Prosecution Insights
Last updated: July 17, 2026
Application No. 17/304,444

MICROENCAPSULATED AND CHROMOSOME INTEGRATED COMPOSITIONS FOR L-DOPA MICROBIOME THERAPY

Non-Final OA §112
Filed
Jun 21, 2021
Priority
Jul 31, 2020 — provisional 62/706,096 +1 more
Examiner
WANG, CHANG YU
Art Unit
1675
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Iowa State University Research Foundation Inc.
OA Round
7 (Non-Final)
34%
Grant Probability
At Risk
7-8
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants only 34% of cases
34%
Career Allowance Rate
289 granted / 861 resolved
-26.4% vs TC avg
Strong +53% interview lift
Without
With
+53.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
949
Total Applications
across all art units

Statute-Specific Performance

§101
2.1%
-37.9% vs TC avg
§103
37.8%
-2.2% vs TC avg
§102
8.0%
-32.0% vs TC avg
§112
25.4%
-14.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 861 resolved cases

Office Action

§112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on June 11, 2026 has been entered. RESPONSE TO AMENDMENT Status of Application/Amendments/claims 3. Applicant’s amendment filed June 11, 2026 is acknowledged. Claims 1-38, 44-48 and 54-59 are canceled. Claim 39 is amended. Claims 39-43 and 49-53 are pending in this application. Applicant timely traversed the restriction (election) requirement in the reply filed on August 23, 2023. 3. Claims 39-43 and 49-53 are under examination with respect to DOPA-decarboxylase inhibitor in this office action. 4. Applicant’s arguments filed on June 11, 2026 have been fully considered but they are not deemed to be persuasive for the reasons set forth below. Claim Rejections/Objections Withdrawn 5. The rejection of claims 39-43, 49 and 51-53 under 35 U.S.C. 103 as being unpatentable over Kanthasamy et al. (US2019262298) in view of Falb et al. (US2017/0232043, published Aug 17, 2017, priority Jun 10, 2015) and Mawad et al. (Applied Microbiol. Biotechnol. 2018; 102:10675-10690. doi.org/10.1007/s00253-018-9417-3, as in IDS) is withdrawn in response to Applicant’s amendment to the claims. The rejection of claims 49-50 under 35 U.S.C. 103 as being unpatentable over Kanthasamy et al. (US2019262298) in view of Falb et al. (US2017/0232043) and Mawad et al. (2018) as applied to claims39-43, 49 and 51-53 above, and further in view of Xie et al. (Sci. Rept. 2014; 4:7506. DOI: 10.1038/srep07506, as in IDS) is withdrawn in response to Applicant’s amendment to the claims. The rejection of claims 49-50 on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of US11576883 or claims 1-9 of US12539287 in view of Falb et al. (US2017/0232043), Mawad et al. (2018) and Xie et al. (2014) is withdrawn in response to Applicant’s amendment to the claims. New Grounds of Rejection Necessitated by the Amendment The following rejections are new grounds of rejections necessitated by the amendment filed on June 11, 2026. Claim Rejections - 35 USC § 112 6. The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 39-43 and 49-53 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. Claims 39-43 and 49-53 are drawn to a microencapsulated composition comprising: a core component comprising a recombinant microbial cell that has been pre-induced with rhamnose comprising a heterologous polynucleotide comprising a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter, wherein the polynucleotide lacks an antibiotic selection marker, and wherein a single copy of the polynucleotide is stably integrated into a chromosome of the cell; and a coating material surrounding the core component; wherein the composition provides a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. The claims encompass a genus of rhamnose pre-induced recombinant microbial cells comprising a heterologous polynucleotide comprising a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter and lacking an antibiotic selection marker and capable of resulting in a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. The specification fails to provide sufficient species of the claimed genus of rhamnose pre-induced recombinant microbial cell capable of producing a therapeutically effective plasma L-DOPA concentration within 6 hours of administration. The specification only describes i) orally administered with EcNLDOPA4 pre-induced with Rhamnose (doses of 1-2×1010 CFU) for 8 wk, wherein EcNLDOPA4 comprises is Nissle 1917 stably integrating the hpaBC gene into the EcN genome, and comprising a rhamnose (Rha)-inducible, tightly regulated and tunable promoter, and a human therapeutic level of L-DOPA (770 ng/mL) was rapidly seen by 6h post-EcNrha L-DOPA (Examples 1-2). In making a determination of whether the application complies with the written description requirement of 35 U.S.C. 112, first paragraph, it is necessary to understand what Applicant is in possession of and what Applicant is claiming. M.P.E.P. § 2163 instructs: An invention described solely in terms of a method of making and/or its function may lack written descriptive support where there is no described or art-recognized correlation between the disclosed function and the structure(s) responsible for the function. . . . An applicant may show possession of an invention by disclosure of drawings or structural chemical formulas that are sufficiently detailed to show that applicant was in possession of the claimed invention as a whole. . . . An applicant may also show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics.” This standard has not been met in this case. From the specification, Applicant is in possession of oral administration of EcNLDOPA4 pre-induced with Rhamnose at doses of 1-2×1010 CFU to result in a plasma L-DOPA concentration of 770ng/ml within 6 hours after administering the composition, and wherein the EcNLDOPA4 pre-induced with Rhamnose comprises stably integrating the hpaBC gene into the EcN genome, and a rhamnose (Rha)-inducible, tightly regulated and tunable promoter. However, Applicant is not in possession of other Rhamnose-pre-induced recombinant microbial cells comprising a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter and lacking an antibiotic selection marker and stably integrated into a genus of the cell capable of a undefined therapeutically effective plasma L-DOPA concentration within 6 hours after administering the composition or a plasma L-DOPA concentration of 770ng/ml within 6 hours after administering the composition. The specification provides no well-established structural and functional relationship between the claimed genus of recombinant microbial cell and EcNLDOPA4 pre-induced with Rhamnose and the dose of 1-2×1010 CFU used in Examples 1-2. The specification provides no identification of any particular portion of the structure that must be conserved. The instant specification fails to provide sufficient descriptive information, such as definitive structural or functional features of the claimed genus of recombinant microbial cells pre-induced with rhamnose and comprising a heterologous polynucleotide comprising a hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter and lacking an antibiotic selection marker and capable of resulting in a therapeutically effective plasma L-DOPA concentration within 6 hours of administration to the function of EcNLDOPA4 pre-induced with Rhamnose at dose of 1-2×1010 CFU resulting in at least 770ngml in human within 6 hours after administering the composition. Furthermore, the prior art does not provide compensatory structural or correlative teachings sufficient to enable one of skill to identify what other recombinant microbial cells might be. Since the common characteristics/features of other recombinant microbial cells and other doses are unknown, a skilled artisan cannot contemplate the functional correlations of the genus with the claimed invention. Accordingly, in the absence of sufficient recitation of distinguishing identifying characteristics, the specification does not provide adequate written description of the genus of recombinant microbial cells and doses Based on MPEP § 2161.01 and §2163, “to satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116”. Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116). As discussed above, the skilled artisan cannot envision the detailed chemical structure of the encompassed genus of recombinant microbial cells and doses to result in undefined therapeutically effective plasma L-DOPA concentration within 6 hours after administering the composition, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481 at 1483. Therefore, the microencapsulated composition has not met the written description provision of 35 U.S.C. §112, first paragraph. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). Applicant is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112, ¶ 1 "Written Description" Requirement. See MPEP § 2161.01 and 2163. Conclusion 7. NO CLAIM IS ALLOWED. 8. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Kanthasamy et al. (US20190262298) teach methods and compositions for treating Parkinson's disease (PD) and depression and/or anxiety ([0005]-[0007] [0080]-[0083]; [0091]), wherein the method comprises administering to a subject with PD and depression and/or anxiety a composition comprising a recombinant microbial cell including recombinant E. coli Nissle 1917 (EcN) or variant thereof comprising a heterologous hpaB and hpaC nucleotide sequence operably linked to a rhamnose inducible promoter (see para.[0148]-[0150]) and wherein the recombinant microbial cell produces L-DOPA (see Example 11; [0139]-[0150]; and is capable of colonizing the gut of a mammal including human (see para. [0005]-[0013]; [0040]; [0084];[0099]; [0148]-[0150]; [0139]-[0150], Examples 5-12, [0116]- [0154]; Example 11; paragraphs [065]-[0067]; [0073]-[0074]; [0054]-[0059], [0139]-[0150]; claims 1-29), wherein the hpaB and hpaC nucleotide sequence is operably linked to a rhamnose inducible promoter sequence in a plasmid/vector (see para. [0148]-[0150]) and comprises SEQ ID NO:3, which is 100% identical to instant SEQ ID NO:1 (see the sequence alignment below; para. [0148]-[0150]). Kanthasamy teaches that the composition further comprises additional agents including a DOPA-decarboxylase inhibitor (see para. [0009]; [0107]-[0108]; claims 11 and 25; [0103]-[0105]). The sequence search results disclose as follows: SEQ ID NO:1 BGR30350 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) ID BGR30350 standard; DNA; 2149 BP. XX AC BGR30350; XX DT 17-OCT-2019 (first entry) XX DE E. coli HpaBC synthetic gene, SEQ ID 3. XX KW HpaBC gene; amino acid production; antiparkinsonian; anxiety disorder; KW ds; major depressive disorder; parkinsons disease; therapeutic. XX OS Escherichia coli Nissle 1917. OS Synthetic. XX CC PN US2019262298-A1. XX CC PD 29-AUG-2019. XX CC PF 27-FEB-2019; 2019US-00287437. XX PR 27-FEB-2018; 2018US-0635983P. PR 28-DEC-2018; 2018US-0785980P. XX CC PA (IOWA ) UNIV IOWA STATE RES FOUND INC. XX CC PI Kanthasamy AG, Abdalla A, Phillips G, Backes N; XX DR WPI; 2019-74367Y/69. XX CC PT Treating Parkinson's disease, comprises administering composition CC PT comprising recombinant microbial cell capable of producing L-3,4- CC PT dihydroxyphenylalanine, in which the recombinant microbial cell colonizes CC PT gut. XX CC PS Claim 13; SEQ ID NO 3; 84pp; English. XX CC The present invention relates to a method of treating parkinson's CC disease. The method comprises administering to a subject an effective CC amount of a composition comprising a recombinant microbial cell capable CC of producing levodopa (L-DOPA), wherein the said recombinant microbial CC cell colonizes the gut of the said subject, thereby providing L-DOPA in a CC sustained manner. The invention further claims: (1) a method of treating CC depression and/or anxiety and improving motivational performance; and (2) CC a pharmaceutical composition comprising a recombinant microbial cell CC capable of producing L-DOPA and colonizing the gut of a subject, thereby CC providing L-DOPA in a sustained manner. The method is useful for treating CC Parkinson's disease in a subject, and treating depression and/or anxiety CC and improving motivational performance, where the depression and/or CC anxiety is associated with parkinson's disease. XX SQ Sequence 2149 BP; 544 A; 511 C; 559 G; 535 T; 0 U; 0 Other; Query Match 100.0%; Score 2149; Length 2149; Best Local Similarity 100.0%; Matches 2149; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAAGGAGATATACATATGAAACCCGAAGATTTCCGTGCTTCAACACAGCGCCCTTTCACT 60 Qy 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGGGAAGAATACCTGAAGAGCCTGCAAGACGGTCGTGAAATTTATATTTACGGGGAGCGT 120 Qy 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTGAAGGATGTTACGACCCATCCAGCCTTTCGCAACGCCGCTGCGTCTGTGGCGCAGTTG 180 Qy 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TATGATGCGTTACACAAACCTGAGATGCAGGATTCGTTGTGCTGGAACACAGACACGGGT 240 Qy 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TCGGGAGGATATACTCATAAATTTTTTCGCGTTGCTAAGTCGGCAGACGACCTGCGCCAA 300 Qy 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAACGTGATGCTATTGCTGAGTGGTCACGTCTGTCGTACGGGTGGATGGGACGTACACCC 360 Qy 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GATTATAAAGCGGCGTTTGGATGCGCATTGGGAGCTAACCCTGGATTCTATGGACAGTTC 420 Qy 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGCAGAATGCCCGCAACTGGTACACACGCATTCAAGAAACTGGGTTGTATTTTAATCAC 480 Qy 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCCATTGTCAATCCGCCGATCGATCGCCACCTGCCCACGGATAAAGTAAAAGATGTATAT 540 Qy 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAAGTTGGAAAAAGAGACAGACGCAGGGATCATTGTATCAGGCGCCAAGGTGGTTGCG 600 Qy 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ACCAATTCTGCCCTGACGCACTACAACATGATCGGCTTTGGATCTGCTCAAGTGATGGGT 660 Qy 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GAAAACCCCGATTTTGCACTTATGTTTGTAGCCCCCATGGACGCTGACGGGGTTAAACTG 720 Qy 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATTAGCCGCGCATCGTACGAAATGGTCGCCGGGGCCACAGGCAGTCCGTACGATTATCCT 780 Qy 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTATCTAGTCGCTTCGACGAAAACGACGCGATCTTAGTGATGGATAACGTCCTGATTCCT 840 Qy 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TGGGAGAACGTCCTGATCTATCGTGATTTCGACCGCTGCCGTCGTTGGACTATGGAAGGA 900 Qy 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GGCTTCGCTCGCATGTACCCTTTGCAAGCCTGTGTACGCCTTGCTGTCAAACTTGATTTC 960 Qy 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATCACTGCGCTTTTGAAGAAATCGTTAGAGTGTACTGGGACGCTGGAGTTCCGTGGTGTC 1020 Qy 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CAAGCCGACCTTGGCGAGGTGGTGGCTTGGCGTAATACTTTCTGGGCATTATCCGACTCC 1080 Qy 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 ATGTGCTCGGAAGCAACCCCCTGGGTCAATGGGGCATACCTTCCCGATCACGCCGCTCTT 1140 Qy 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CAAACCTATCGCGTACTTGCGCCTATGGCTTATGCTAAGATTAAAAATATTATCGAACGT 1200 Qy 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AATGTGACTTCCGGCTTAATTTACTTGCCCTCCAGCGCGCGCGATCTGAATAATCCTCAA 1260 Qy 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATCGACCAGTATTTAGCGAAGTATGTTCGCGGGAGCAACGGGATGGATCATGTCCAGCGC 1320 Qy 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 ATCAAAATCCTTAAGTTAATGTGGGATGCCATTGGTTCAGAATTTGGCGGGCGTCATGAA 1380 Qy 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTTTATGAAATTAATTACTCTGGCTCGCAAGACGAGATCCGTCTGCAATGCTTGCGCCAG 1440 Qy 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GCGCAATCCTCGGGTAATATGGATAAGATGATGGCTATGGTAGACCGCTGCCTGTCCGAG 1500 Qy 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TACGACCAAAACGGATGGACGGTCCCCCATCTGCATAACAACGATGACATTAACATGCTG 1560 Qy 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GATAAGCTGCTGAAATAACGCAGCAGGAGGTTAAGATGCAGCTGGACGAACAACGCCTGC 1620 Qy 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GCTTTCGTGACGCAATGGCGAGTTTGAGTGCAGCCGTTAATATCATTACAACAGAAGGGG 1680 Qy 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 ACGCAGGTCAATGTGGAATCACTGCAACGGCCGTGTGCTCAGTTACAGACACTCCGCCTT 1740 Qy 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CATTAATGGTATGCATCAATGCTAACTCGGCTATGAATCCTGTCTTCCAAGGCAATGGGA 1800 Qy 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AATTATGTGTGAACGTCCTGAACCATGAGCAAGAACTGATGGCACGCCACTTCGCAGGCA 1860 Qy 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGACAGGTATGGCAATGGAGGAGCGTTTTAGCTTGTCTTGCTGGCAAAAGGGACCACTGG 1920 Qy 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CCCAACCAGTTTTGAAGGGGTCTCTTGCATCATTAGAAGGGGAAATCCGCGATGTCCAGG 1980 Qy 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CGATTGGTACACACCTGGTTTACCTTGTCGAGATCAAGAACATCATTTTATCCGCAGAGG 2040 Qy 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GCCACGGGCTGATTTACTTTAAACGCCGCTTCCATCCGGTTATGCTGGAAATGGAAGCTG 2100 Qy 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CAATTTAAGTAAGGAAACATTTATGCGCCTGCATCATCACCACCATCAC 2149 Falb et al. (US2017/0232043) teach a method of treating different diseases including neurodegenerative diseases or Parkinson’s disease, comprising providing a recombinant microbial cell comprising a rhamnose-inducible expression system, wherein the recombinant microbial cell includes a probiotic or E. coli Nissle 1917, and wherein the rhamnose-inducible system comprises a heterologous gene operably linked to a rhamnose-inducible promoter to express the gene product for treating diseases including neurodegenerative diseases or Parkinson’s disease; pre-incubating the recombinant microbial cell including a probiotic or E. coli Nissle 1917 with a rhamnose prior to administration; administering to a subject including human a composition comprising the rhamnose pre-incubated recombinant microbial cell (see para. [0562]; [0564]; [0573]; [0575]-[0576]; [0580]-[0581]; [0586]; [0520]-[0526]). Wei et al. (Sci. Rept. 2016; 6:30080. DOI:10.1038/srep30080, s in IDS) teaches E. coli DOPA-30N which comprises a heterologous hpaB and hpaC nucleotide sequence stably integrated into the genome of the cell and is capable of producing L-DOPA (p. 3-4; tables1-4; p.4 2nd paragraph; p. 5-7; table 5), and wherein the hpaB and hpaC nucleotide sequence is operably linked to a promoter sequence in a plasmid/vector comprising a constitutive promoter, or an inducible promoter including a rhamnose inducible promoter, such as a T5 promoter, a p37 promoter, a 7P37 promoter as in claims 44-46 (see p. 2, table 1; pp. table 4; p. 5-7, table 5). Munoz et al. (J. Ind. Microbiol. Biotechnol. 2011; 38:1845-1852. DOI 10.1007/s10295-011-0973-0, as in IDS) teach a recombinant Ecoli cell comprising a heterologous hpaB and hpaC nucleotide sequence (see abstract; table 1; p. 1849-1850). Xie et al. (Sci. Rept. 2014; 4:7506. DOI: 10.1038/srep07506, as in IDS) teach benefits of encapsulating L-DOPA and a DOPA-carboxylase inhibitor including benserazide in microspheres because the encapsulated L-DOPA and a DOPA-carboxylase inhibitor including benserazide in microspheres can release L-DOPA/levodopa and benserazide in a sustained manner to continuous stimulate dopaminergic receptors for treatment of Parkinson’s disease (PD) (see p. 1, abstract; p.2, 1st col., 3rd paragraph). Kramer et al. (US2006/0141587, as in IDS) teaches Escherichia coli W3110/pACYCtac aroF.sup.fbr tyrA/pJF119EH hpaB hpaC, which is a recombinant microbial cell comprising a heterologous hpaB and hpaC nucleotide sequence stably integrated into the genome of the cell as in instant claims 39-41 and 44-46 (see Example 3, [0053]-[0055]; paragraphs [0056]-[0069], Examples 4-6; [0032]-[0042]; [0046];). Kramer teaches that the recombinant microbial cell produces L-DOPA and is capable of colonizing the gut of a subject as in claim 40 (see paragraphs [0056]-[0069], Examples 4-6). WO2006061174 teaches an Ecoli rhaBAD promoter comprising the sequence of instant SEQ ID NO:2 (see the sequence alignment below). SEQ ID NO:2 AEI06695 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) ID AEI06695 standard; DNA; 129 BP. XX AC AEI06695; XX DT 10-AUG-2006 (first entry) XX DE E. coli rhaBAD promoter from the L-rhamnose operon. XX KW ds; vector; rhaBAD promoter; promoter; L-rhamnose operon; KW gene expression. XX OS Escherichia coli. XX CC PN WO2006061174-A2. XX CC PD 15-JUN-2006. XX CC PF 05-DEC-2005; 2005WO-EP013013. XX PR 07-DEC-2004; 2004EP-00028917. XX CC PA (LONZ ) LONZA AG. CC PA (MORP-) MORPHOSYS AG. XX CC PI Brass J, Kiziak C, Klein J, Ostendorp R; XX DR WPI; 2006-415137/42. XX CC PT New vector expressible in a host comprises the rhaBAD promoter region of CC PT the L-rhamnose operon operably linked to a transcriptional unit, useful CC PT for regulated heterologous expression of a nucleic acid sequence in a CC PT prokaryotic host. XX CC PS Claim 19; SEQ ID NO 1; 67pp; English. XX CC The invention relates to a vector expressible in a host comprising the CC rhaBAD promoter region of the L-rhamnose operon operably linked to a CC transcriptional unit. The vector comprises: a nucleic acid sequence, CC which is heterologous to the host; and a prokaryotic signal sequence CC operably linked to the nucleic acid sequence, where the prokaryotic CC signal sequence is selected from signal peptides of periplasmic binding CC proteins for sugars, amino acids, vitamins, or ions, and whereas the CC expression of the nucleic acid sequence is controlled by the promoter CC region. Also included are: an isolated and purified nucleic acid sequence CC expressible in a host comprising the rhaBAD promoter region of the L- CC rhamnose operon operably linked to a transcriptional unit comprising: a CC nucleic acid sequence, which is heterologous to the host; and a CC prokaryotic signal sequence operably linked to the nucleic acid sequence, CC whereas the prokaryotic signal sequence is selected from signal peptides CC of periplasmic binding proteins for sugars, amino acids, vitamins, or CC ions and, whereas the expression of the nucleic acid sequence is CC controlled by the promoter region; the plasmid pBW22-Fab-H; the plasmid CC pAKL14; a prokaryotic host transformed with the vector, the isolated and CC purified nucleic acid sequence, and/or the plasmids; and producing a CC polypeptide in a host. The vector is useful for the regulated CC heterologous expression of a nucleic acid sequence in a prokaryotic host. CC The present sequence represents E. coli rhaBAD promoter from the L- CC rhamnose operon. XX SQ Sequence 129 BP; 34 A; 32 C; 25 G; 38 T; 0 U; 0 Other; Query Match 100.0%; Score 119; Length 129; Best Local Similarity 100.0%; Matches 119; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGC 60 Qy 61 CCATTTTCCTGTCAGTAACGAGAAGGTCGCGAATTCAGGCGCTTTTTAGACTGGTCGTA 119 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCATTTTCCTGTCAGTAACGAGAAGGTCGCGAATTCAGGCGCTTTTTAGACTGGTCGTA 119 9. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHANG-YU WANG whose telephone number is (571)272-4521. The examiner can normally be reached Monday-Thursday, 7:00am-5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jeffrey Stucker can be reached at 571-272-0911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Chang-Yu Wang June 27, 2026 /CHANG-YU WANG/Primary Examiner, Art Unit 1675
Read full office action

Prosecution Timeline

Show 12 earlier events
Apr 21, 2025
Response after Non-Final Action
Jun 18, 2025
Non-Final Rejection mailed — §112
Nov 17, 2025
Response Filed
Mar 11, 2026
Final Rejection mailed — §112
May 11, 2026
Response after Non-Final Action
Jun 11, 2026
Request for Continued Examination
Jun 12, 2026
Response after Non-Final Action
Jul 01, 2026
Non-Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12662528
NOVEL ANTI-NOGO-A ANTIBODIES
4y 2m to grant Granted Jun 23, 2026
Patent 12662678
HUMAN ALZHEIMER'S DISEASE AND TRAUMATIC BRAIN INJURY ASSOCIATED TAU VARIANTS AS BIOMARKERS AND METHODS OF USE THEREOF
3y 6m to grant Granted Jun 23, 2026
Patent 12655201
ISOLATED ANTIGEN BINDING PROTEIN AND USE THEREOF
3y 6m to grant Granted Jun 16, 2026
Patent 12653872
MIMOTOPES OF ALPHA-SYNUCLEIN AND VACCINES THEREOF FOR THE TREATMENT OF SYNUCLEINOPATHY
3y 6m to grant Granted Jun 16, 2026
Patent 12624396
METHODS FOR DETERMINING THE PRESENCE OR RISK OF DEVELOPING FACIOSCAPULOHUMERAL DYSTROPHY (FSHD)
5y 5m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
34%
Grant Probability
87%
With Interview (+53.3%)
3y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 861 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month