Prosecution Insights
Last updated: May 29, 2026
Application No. 17/323,715

GENERATION OF HOXA-EXPRESSING HEMOGENIC ENDOTHELIUM WITH ENHANCED T CELL POTENTIAL FROM HPSCS

Non-Final OA §102§103§112
Filed
May 18, 2021
Priority
May 18, 2020 — provisional 63/026,494
Examiner
ROGERS, ERIC JASON
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wisconsin Alumni Research Foundation
OA Round
5 (Non-Final)
59%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
88%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
58 granted / 98 resolved
-0.8% vs TC avg
Strong +29% interview lift
Without
With
+28.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
38 currently pending
Career history
141
Total Applications
across all art units

Statute-Specific Performance

§101
1.3%
-38.7% vs TC avg
§103
55.8%
+15.8% vs TC avg
§102
3.5%
-36.5% vs TC avg
§112
10.7%
-29.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 98 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on Nov. 24, 2025 has been entered. Claim Status Claims 1-14, 16-20 and 25-26 are pending in the application. Claims 1-13 and 25-26 are withdrawn from consideration as being drawn to non-elected subject matter, and claims 14 and 16-20 have been considered on the merits. All arguments have been thoroughly reviewed and fully considered. Objections to the Disclosure Page 4 in the specification refers to colors in Figure 4 (red and magenta); however, color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection will not be held in abeyance. Claim Objections Claim 14 recites a series of wherein clauses, which would be clearer if rewritten with an “and” between the penultimate and ultimate wherein clauses. Appropriate correction is requested. Claim 14 recites the term “KDR mesoderm cells,” which is neither defined by the claim nor the instant specification. If this is an abbreviation, then the abbreviation needs to be spelled out at least once in the claims. For purposes of applying prior art, the term “KDR” mesoderm cells is interpreted as meaning “KDR+” mesoderm cells, which merely requires a given mesoderm cell having a detectable amount of KDR expression (also known as VEGFR2 or Flk-1), whether detected as KDR protein or an mRNA encoding it. Claim 20 recites the phrase “any one of claim 16,” which is grammatically unclear as only one claim is referenced therein. Appropriate correction is required. Claim Interpretation In the claims, the term “SOX17 transgene” is interpreted as requiring a regulatory sequence(s) that drive expression of SOX17 protein as the term is typically used in the art, e.g., a promoter sequence. In the claims, the terms DLL4+ or CXCR4+ are interpreted as merely requiring a given cell to express a detectable amount of DLL4 or CXCR4, respectively, whether on a cell surface and notwithstanding teachings in the prior art regarding differential levels of cell surface expression, e.g., Ayllon et al., Leukemia 29: 1741-53 (2015) at Fig. 4a, Fig. 5a,e; Shiba et al., Cardiovasc Res 81: 169-77 (2008) at Fig. 1,2D. Claim 14 is interpreted as a product-by-process encompassing any human cell population comprising at least 90% DLL4+ CXC4+ CDX2-expressing arterial hemogenic endothelium (AHE) cells made from human pluripotent stem cells (hPSCs) using an induced SOX17 transgene expression. Note for patentability over the prior art purposes, product-by-process claims are treated outrightly as products, while for patent infringement purposes, product-by-process claims are treated exclusively as process claims. See Abbott v. Sandoz, 566 F.3d 1282 (Fed. Cir. 2009). While the recited process used in making the claimed product comprises introducing an inducible SOX17 transgene into a population of hPSCs, differentiating the hPSCs into “KDR” mesoderm cells, and inducing expression of the transgene in “KDR” mesoderm cells, there is no unrecited structural feature(s) clearly implied in the claim beyond the presence of pan-mesoderm markers, like Brachyury, and/or more narrower mesoderm marker like HAND1 as instantly shown. For example, there is no requirement that the SOX17 transgene be present in any resulting DLL4+ CXCR4+ AHE cells of the final product. Furthermore, based on the instant claim language, the result of induced SOX17 expression need not result in the upregulation of all of HOXA5, HOXA7, HOXA9, HOX10, and HOXA11, but rather just at least one of the aforementioned. Similarly, the result of induced SOX17 expression need not result in the expression of any of EFNB2, NOTCH4 and HEY1. There is no unrecited structural feature(s) implied in the claim that would distinguish a cell population of 90% DLL4+ CXCR4+ CDX2-expressing AHE cells produced by the recited method versus any other cell population of DLL4+ CXCR4+ arterial hemogenic endothelium (AHE) cells, such as methods whereby SOX17 does not stimulate/upregulate any gene selected from HOXA5, HOXA7, HOXA9, HOXA10, and HOXA11 and/or does not enhance arterial specification of hemogenic endothelium cells by 50%. There is no requirement the resulting DLL4+ CXCR4+ CDX2-expressing AHE cells also express one or more of HOXA5, HOXA7, HOXA9, HOXA10, and HOXA11. There is no requirement that all of the at least 90% of the DLL4+ CXCR4+ CDX2-expressing AHE cells also express one or more of EFNB2, NOTCH4, and HEY1 as DLL4 and CXCR4 expression is required. Moreover, the phrases “SOX17-induced” and “wherein expression of SOX17 increases production of AHE cells by about 50%” regarding the process of product production is considered but does not imply any structural limitation to the claimed product. Thus, claim 14 is interpreted as encompassing any cell population comprising at least 90% DLL4+ CXCR4+ CDX2-expressing AHE cells regardless of how exactly obtained or the precise process that might have been used to make the population absent evidence to the contrary. In claim 14, the term “arterial hemogenic endothelium (AHE)” is interpreted as meaning an in vitro cellular aggregate, typically a monolayer, comprising mostly or entirely endothelium cells, but often comprising hPSCs and endothelial progenitor cells. Claim 16 is interpreted as a product-by-process regarding the preamble term “SOX17-induced.” There is no unrecited structural feature(s) implied in the claim that would distinguish a pluripotent stem cell population comprising a SOX17 transgene and expressing CDX2 produced by a SOX17 induction versus any other cell population of CDX2-expressing pluripotent stem cells comprising a SOX17 transgene. Also, there is no indication of what additional unrecited structural feature(s) or implied limitations, if any, provide for the capability of differentiating into DLL4+ CXCR4+ arterial hemogenic endothelial (AHE) cells, and thus, claim 16 is interpreted as encompassing any human pluripotent stem cell population comprising a SOX17 transgene and expressing CDX2 absent any evidence to the contrary. In view of the instant specification, “SOX17-induced” may mean hPSC contacted with SOX17 protein, or nucleic acid encoding such (e.g., a vector) as well as hPSC specifically “induced” to express said SOX17 transgene operably linked to an inducible promoter by providing the hPSC with an inducing condition, e.g., contacting with an inducing chemical or temperature or a “signaling” molecule required for activation of an inducible transgene expression (pg. 8 line 26, to pg. 10, line 31; pg. 12, lines 6-12). Claim Rejections - 35 USC § 112(a), Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 14 and 16-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claimed invention as a whole is not adequately described if the claims require essential or critical elements that are not adequately described in the specification and that is not conventional in the art as of applicant’s effective filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641,1646 (1998). In making a determination of whether the application complies with the written description requirement under 35 U.S.C. 112(a) or 35 U.S.C. 112, first paragraph, it is necessary to understand what Applicant is claiming and what Applicant has possession of. Claim 14 recites the functional limitations of: i) wherein inducing expression of SOX17 upregulates HOXA genes selected from a group consisting of HOXA5, HOXA7, HOXA9, HOXAl0, and HOXA11; ii) wherein the AHE cells express one or more arterial markers selected from a group consisting of EFNB2, DLL4, NOTCH4, CXCR4, and HEY1; iii) wherein expression of SOX17 increases production of AHE cells by about 50%; iv) wherein the cell population is at least 90% DLL4+CXCR4+ AHE cells; and v) wherein the at least 90% DLL4+CXCR4+ AHE cell express CDX2. In claim 14, all the process steps (a), (b), and (c) are each recited at a high level of generality. As the limitations listed above (i)-(v) are not all reasonably predicted to occur merely by performing the process steps recited in the claim, one skilled in the art would not find applicant had possession of the claimed invention as currently drafted. Firstly, the prior art is silent as to any method expressly resulting in (iii)-(v). For example, Wang teaches culturing a population of human pluripotent stem cells comprising a human SOX17 transgene using a protocol resulting in CDX2-expressing cells without mention as to any specific increase in production of AHE cells or the percentage of the resulting cell population that is DLL4+CXCR4+ AHE cells and/or CDX-2 expressing AHE cells (Wang et al., Cell Stem Cell 8: 335-4 (2011) at Fig. 1, 6A-B). Similarly, Guye teaches culturing human pluripotent stem cells overexpressing a SOX17 transgene via an inducible promoter and for a time sufficient to produce hemogenic endothelial (HE) cells without mention as to any specific increase in production of AHE cells or the percentage of the resulting cell population that is DLL4+CXCR4+ AHE cells and/or CDX-2 expressing AHE cells (col. 5, line 30 to col. 6, line 36; col. 12, lines 23-52; col. 15, lines 36-40). Second, in the working examples to yield the recited results (iii)-(v), the protocol comprised a CD31 MACS step, culturing hemogenic endothelium (HE) specified cells in a medium comprising FGF, VEGF, TPO, SCF, IL-6, IL-3 and FLT3L for 1-5 days, and FACS-isolating DLL4+ CXCR4+ AHE cells (Example 1). Thus, the written description does not support the full scope of the current claims with regard to the recited AHE cell population produced occurring from merely performing the recited process steps of (a)-(c), i.e., to yield the specific results of (iii)-(v), concordantly and respectively. Furthermore based on the instant claim language, the result of induced SOX17 transgene expression need not result in the upregulation of all of HOXA5, HOXA7, HOXA9, HOX10, and HOXA11 nor the expression of any of EFNB2, NOTCH4 and HEY1, which raises doubt as to how 90% DLL4+CXCR4+ CDX2-expressing AHE cells are predictably produced in the absence of any EFNB2, NOTCH4, HEY1, and HOXA5 expression and the absence of Sox17 induction of the arterial HE (AHE) program known to comprise HOXA7, HOXA9, and HOXA10 in view of prior art teachings (Jung et al., Blood 134: 2476 (2019)) at end of pg. 1 to 1st para. of pg. 2; Morini et al., Curr Opin Hematol 21: 229-34 (2014) at Fig. 1; pg. 232, left col., 1st and 2nd para.; pg. 231, right col., 4th para.; Ng et al., 2016, IDS ref., at Fig. 4; Sluvkin and Uenishi, Exp Hematol 71: 3-12 (2018) at pg. 6, 4th para.). Thus, the written description does not support the full scope of the current claims with regard to the optionality of EFNB2, NOTCH4, and HEY1 expression in the AHE cells. In addition, claim 14 is directed to a product-by-process whereby the product is made via “KDR mesoderm” intermediate cells. As this term “KDR mesoderm” is not defined in the claims, instant specification, or the prior art, a person of ordinary skill in the art would not recognize applicant was in possession of such a process or the product produced by said process. In view of the specification, claims 16-20 are directed to a modified population of human pluripotent stem cells (hPSC) wherein the cells are “capable” of differentiating into DLL4+ CXCR4+ AHE cells. The claims are broad in that this limitation is only recited in functional language without pointing to any structure providing this capability or pointing to a nexus to a structure(s) ensuring this capability is present in the hPSC population recited. The claims are also broad in that although the hPSC each comprise a SOX17 transgene, that the SOX17 transgene need not expressly be expressed in the hPSC population capable of differentiating into DLL4+ CXCR4+ AHE cells. For example, in view of dependent claim 18, the hPSC population of any one claims 16-17 and 19-20 encompasses those lacking any inducible promoter operably linked to the SOX17 transgene. Similarly, the written description provides for transient SOX17 protein expression, such as via a transduced exogenous SOX17 mRNA or protein (pg. 8, lines 9-10; pg. 10, 29-30). In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described. In the instant case, the instant specification provides wide-ranging representatives species for methods of inducing SOX17 protein by providing/introducing SOX17 protein (e.g., via direct transduction) or indirectly via expression from a nucleic acid (e.g., transduced mRNA) or vector capable of expressing SOX17 protein, e.g., transiently or upon induction (pg. 8 line 26, to pg. 10, line 31; pg. 2, lines 14-15). Specific transgene inductions described include using tetracycline response element (TRE) engineered Tet/DOX-inducible promoters responsive to tetracycline (Tc) and/or doxycycline (DOX), as well as glucocorticoid-responsive mouse mammary tumor virus promoters (MMTVprom), tamoxifen-responsive hormone-binding domain of the estrogen receptor (ERTAM), the ecdysone-inducible promoter (EcP), heat shock inducible promoters, and the T7 promoter (T7P) (pg. 10, line 7-26; pg. 12, lines 6-12). Thus, while SOX17 transgene introduction and inducible expression is well described, there is minimal description for methods comprising transducing SOX17 protein or transiently expressing SOX17 mRNA or other nucleic acids encoding SOX17, .e.g., to achieve sufficient induction over 2 days. The prior art teaches overexpressing SOX17 in pluripotent stem cells transiently via mRNA injection, liposome encapsulated encoding DNA and via DNA vectors, such as under the control of an inducible promoter (Zorn et al., Mol Cell 4: 487-98 (1999) at Fig. 1; Nakajima-Takagi et al., (2013); Lizama et al. (2015), IDS ref.; at Fig. 2-3; Liu et al., Nat Commun 10: 2126 (2019) at Fig. 3; Niakan et al., Genes Dev 24: 312-26 (2010) at pg. 319, left col., last para., Fig. 5; pg. 324, left col., Sox17-inducible, and pg. 316, right col., para. 2-4, Sox17::GFP-high, Fig. 3). The prior art also teaches liposome-based delivery of functional proteins to cells generally (see e.g., Chatin et al., Mol Ther Nucleic Acids 23:4:e244 (2015) at pg. 1, left col., last para., to right col.). However the prior art is silent as to directly transducing SOX17 protein or using injection of mRNA encoding SOX17 for any specific duration to modify a human pluripotent stem cell into a DLL4+ CXCR4+ AHE cell. The skilled artisan could not rely upon the disclosure in the specification such that the specification would sufficiently describe that Applicant was in possession of the entire scope of hPSC populations “capable” of differentiating into DLL4+ CXCR4+ AHE cells as claimed, which encompasses those that never express said SOX17 transgene but instead have a SOX17 inducement via a SOX17 protein/mRNA contacting of the cells, very transient inducement, or transduction of exogenous SOX17 protein. 35 USC § 112(a), Scope of Enablement Claims 14 and 16-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because while enabling the method of claim 14 wherein the mesoderm cells are “KDR+” mesoderm cells and inducing expression of the SOX17 transgene results in the expression of at least EFNB2, NOTCH4, HOXA5, HOXA7, HOXA9, and HOX10; the specification does not enable any person, skilled in the art to which it pertains, or with which it is most nearly connected to, to perform the method recited in claim 14 to produce a cell population comprising at least 90% of cells that are DLL4+ CXCR4+ CDX2-expressing AHE cells. Also, while enabling the method of claims 16-20 wherein the hSPC population is induced to express a mammalian SOX17 transgene in a sufficient dosage, the specification does not enable any person, skilled in the art to which it pertains, or with which it is most nearly connected to, to produce a CDX2-expressing cell population guaranteed to predictably have the capability to differentiate into DLL4+ CXCR4+ AHE cells. Enablement is considered in view of the Wands factors (MPEP 2164.01 (a)). The court in Wands states that "Enablement is not precluded by the necessity for some experimentation such as routine screening. However, experimentation needed to practice the invention must not be undue experimentation. The key word is 'undue.' Not 'experimentation;" (Wands, 8 USPQ2d 104). Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. "Whether undue experimentation is needed is not a single, simple factual determination, but rather is a conclusion reached by weighting many factual considerations." (Wands, 8 USPQ2d 1404). The factors to be considered when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any necessary experimentation required is “undue” include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. Furthermore, the USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Breadth of claims Claim 14 is directed to a product-by-process whereby the product is made via KDR mesoderm intermediate cells. As this term “KDR mesoderm” is not defined in the claims, instant specification, or the prior art, a person of ordinary skill in the art would not be able to make/use such a process or the product of said process. Furthermore, claim 14 is broad in that the result of induced SOX17 transgene expression need not result in the upregulation of all of HOXA5, HOXA7, HOXA9, HOX10, and HOXA11 nor the expression of any of EFNB2, NOTCH4 and HEY1. Claims 16-20 are broadly directed to hPSC populations “capable” of differentiating into DLL4+ CXCR4+ AHE cells wherein the populations express CDX2 and merely comprise a SOX17 transgene, which encompasses those hPSC populations that never express said SOX17 transgene and rather are SOX17-induced in another fashion encompassed by the claims in view of the specification. Additionally, the term “SOX17” (in SOX17-induced and SOX17 transgene) broadly encompasses both mammalian and non-mammalian genes and proteins, e.g., amphibian XSox17 (Zorn et al., Mol Cell 4: 487-98 (1999) at abstract). The state of the art: The prior art teaches overexpressing SOX17 in pluripotent stem cells via mRNA injection and DNA vector transfection, such as using non-integrating or integrating viral vectors and under the control of a Tet/DOX-inducible promoter (M2-rtTA-ROSA26) (Zorn et al., Mol Cell 4: 487-98 (1999) at Fig. 1; Nakajima-Takagi et al., (2013); Lizama et al. (2015), IDS ref., at Fig. 2-3; Niakan et al., Genes Dev 24: 312-26 (2010) at pg. 319, left col., last para., Fig. 5; pg. 324, left col., Sox17-inducible, and pg. 316, right col., para. 2-4, Sox17::GFP-high, Fig. 3). The prior art also teaches SOX17 is expressed in endothelial cells, required during the hematopoietic transition (EHT), and is a marker for hemogenic endothelium cells (Clarke et al. (2013), IDS ref. at abstract; Bos et al., Development 142: 2719-24 (2015) at Fig. 4). Further, the prior art teaches SOX17+ endothelium cells upregulate HOXA11, HES4, HOXA10, HOXA5, HOXA9, HEY1, CXCR4, EFNB2, and DLL4 compared to a SOX17- control (Ng et al., 2016 at Fig. 4). More particularly, the prior art teaches arterial-type definitive hemogenic endothelium cells are associated with expression of SOX17, DLL4, EFNB2, SOX17, CXCR4, HOXA5, HOXA7, and NOTCH1 (Uenishi et al. (2018), IDS ref., at pg. 7, pg. 8 right col., Fig. 6) and that DLL4+ arterial-type hemogenic endothelium cells have high expression of NOTCH4, HEY1, SOX17, and EFNB2 (Sluvkin and Uenishi, Exp Hematol 71: 3-12 (2018) at pg. 6, 4th para.). However the prior art is silent as to transducing a pluripotent stem cell with SOX17 protein and/or very transiently to induce differentiation into DLL4+ CXCR4+ AHE cells, or a cell type capable thereof. The prior art is silent as to inducing expression of a species of SOX17 transgene consisting of XSox17β in human KDR+ mesoderm cells to produce DLL4+ CXCR4+ AHE cells but instead teaches this Sox17 homolog has a different target consensus site and thus different downstream effector genes (pg. 491, left col., last para.; Fig. 4). The prior art is silent as to methods of producing AHE cells lacking expression of EFNB2, NOTCH4 and HEY1 and to any Sox17 induction of the an arterial HE (AHE) program lacking HOXA7, HOXA9, and HOXA10 expression. These aspects of using must be shown to a reasonable extent so that one of the ordinary skills in the art would be able to practice the invention without any undue or unreasonable burden being on such artisan. The amount of direction and guidance as well as any working examples provided: The instant specification provides working examples of methods of differentiating in cell culture human pluripotent stem cells (hPSCs) into KDR+ mesoderm cells using H9 hESC induced to express a human SOX17 protein by exposure to a DOX+ condition (2 μM doxycycline) and culturing with the doxycycline for 2 days further (Example 1; [0088]; FIG. 2-6, 11; [0041]). Nowhere does the instant specification show how to perform this method without expression of EFNB2, NOTCH4, HEY1, and HOXA genes in KDR+ mesoderm cells (see FIG. 5-6, Example 1). Thus, there is no evidence in the instant application or the prior art that the scope of SOX17-induced hPSC population encompassed by claim 14 would predictably produce DLL4+ CXCR4+ CDX2 expressing AHE cells lacking expression of any of EFNB2, NOTCH4, and HEY1 or by a method lacking induction of HOXA genes. Nowhere does the instant specification show how to perform this method using SOX17 protein transduction or transient SOX17 expression from a nucleic introduced by transduction, e.g., an mRNA. Thus, there is no evidence in the instant application or the prior art that the scope of SOX17-induced hPSC population encompassed by claims 16-20 would predictably have the ability to differentiate into DLL4+ CXCR4+ AHE cells. Undue experimentation would be required to fill these gaps and unpredictability. Undue experimentation is required to determine the entire scope of methods of SOX17 induction to achieve cells capable of differentiating into DLL4+ CXCR4+ AHE cells, and may never actually be achievable across the full scope. It would be remedial to limit claim 16 to wherein the SOX17 transgene is induced to express a mammalian SOX17 protein via an operably linked inducible promoter in a sufficient amount over a sufficient period of time to ensure the ability to differentiate into DLL4+ CXCR4+ AHE cells. In summary, the claims are rejected under 35 U.S.C. 112(a) because the specification does not reasonably provide enablement to a person skilled in the art to produce (1) “KDR” mesoderm cells or (2) a SOX17-induced hPSC cell population comprising a SOX17 transgene that is ensured to be capable of differentiating into DLL4+ CXCR4+ AHE cells. Given the lack of working examples, the limited guidance provided in the specification, the lack of guidance in the prior art, and the broad scope of the claims, undue and/or unreasonable experimentation would have been required for one skilled in the art to produce the recited cells over the full scope claimed. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 14 and 16-20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 14 recites the relative term “about”, which renders the claim indefinite because neither the claim nor the specification provides a definition or standard deviation for “about” and, thus, one of ordinary skill in the art would not be reasonably appraised of the scope of this limitation. Claim 14 recites the phrase “wherein expression of SOX17 increases production of AHE cells by about 50%,” which is incoherent, ambiguous and unclear as to what baseline or comparison condition is this increase determined, including regarding induction duration, culture duration, and native SOX17 expression, if any. Claim 16 recites the term “SOX17-induced hPSC,” which is ambiguous and unclear without the impermissible importation into the claim of subject matter from the specification (e.g., pg. 8 line 26, to pg. 10, line 31; pg. 12, lines 6-12; pg. 16, lines 19-22; Example 1; FIG. 9) (see MPEP 2111.01(II)). “SOX17-induced” may mean hPSC contacted with SOX17 protein, or nucleic acid encoding such (e.g., a vector) as well as hPSC specifically “induced” to express said SOX17 transgene operably linked to an inducible promoter by providing the hPSC with an inducing condition, e.g., contacting with an inducing chemical or temperature or a “signaling” molecule required for activation of an inducible expression, i.e., initiates transcription only in the presence of a particular molecule, e.g., doxycycline (DOX) or tetracycline (Tet) (pg. 8 line 26, to pg. 10, line 31; pg. 12, lines 6-12). For example, does the term “SOX17-induced” require any SOX17 function occurs, e.g., upregulation of a SOX17 target gene(s) or HOXA gene(s), such as one or more of HOXA5, HOXA7, HOXA9, HOXA10, and HOXA11. Claims 17-20 are included in this rejection for depending from indefinite claim 16. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 16-17 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wang (Wang et al., Cell Stem Cell 8: 335-4 (2011)). The claims are interpreted as provided in a previous section. Regarding claim 16, Wang discloses culturing a population of human pluripotent stem cells (hESCs) comprising a human SOX17 transgene (hSOX17eGFP) (Fig. 1) using a protocol resulting in CDX2-expressing cells (Fig. 6A-B, stage3 or stage4). Although Wang does not expressly disclose these cells are capable of differentiating into DLL4+ CXCR4+ AHE cells, the cell population anticipates the claimed product by having all recited structural features required for this capability according to claim 16 as currently presented. Note, a claimed product is not limited by any particular intended use, such as regarding a differentiating step that may or may not ever be applied to the product, e.g., via an inducing step. Further, “[w]hen the PTO shows a sound basis for believing that the products of the applicant and the prior art are the same, the applicant has the burden of showing that they are not.” In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990) (see MPEP 2112(V)). Regarding claim 17, Wang discloses the SOX17 transgene was introduced using a vector and retains fragments of this targeting vector (Fig. 1A). Thus, Wang anticipates the claimed invention. Claims 16-18 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Guye (US Patent 9,677,085) as evidenced by Jung (Jung et al., Blood 134: 2476 (2019)). Regarding claim 16, Guye discloses culturing human pluripotent stem cells (hiPS cells) comprising and overexpressing a SOX17 transgene via an inducible promoter and for a time sufficient to produce hemogenic endothelial cells (col. 5, line 30 to col. 6, line 36; col. 12, lines 23-52; col. 15, lines 36-40). Although Guye does not expressly disclose these cells express CDX2, human stem cells overexpressing SOX17 significantly upregulate CDX2 expression in SOX17-induced cultures as evidenced by Jung (end of pg. 1 to 1st para. of pg. 2). Regarding claim 17, Guye discloses the SOX17 transgene is in a vector (col. 6, lines 1-17). Regarding claim 18, Guye discloses the vector comprises an inducible promoter operably linked to the SOX17 transgene (col. 6, lines 1-25; col. 5, lines 62-67). Thus, Guye anticipates the claimed invention. Response to remarks Although Applicant’s response filed 11/24/25 established at pg. 6 in combination with Rule 130(b) Declarations of Sluvkin and Jung that Jung is not available as prior art under 35 USC 102(b)(1)(A), Jung is relied upon as evidence for inherency of CDX2 expression induced by SOX17 transgene expression. There is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the time of invention, but only that the subject matter is in fact inherent in the prior art reference. Schering Corp. v. Geneva Pharm. Inc., 339 F.3d 1373, 1377, 67 USPQ2d 1664, 1668 (Fed. Cir. 2003). Thus, a reference relied on to show evidence of inherency need not qualify as prior art and the date of such a reference need not be a “prior art” date. Applicant’s claim amendment, noted at the end of pg. 9 of the response, to add the preamble language “SOX17-induced” is both broad and unclear as noted above in the 112(a) and 112(b) rejections. Further, claim 16 is interpreted as a product-by-process regarding “SOX17-induced,” which is interpreted as not necessarily providing any structural limitation, such as regarding the presence of a SOX17 transgene or even any remnant or leftover structure resulting from such a SOX17-induced process absence evidence to the contrary. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 14 and 16-18 are rejected under 35 U.S.C. 103 as being unpatentable over Guye (US Patent 9,677,085) in view of Park2 (Park et al., Cell Rep 23: 2467-81 (2018)) and as evidenced by Jung (Jung et al., Blood 134: 2476 (2019)), Morini (Morini et al., Curr Opin Hematol 21: 229-34 (2014)), and Basu (Basu et al., J Vis Exp 10:(41): 1546 (2010)). As set forth fully above, claims 16-18 are anticipated by Guye and, thus, Guye as evidenced by Jung renders obvious the subject matter of claims 16-18. The claims are interpreted as provided in a previous section and in particular claim 14 is interpreted as encompassing any cell population comprising at least 90% DLL4+ CXCR4+ CDX2-expressing AHE cells produced using a SOX17-inducement at some point. Regarding claim 14, Guye teaches CXCR4+ hemogenic endothelium cell populations (col. 5, lines 41-51; col. 6 lines 30-36; FIG. 19D) comprising a SOX17 overexpression construct (e.g., an inducible SOX17 transgene) and methods of making these cells from human pluripotent stem cells by modifying stem cells to overexpress a gene encoding SOX17 (col. 6, lines 30-33) and inducing overexpression of SOX17 (e.g., human SOX17) in culture for sufficient time to produce a particular cell type (e.g., hemogenic endothelium (HE) or hematopoietic progenitor cell), such as by culturing the cells at least 2 days (e.g., 4-15 days) (col. 13, line 53, to col. 14, line 8), and specifically producing a hemogenic endothelial cell overexpressing SOX17 (col. 5, line 30 to col. 6, line 53; col. 12, lines 23-35; col. 13, lines 34-35; col. 15, lines 36-40). Guye teaches purifying (isolating) and transplanting these hemogenic endothelial cells into a subject (col. 6, lines 48-60), such as for continued maturation in the subject (col. 14, lines 8-12). Although Guye does not teach that the SOX17 expression upregulates a specific HOXA gene, such as HOXA5, HOXA7, HOXA9, HOXA10, and/or HOXA11. However as noted in the claim interpretation, the claims are directed merely to the product of a cell population comprising at least 90% DLL4+ CXCR4+ AHE cells expressing CDX2 regardless of the process used to make the population. Guye does not expressly teach the resulting CXCR4+ hemogenic endothelium cell populations comprise DLL4+ arterial hemogenic endothelium (AHE) cells which express CDX2 or the purity of such cells. However Morini teaches SOX17 expression upregulates Dll4 expression directly via binding upstream of the Dll4 promoter along with β-catenin and promotes the development and maintenance of arterial hemogenic endothelium, including by upregulating CXCR4 and EFNB2 (EphrinB2) (Fig. 1; pg. 232, left col., 1st and 2nd para.; pg. 231, right col., 4th para.). Jung teaches forced overexpression of Sox17 upregulates DLL4, NOTCH4, CXCR4, HOXA7, HOXA9, HOXA10, and CDX2 in stem cells in cell culture in its role of activating and integrating arterial hemogenic endothelium (AHE) gene expression programs (end of pg. 1 to 1st para. of pg. 2). Jung teaches CDX2 is a mediator for arterial HE formation in response to SOX17 expression (pg. 2, last para.). As Guye discloses the method of introducing an inducible SOX17 transgene into hPSCs, culturing the cells under conditions for differentiation while inducing transgene expression with the aim to produce CXCR4+ hemogenic endothelium cells in the population, this method would inherently result in DLL4+ CXCR4+ AHE cells as evidenced by Morini and Jung; and further, wherein at least some of the DLL4+ CXCR4+ AHE cells in the population inherently express one or more of EFNB2, NOTCH4, HOXA7, HOXA9, and HOXA10 due to forced SOX17 expression as evidenced by Morini and Jung. Thus, the CXCR4+ HE cell population of Guye comprises at least a subset of DLL4+ CXCR4+ AHE cells as evidenced by Morini and Jung. Although Guye teaches generating CXCR4+ HE cell populations in vitro which overexpresses SOX17 (e.g., via an inducible promoter) (col. 7, lines 3-6; col. 5, line 34-40; col. 5, line 51; col. 5, line 62, to col. 6, line 36) and purifying a desired cell type from a heterogenous population (col. 6, lines 48-60), Guye does not expressly teach purifying a cell population comprising DLL4+ CXCR4+ AHE cells to at least 90% purity. However Park2 teaches using human pluripotent stem cells to make hemogenic endothelium (HE) cells in scalable methods with the purpose of creating various blood cells for clinical purposes, e.g., treatment of blood diseases and immunotherapies (Abstract; pg. 2476, right col., 1st para.). Specifically, Park2 teaches using DLL4+ CXCR4+ AHE cells (produced from in vitro cultures of human pluripotent stem cells modified to express DLL4 and increase Notch signaling) because of their definitive hematopoiesis potentials and abilities to generate definitive lymphomyeloid progenitors and enriched populations of T and B lymphoid cells in vitro (Abstract; pg. 2469, left col., 1st para.; Fig. 2A). Park2 teaches DLL4+ CXCR4+ AHE cells provide for improved T cell progenitor cell production useful for large scale iPSC-based T cell creation for immunotherapies (pg. 2476, left col., 3rd para.). Park2 also teaches purifying AHE cells via FACS sorting based on expression of the arterial markers CXCR4 and DLL4 (pg. 2479, left col., 1st para.; Fig. 5D, pg. 2471, right col., 1st para.; Fig. S7). Park2 also teaches other useful arterial markers expressed by the DLL4+ AHE cells include EFNB2, SOX17, and NOTCH1, (pg. 2471, right col., 1st para.; Fig. 5E; Fig. 1D-E). Furthermore, Basu teaches routine cell purification techniques already known in the prior art can achieve at least 90% purity via fluorescence activated cell sorting (FACS) using a cell surface marker (pg. 3, last para.). It would have been prima facie obvious to one of ordinary skill in the art before the effective time of filing with the goal of creating blood cells from CXCR4+ HE cells to purify the cells away from heterogenous cell types or tissues using well-known HE cell surface markers (e.g., SOX17, CXCR4, and/or DLL4) and routine techniques known in the art as noted in Basu and whereby the final purity is at least 90% with a reasonable expectation of success as taught by Basu. One of ordinary skill in the art would be motivated to prepare a homogenous DLL4+ CXCR4+ AHE cell population with as high of a purity as practically possible to improve methods of producing large amounts of hematopoietic stem cells and lymphoid cells (e.g., T cell) for use in immunotherapies as taught by Park2, such as wherein the cells also inherently express one or more of EFNB2, NOTCH4, HOXA7, HOXA9, and HOXA10. For applying prior art, an intended use of a claimed product only limits the claim if there is an implied structure not recited in the claims (see Pitney Bowes, Inc. v. Hewlett-Packard Co., 182 F.3d 1298, 1305, 51 USPQ2d 1161, 1165 (Fed. Cir. 1999) as “it is important not to import into a claim limitations that are not part of the claim.” See MPEP 2111.01.02. Furthermore, based on the logic of claim 14, any intended results or, capability thereof, from inducing expression of SOX17 is inherently present absent evidence to the contrary as predicated by the natural laws of cell biology when expression of any SOX17 transgene is induced in cultured KDR+ mesoderm cells, e.g., via downstream activation of Sox17 effector gene(s). Thus, all of HOXA5, HOXA7, HOXA9, HOXA10, and HOXA11 would be induced eventually as necessarily flows from SOX17 transgene expression based on the instant claim language. Similarly, all of EFNB2, DLL4, NOTCH4, CXCR4, HEY1, and CDX2 would be expressed for the same reasons. To the extent these capabilities are argued to be absent in such cells, note the 112(a) rejection above. Note only the claimed structures must be present in the product, including those implied by the process of making it, regardless of whether any functional limitation was previously met (i.e., previous functional effects of induced Sox17) during the process of its making (see MPEP 2113(I), 2111.04). The wherein clauses below (i) and (iii) are all limitations on the process of making the claimed product but not limiting on the resulting product (i.e., the population of DLL4+ CXCR4+ CDX2-expressing AHE cells): i) wherein inducing expression of SOX17 upregulates HOXA genes selected from a group consisting of HOXA5, HOXA7, HOXA9, HOXAl0, and HOXA11; iii) wherein expression of SOX17 increases production of AHE cells by about 50%. Thus, the claimed invention as a whole is prima facie obvious in the absence of evidence to the contrary. Claims 16-18 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Guye in view of AB464248 (GenBank AB464248; submitted 2008) and as evidenced by Jung (Jung et al., Blood 134: 2476 (2019)). As set forth fully above, claims 16-18 are anticipated by Guye and, thus, Guye as evidenced by Jung renders obvious the subject matter of claims 16-18. Regarding claim 20, the combination of Guye and Jung does not expressly teach the SOX17 transgene comprises instant SEQ ID NO: 58. However AB464248 teaches SEQ ID NO: 58 is a human open reading frame encoding SOX17 as shown below. GenBank AB464248 LOCUS AB464248 1259 bp DNA linear SYN 26-JUL-2016 DEFINITION Synthetic construct DNA, clone: pF1KB9723, Homo sapiens SOX17 gene for SRY (sex determining region Y)-box 17, without stop codon, in Flexi system. ACCESSION AB464248 VERSION AB464248.1 Query Match 100.0%; Score 1221; DB 1243; Length 1259; Best Local Similarity 100.0%; Matches 1221; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGAGCAGCCCGGATGCGGGATACGCCAGTGACGACCAGAGCCAGACCCAGAGCGCGCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10 ATGAGCAGCCCGGATGCGGGATACGCCAGTGACGACCAGAGCCAGACCCAGAGCGCGCTG 69 Qy 61 CCCGCGGTGATGGCCGGGCTGGGCCCCTGCCCCTGGGCCGAGTCGCTGAGCCCCATCGGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 70 CCCGCGGTGATGGCCGGGCTGGGCCCCTGCCCCTGGGCCGAGTCGCTGAGCCCCATCGGG 129 Qy 121 GACATGAAGGTGAAGGGCGAGGCGCCGGCGAACAGCGGAGCACCGGCCGGGGCCGCGGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 130 GACATGAAGGTGAAGGGCGAGGCGCCGGCGAACAGCGGAGCACCGGCCGGGGCCGCGGGC 189 Qy 181 CGAGCCAAGGGCGAGTCCCGTATCCGGCGGCCGATGAACGCTTTCATGGTGTGGGCTAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 190 CGAGCCAAGGGCGAGTCCCGTATCCGGCGGCCGATGAACGCTTTCATGGTGTGGGCTAAG 249 Qy 241 GACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 250 GACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAG 309 Qy 301 ATGCTGGGCAAGTCGTGGAAGGCGCTGACGCTGGCGGAGAAGCGGCCCTTCGTGGAGGAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 310 ATGCTGGGCAAGTCGTGGAAGGCGCTGACGCTGGCGGAGAAGCGGCCCTTCGTGGAGGAG 369 Qy 361 GCAGAGCGGCTGCGCGTGCAGCACATGCAGGACCACCCCAACTACAAGTACCGGCCGCGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 370 GCAGAGCGGCTGCGCGTGCAGCACATGCAGGACCACCCCAACTACAAGTACCGGCCGCGG 429 Qy 421 CGGCGCAAGCAGGTGAAGCGGCTGAAGCGGGTGGAGGGCGGCTTCCTGCACGGCCTGGCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 430 CGGCGCAAGCAGGTGAAGCGGCTGAAGCGGGTGGAGGGCGGCTTCCTGCACGGCCTGGCT 489 Qy 481 GAGCCGCAGGCGGCCGCGCTGGGCCCCGAGGGCGGCCGCGTGGCCATGGACGGCCTGGGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 490 GAGCCGCAGGCGGCCGCGCTGGGCCCCGAGGGCGGCCGCGTGGCCATGGACGGCCTGGGC 549 Qy 541 CTCCAGTTCCCCGAGCAGGGCTTCCCCGCCGGCCCGCCGCTGCTGCCTCCGCACATGGGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 550 CTCCAGTTCCCCGAGCAGGGCTTCCCCGCCGGCCCGCCGCTGCTGCCTCCGCACATGGGC 609 Qy 601 GGCCACTACCGCGACTGCCAGAGTCTGGGCGCGCCTCCGCTCGACGGCTACCCGTTGCCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 610 GGCCACTACCGCGACTGCCAGAGTCTGGGCGCGCCTCCGCTCGACGGCTACCCGTTGCCC 669 Qy 661 ACGCCCGACACGTCCCCGCTGGACGGCGTGGACCCCGACCCGGCTTTCTTCGCCGCCCCG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 670 ACGCCCGACACGTCCCCGCTGGACGGCGTGGACCCCGACCCGGCTTTCTTCGCCGCCCCG 729 Qy 721 ATGCCCGGGGACTGCCCGGCGGCCGGCACCTACAGCTACGCGCAGGTCTCGGACTACGCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 730 ATGCCCGGGGACTGCCCGGCGGCCGGCACCTACAGCTACGCGCAGGTCTCGGACTACGCT 789 Qy 781 GGCCCCCCGGAGCCTCCCGCCGGTCCCATGCACCCCCGACTCGGCCCAGAGCCCGCGGGT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 790 GGCCCCCCGGAGCCTCCCGCCGGTCCCATGCACCCCCGACTCGGCCCAGAGCCCGCGGGT 849 Qy 841 CCCTCGATTCCGGGCCTCCTGGCGCCACCCAGCGCCCTTCACGTGTACTACGGCGCGATG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 850 CCCTCGATTCCGGGCCTCCTGGCGCCACCCAGCGCCCTTCACGTGTACTACGGCGCGATG 909 Qy 901 GGCTCGCCCGGGGCGGGCGGCGGGCGCGGCTTCCAGATGCAGCCGCAACACCAGCACCAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 910 GGCTCGCCCGGGGCGGGCGGCGGGCGCGGCTTCCAGATGCAGCCGCAACACCAGCACCAG 969 Qy 961 CACCAGCACCAGCACCACCCCCCGGGCCCCGGACAGCCGTCGCCCCCTCCGGAGGCACTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 970 CACCAGCACCAGCACCACCCCCCGGGCCCCGGACAGCCGTCGCCCCCTCCGGAGGCACTG 1029 Qy 1021 CCCTGCCGGGACGGCACGGACCCCAGTCAGCCCGCCGAGCTCCTCGGGGAGGTGGACCGC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1030 CCCTGCCGGGACGGCACGGACCCCAGTCAGCCCGCCGAGCTCCTCGGGGAGGTGGACCGC 1089 Qy 1081 ACGGAATTTGAACAGTATCTGCACTTCGTGTGCAAGCCTGAGATGGGCCTCCCCTACCAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1090 ACGGAATTTGAACAGTATCTGCACTTCGTGTGCAAGCCTGAGATGGGCCTCCCCTACCAG 1149 Qy 1141 GGGCATGACTCCGGTGTGAATCTCCCCGACAGCCACGGGGCCATTTCCTCGGTGGTGTCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1150 GGGCATGACTCCGGTGTGAATCTCCCCGACAGCCACGGGGCCATTTCCTCGGTGGTGTCC 1209 Qy 1201 GACGCCAGCTCCGCGGTATAT 1221 ||||||||||||||||||||| Db 1210 GACGCCAGCTCCGCGGTATAT 1230 It would have been prima facie obvious to one of ordinary skill in the art before the effective time of filing in making the stem cell population taught by Guye to select the transgene sequence comprising instant SEQ ID NO: 58 as taught by AB464248. One of ordinary skill in the art would be motivated to because Guye teaches using an inducible SOX17 transgene in human stem cells to induce the formation of human hemogenic endothelium cells for purification (col. 5, line 30 to col. 6, line 36; col. 6, lines 48-60; col. 12, lines 23-35; col. 15, lines 36-40) and AB464248 provides the specific human SOX 17 gene sequence for use in the method of Guye. Thus, the claimed invention as a whole is prima facie obvious in the absence of evidence to the contrary. Claims 16-20 are rejected under 35 U.S.C. 103 as being unpatentable over Guye in view of AB464248 (GenBank AB464248; submitted 2008) and as evidenced by Jung (Jung et al., Blood 134: 2476 (2019)) as applied above, and further in view of Park1 (Park et al., Curr Protoc Stem Cell Biol 47: e63 (2018)). Regarding claim 19, the combination of Guye, Jung, and AB464248 does not teach a vector comprising instant SEQ ID NO: 1. However Park1 teaches using a PiggyBac transposon vector (PTRE-P2A-Venus-rPEF1α-Zeo vector) (Fig. 1A) for inducible expression of a transgene in a human cell, e.g., a hPSC, under the control of tetracycline via the upstream TREtight promoter (Abstract; pg. 3, 2nd para.). Park1 teaches that this vector format can be used for robust generation of stable hPSC lines for expression of large transgenes that are conditionally expressed during cell differentiation and avoid silencing during differentiation (Abstract; pg. 2, 2nd para.). Within instant SEQ ID NO: 1, position 330 to 1,571 is instant SEQ ID NO: 58, which is discussed above regarding claim 20, and the rest of instant SEQ ID NO: 1 is from PiggyBac transposon vectors known in the art, such as PTRE-P2A-Venus-rPEF1α-Zeo taught by Park1. It would have been prima facie obvious to one of ordinary skill in the art before the effective time of filing in making the stem cell population taught by the combination of Guye and AB464248 wherein the SOX17 transgene is inserted into PTRE-P2A-Venus-rPEF1α-Zeo vector as taught by Park1 to arrive at a vector comprising instant SEQ ID NO: 1. One of ordinary skill in the art would be motivated to use this vector because Park1 teaches methods of making hPSC populations comprising inducible transgenes using the PTRE-P2A-Venus-rPEF1α-Zeo vector for permanent, stable, and inducible transgene expression control during cell differentiation and maturation. Thus, the claimed invention as a whole is prima facie obvious in the absence of evidence to the contrary. Response to arguments Applicant’s arguments in the response filed 11/24/25 have been fully considered but not found persuasive. Applicant’s response filed 11/24/25 established at pg. 6 in combination with Rule 130(b) Declarations of Sluvkin and Jung that Jung is not available as prior art under 35 USC 102(b)(1)(A). Applicant traverses the previous 103 rejection, in part, by arguing a reliance on impermissible hindsight and ex post reasoning, especially regarding a reasonable expectation of success. In response to applicant's argument, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Furthermore, there is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the time of invention, but only that the subject matter is in fact inherent in the prior art reference. Schering Corp. v. Geneva Pharm. Inc., 339 F.3d 1373, 1377, 67 USPQ2d 1664, 1668 (Fed. Cir. 2003). Thus, a reference relied on to show evidence of inherency need not qualify as prior art and the date of such a reference need not be a “prior art” date. This is how Jung is relied upon to show the teachings in the prior art necessarily teach CDX2-expression by the cell population. As claim 14 is in the format of a product-by-process, patentability is based on the claimed product (Abbott v. Sandoz, 566 F.3d 1282 (Fed. Cir. 2009)), which encompasses any human cell population comprising at least 90% DLL4+ CXC4+ CDX2-expressing AHE cells made from hPSCs using an induced SOX17 transgene expression. Thus, claim 14 has no requirement in the claimed product that any expression is enhanced/upregulated for any of HOXA5, HOXA7, HOXA9, HOXA10, and HOXA11 or for expression of EFNB2, NOTCH4, and/or HEY1, as DLL4 and CXCR4 expression is required. Therefore, it is noted that the features upon which applicant relies in the arguments are not recited as limitations in the rejected claim. Furthermore as indicated by Applicant’s arguments, it appears the expression/upregulation of these genes necessarily and naturally flows from induction of SOX17 transgene expression and Guye clearly teaches overexpressing a SOX17 transgene in human pluripotent stem cells sufficiently to produce hemogenic endothelial cells (see e.g., col. 6, lines 30-40). Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ERIC J ROGERS whose telephone number is (571)272-8338. The examiner can normally be reached Monday - Friday 9:00-6:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached on (571) 272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ERIC J ROGERS/Examiner, Art Unit 1638 /KEVIN K HILL/Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

Show 5 earlier events
Aug 01, 2024
Response after Non-Final Action
Nov 26, 2024
Non-Final Rejection mailed — §102, §103, §112
Apr 28, 2025
Response Filed
May 23, 2025
Final Rejection mailed — §102, §103, §112
Nov 24, 2025
Request for Continued Examination
Nov 24, 2025
Response after Non-Final Action
Nov 25, 2025
Response after Non-Final Action
Apr 20, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12623003
Three-Dimensional Microporous Scaffold Device for Cell Culture
5y 5m to grant Granted May 12, 2026
Patent 12607620
DEVICES AND SYSTEMS FOR MIMICKING HEART FUNCTION
3y 0m to grant Granted Apr 21, 2026
Patent 12577529
METHODS FOR PRODUCING NEURAL CELLS
3y 9m to grant Granted Mar 17, 2026
Patent 12558458
Targeted in Situ Therapeutic Delivery of Secreted Factors from Stem Cells for Treatment of Damaged Tissue
6y 3m to grant Granted Feb 24, 2026
Patent 12545870
THREE-DIMENSIONAL MUSCLE TISSUE AND PRODUCTION METHOD THEREFOR
4y 5m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
59%
Grant Probability
88%
With Interview (+28.6%)
3y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 98 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month