ‘883 patent or the ’28y patent do not teach the recombinant microbial cell with a rhamnose inducible promoter and has been pre-incubated with rhamnose and a microencapsulated composition comprising a core component comprising the recombinant microbial cells and a coating material surrounding the core component as in claim 39, and wherein the coating material comprises a polymer, alginic acid or an alginate or the composition further comprising a pharmaceutically acceptable carrier in claims 51-53 or wherein the core component further comprises a DOPA-carboxylase inhibitor including carbidopa or benserazide as in claim 49-50, Falb, Mawad and Xie teach these limitations and provide motivation and an expectation of success for the reasons set forth above under the 103 rejections. Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to select and apply the known the known the recombinant microbial cell that has been pre-incubated with rhamnose wherein the recombinant microbial cell comprises a heterologous gene including a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose-inducible promoter and the known technique of microencapsulating probiotic bacteria, and the known DOPA-carboxylase inhibitor including benserazide and the known technique of encapsulating L-DOPA and DOPA-carboxylase inhibitor including benserazide in the core component/microspheres disclosed by Falb, Mawad and Xie to the composition of the ‘883 patent or the ’28y patent, and yield the predictable result of a microencapsulation composition comprising a core component and a coating material surrounding the core component, wherein the core component comprises a probiotic Escherichia coli Nissle 1917 (EcN) that has been pre-incubated with rhamnose to produce L-DOPA and wherein the probiotic EcN comprises a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter and wherein the core component further comprises a DOPA-carboxylase inhibitor including carbidopa or benserazide for treating PD. Conclusion 10. NO CLAIM IS ALLOWED. 11. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Wei et al. (Sci. Rept. 2016; 6:30080. DOI:10.1038/srep30080, s in IDS) teaches E. coli DOPA-30N which comprises a heterologous hpaB and hpaC nucleotide sequence stably integrated into the genome of the cell and is capable of producing L-DOPA (p. 3-4; tables1-4; p.4 2nd paragraph; p. 5-7; table 5), and wherein the hpaB and hpaC nucleotide sequence is operably linked to a promoter sequence in a plasmid/vector comprising a constitutive promoter, or an inducible promoter including a rhamnose inducible promoter, such as a T5 promoter, a p37 promoter, a 7P37 promoter as in claims 44-46 (see p. 2, table 1; pp. table 4; p. 5-7, table 5). Munoz et al. (J. Ind. Microbiol. Biotechnol. 2011; 38:1845-1852. DOI 10.1007/s10295-011-0973-0, as in IDS) teach a recombinant Ecoli cell comprising a heterologous hpaB and hpaC nucleotide sequence (see abstract; table 1; p. 1849-1850). Kramer et al. (US2006/0141587, as in IDS) teaches Escherichia coli W3110/pACYCtac aroF.sup.fbr tyrA/pJF119EH hpaB hpaC, which is a recombinant microbial cell comprising a heterologous hpaB and hpaC nucleotide sequence stably integrated into the genome of the cell as in instant claims 39-41 and 44-46 (see Example 3, [0053]-[0055]; paragraphs [0056]-[0069], Examples 4-6; [0032]-[0042]; [0046];). Kramer teaches that the recombinant microbial cell produces L-DOPA and is capable of colonizing the gut of a subject as in claim 40 (see paragraphs [0056]-[0069], Examples 4-6). WO2006061174 teaches an Ecoli rhaBAD promoter comprising the sequence of instant SEQ ID NO:2 (see the sequence alignment below). SEQ ID NO:2 AEI06695 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) ID AEI06695 standard; DNA; 129 BP. XX AC AEI06695; XX DT 10-AUG-2006 (first entry) XX DE E. coli rhaBAD promoter from the L-rhamnose operon. XX KW ds; vector; rhaBAD promoter; promoter; L-rhamnose operon; KW gene expression. XX OS Escherichia coli. XX CC PN WO2006061174-A2. XX CC PD 15-JUN-2006. XX CC PF 05-DEC-2005; 2005WO-EP013013. XX PR 07-DEC-2004; 2004EP-00028917. XX CC PA (LONZ ) LONZA AG. CC PA (MORP-) MORPHOSYS AG. XX CC PI Brass J, Kiziak C, Klein J, Ostendorp R; XX DR WPI; 2006-415137/42. XX CC PT New vector expressible in a host comprises the rhaBAD promoter region of CC PT the L-rhamnose operon operably linked to a transcriptional unit, useful CC PT for regulated heterologous expression of a nucleic acid sequence in a CC PT prokaryotic host. XX CC PS Claim 19; SEQ ID NO 1; 67pp; English. XX CC The invention relates to a vector expressible in a host comprising the CC rhaBAD promoter region of the L-rhamnose operon operably linked to a CC transcriptional unit. The vector comprises: a nucleic acid sequence, CC which is heterologous to the host; and a prokaryotic signal sequence CC operably linked to the nucleic acid sequence, where the prokaryotic CC signal sequence is selected from signal peptides of periplasmic binding CC proteins for sugars, amino acids, vitamins, or ions, and whereas the CC expression of the nucleic acid sequence is controlled by the promoter CC region. Also included are: an isolated and purified nucleic acid sequence CC expressible in a host comprising the rhaBAD promoter region of the L- CC rhamnose operon operably linked to a transcriptional unit comprising: a CC nucleic acid sequence, which is heterologous to the host; and a CC prokaryotic signal sequence operably linked to the nucleic acid sequence, CC whereas the prokaryotic signal sequence is selected from signal peptides CC of periplasmic binding proteins for sugars, amino acids, vitamins, or CC ions and, whereas the expression of the nucleic acid sequence is CC controlled by the promoter region; the plasmid pBW22-Fab-H; the plasmid CC pAKL14; a prokaryotic host transformed with the vector, the isolated and CC purified nucleic acid sequence, and/or the plasmids; and producing a CC polypeptide in a host. The vector is useful for the regulated CC heterologous expression of a nucleic acid sequence in a prokaryotic host. CC The present sequence represents E. coli rhaBAD promoter from the L- CC rhamnose operon. XX SQ Sequence 129 BP; 34 A; 32 C; 25 G; 38 T; 0 U; 0 Other; Query Match 100.0%; Score 119; Length 129; Best Local Similarity 100.0%; Matches 119; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGC 60 Qy 61 CCATTTTCCTGTCAGTAACGAGAAGGTCGCGAATTCAGGCGCTTTTTAGACTGGTCGTA 119 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCATTTTCCTGTCAGTAACGAGAAGGTCGCGAATTCAGGCGCTTTTTAGACTGGTCGTA 119 US11576882 (under the ODP rejection) teaches an Ecoli rhaBAD promoter comprising the sequence of instant SEQ ID NO:2 (see the sequence alignment below). SEQ ID NO:1 US-16-287-437-3 Sequence 3, US/16287437 Patent No. 11576883 GENERAL INFORMATION APPLICANT: Iowa State University Research Foundation, Inc. APPLICANT: KANTHASAMY, ANUMANTHA G APPLICANT: ABDALLA, AHMED APPLICANT: PHILLIPS, GREGORY APPLICANT: BACKES, NICHOLAS TITLE OF INVENTION: L-DOPA MICROBIOME THERAPY FILE REFERENCE: P12428US02 CURRENT APPLICATION NUMBER: US/16/287,437 CURRENT FILING DATE: 2019-02-27 PRIOR APPLICATION NUMBER: US 62/635,983 PRIOR FILING DATE: 2018-02-27 PRIOR APPLICATION NUMBER: US 62/785,980 PRIOR FILING DATE: 2018-12-28 NUMBER OF SEQ ID NOS: 23 SEQ ID NO 3 LENGTH: 2149 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic construct Query Match 100.0%; Score 2149; Length 2149; Best Local Similarity 100.0%; Matches 2149; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 Qy 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 Qy 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 Qy 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 Qy 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 Qy 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 Qy 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 Qy 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 Qy 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 Qy 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 Qy 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 Qy 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 Qy 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 Qy 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 Qy 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 Qy 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 Qy 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 Qy 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 Qy 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 Qy 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 Qy 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 Qy 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 Qy 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 Qy 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 Qy 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 Qy 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 Qy 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 Qy 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 Qy 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 Qy 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 Qy 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 Qy 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 Qy 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 Qy 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 Qy 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 Qy 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 12. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. 13. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Chang-Yu Wang whose telephone number is (571)272-4521. The examiner can normally be reached on Monday-Thursday, 7:00am-5:30pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jeffrey Stucker, can be reached on 571-272-0911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see https://ppair-my.uspto.gov/pair/PrivatePair. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Chang-Yu Wang March 7, 2026 /CHANG-YU WANG/Primary Examiner, Art Unit 1675
Read full office action

Prosecution Timeline

Jun 21, 2021
Application Filed
Aug 03, 2021
Response after Non-Final Action
Sep 29, 2023
Non-Final Rejection — §103, §DP
Dec 27, 2023
Response Filed
Apr 08, 2024
Final Rejection — §103, §DP
Jun 12, 2024
Response after Non-Final Action
Jun 26, 2024
Response after Non-Final Action
Jun 26, 2024
Non-Final Rejection — §103, §DP
Oct 24, 2024
Response Filed
Feb 03, 2025
Final Rejection — §103, §DP
Apr 07, 2025
Response after Non-Final Action
Apr 17, 2025
Request for Continued Examination
Apr 21, 2025
Response after Non-Final Action
Jun 14, 2025
Non-Final Rejection — §103, §DP
Nov 17, 2025
Response Filed
Mar 07, 2026
Final Rejection — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599670
METHODS OF PROMOTING NERVOUS SYSTEM REGENERATION
2y 5m to grant Granted Apr 14, 2026
Patent 12589118
USE OF CEREBROLYSIN
2y 5m to grant Granted Mar 31, 2026
Patent 12576130
DOMINANT NEGATIVE SARM1 MOLECULES AS A THERAPEUTIC STRATEGY FOR NEURODEGENERATIVE DISEASES OR DISORDERS
2y 5m to grant Granted Mar 17, 2026
Patent 12559549
ANTIBODY BINDING TO SUPER-REPRESSOR IkB (srIkB) OR ANTIGEN BINDING FRAGMENT THEREOF
2y 5m to grant Granted Feb 24, 2026
Patent 12545725
ANTI-PACAP ANTIBODIES, NUCLEIC ACIDS AND METHODS OF MAKING THEREOF
2y 5m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

7-8
Expected OA Rounds
34%
Grant Probability
86%
With Interview (+52.5%)
4y 1m
Median Time to Grant
High
PTA Risk
Based on 850 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month