DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application is being examined under the pre-AIA first to invent provisions.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the prior art rejection set forth below will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
Continued Examination Under 37 CFR 1.114
2. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on January 7, 2026 has been entered.
Claims 1-13 are pending. Claims 1-4 are under examination. Claims 5-13 remain withdrawn as being drawn to a non-elected invention.
Response to Arguments
3. Applicant’s arguments filed on January 7, 2026 have been fully considered.
Priority
Applicant argues that, in view of the claim amendments, claims 1-4 should have an effective filing date of February 1, 2012 (Remarks, page 7).
This argument was persuasive in part. As discussed below in the “Priority” section, claims 1, 2, and 4 have an effective filing date of February 1, 2012. Claim 3, though, contains new matter for the reasons set forth below. Accordingly, the effective filing date for claim 3 is the filing date of the instant application (i.e., June 28, 2021).
Specification Objections
Applicant argues that the objections made previously should be withdrawn in view of the amendment to the specification filed with the response of January 7, 2026 (Remarks, page 6).
This argument was persuasive. The previously made objections have been withdrawn.
Rejection of claims 1-4 and 14 under 35 U.S.C. 101
Applicant argues on pages 9-15 of the Remarks that the rejection should be withdrawn for the following reasons:
I. Claims are not directed to a patent-ineligible concept (Remarks, page 9);
II. Claims are not mere observation or detection of a natural phenomenon (Remarks, pages 9-10);
III. CHO cell DNA functions as a competitor rather than as a template, which is not conventional (Remarks, pages 10 and 13);
IV. Experimental evidence demonstrates markedly different characteristics, which rebuts the argument in the rejection that the kit components simply perform their naturally occurring functions (Remarks, pages 10-12);
V. Claimed kit is not analogous to “placing DNA in a test tube” (Remarks, page 12);
VI. Claims recite an improved technological process (Remarks, pages 13-14); and
VII. Claims do not preempt all uses of CHO cell DNA (Remarks, pages 14-15).
Response:
Applicant’s arguments have been fully considered, but they were not persuasive for the following reasons.
Argument I: This argument was not persuasive because, as discussed in the rejection, the requirement to provide the different judicial exceptions recited in the claims (i.e., the primers, DNA polymerase, and CHO cell DNA) in a kit is nothing more than insignificant extra-solution activity. See also MPEP 2106.05(g). Therefore, the claims are, in fact, directed to ineligible subject matter.
It is also noted that Applicant’s quotation from CellzDirect on page 9 of the Remarks relates to methods rather than products. In this case, if the instant claims were drawn to an amplification method requiring the use of the claimed Mollicute-specific primers and CHO cell DNA, said claims would almost certainly be directed to eligible subject matter.
Argument II: This argument was not persuasive because, as with Argument I above, the instant claims are drawn to a kit comprising a plurality of judicial exceptions rather than a method in which judicial exceptions are used in a novel way. The claimed kits do not require the judicial exceptions to have any structural features that are markedly different from their naturally occurring counterparts, nor are any functions other than naturally occurring functions required, at least because the amount of CHO cell DNA in the kit is not fixed and depends on a variable object (sample volume). This causes the claims to encompass kits that do not contain large amounts of CHO cell DNA. And, even if the CHO cell DNA was somehow required by the claims to function as a competitor rather than a template, it is not clear from the evidence (e.g., Examples 6, 9, and 10 of the application) that the CHO cell DNA is not still merely performing its naturally occurring function of hybridizing to complementary nucleic acids. That is, the CHO cell DNA may function in an amplification reaction as a competitor rather than as a template, but it apparently does so by performing its naturally occurring function of hybridizing to complementary nucleic acids. Thus, the claims are, in fact, directed to nothing more than a collection of judicial exceptions provided together.
Argument III: This argument was not persuasive because the instant claims are drawn to a kit rather than a method. The kit only requires the presence of the recited components and does not require them to be used in any particular way or even provided as a single composition in the kit. As well, since the amount of CHO cell DNA in the kit depends on an object that is variable (i.e., the sample volume), the claimed kits do not even require a large amount of CHO cell DNA to be present. Put another way, there is nothing in the current claim language that requires CHO cell DNA to function as a competitor rather than a template nucleic acid. And, even if the CHO cell DNA was required by the claims to function as a competitor rather than a template, it is not clear from the evidence (e.g., Examples 6, 9, and 10 of the application) that the CHO cell DNA is not still merely performing its naturally occurring function of hybridizing to complementary nucleic acids. That is, the CHO cell DNA may function in an amplification reaction as a competitor rather than as a template, but it apparently does so by performing its naturally occurring function of hybridizing to complementary nucleic acids.
Argument IV: This argument was not persuasive for two reasons. First, the claims do not actually require the kits to contain large amounts of CHO cell DNA since the amount of CHO cell DNA in the kit depends on an object that is variable (i.e., the sample volume), nor do they require the CHO cell DNA to be provided in a composition with primers or used as a competitor nucleic acid. Second, the evidence contained in the cited working examples does not establish that CHO cell DNA is not still simply performing its naturally occurring function of hybridizing to complementary DNA. CHO cell DNA provided better artifact suppression than calf thymus DNA, but it is not clear that this did not simply result from the CHO cell DNA being more homologous to background nucleic acids in the sample compared to calf thymus DNA.
Argument V: This argument was not persuasive because, as discussed above, the claims do not actually require the “specific functional combination” Applicant discusses on page 12 of the Remarks. Instead, the claims do not require providing the CHO cell DNA in a composition together with Mollicute-specific primers and encompass kits containing separately provided reagents and also containing smaller amounts of CHO cell DNA since the amount of CHO cell DNA depends on an object that is variable (the sample volume). And, as also discussed above, it is not clear that even larger amounts of CHO cell DNA perform a function other than hybridizing to complementary nucleic acids.
Argument VI: This argument was not persuasive because the instant claims are drawn to a kit and not a method. As discussed in greater detail above, the claims do not require providing a large amount of CHO cell DNA in a composition together with Mollicute-specific primers and more broadly encompass kits containing separately provided reagents and also containing smaller amounts of CHO cell DNA since the amount of CHO cell DNA depends on an object that is variable (the sample volume). And, as also discussed above, it is not clear that even larger amounts of CHO cell DNA perform a function other than hybridizing to complementary nucleic acids.
Argument VII: This argument was not persuasive because the rejection does not allege that the claims attempt to “lock up” all possible uses of CHO cell DNA. The examiner agrees that the claims do not do this. Instead, the rejection argues that the instant claims are drawn to a collection of judicial exceptions without significantly more.
Since Applicant’s arguments were not persuasive, the rejection has been maintained with modifications to address the amendments to claim 1 and the cancellation of claim 14.
Rejection of claims 1-4 and 14 under pre-AIA 35 U.S.C. 112, first paragraph
Applicant argues that the rejection should be withdrawn in view of the amendments to claim 1 (Remarks, page 7).
This argument was persuasive. The rejection has been withdrawn.
Rejection of claims 2 and 14 under pre-AIA 35 U.S.C. 112, second paragraph
Applicant argues that the rejection concerning claim 2 should be withdrawn in view of the amendments to that claim (Remarks, pages 7-8). Applicant also argues that the rejection of claim 14 is moot in view of the cancellation of that claim (Remarks, page 8).
These arguments were persuasive. The rejections have been withdrawn.
Rejection of claims 1-4 and 14 under pre-AIA 35 U.S.C. 103(a) as being unpatentable over MycoTool in view of Kim and further in view of Arieli
Since claim 14 has been canceled, the rejection currently applies to claims 1-4. The rejection has also been modified somewhat to account for the claim amendments.
Applicant argues on pages 16-22 of the Remarks filed on January 7, 2026 that the rejection should be withdrawn. The arguments in sections II.A – II.F of the Remarks pertain to the modified rejection. They have been fully considered and are discussed below. The arguments in section II.G of the Remarks have also been considered, but they are moot in view of the amendments to claim 1.
Argument:
Applicant first argues that the rejection should be withdrawn because the prior art and the claimed invention use CHO cell DNA to address “fundamentally different technical problems” (Remarks, pages 16-17). More specifically, Applicant argues in this portion of the response that the rejection proposes including CHO cell DNA in the MycoTool kit to function as a positive control, whereas the claimed invention uses CHO cell DNA as a competitor that reduces nonspecific amplification when used with Mollicute-specific primers (i.e., SEQ ID NOs: 1 and 2). Therefore, Applicant argues, the prior art fails to provide a rationale to use CHO cell DNA for the purpose addressed by the application and also fails to teach or suggest providing the required amount of CHO cell DNA in the MycoTool kit.
Response:
This argument was not persuasive for the following reasons. First, the fact that the inventor has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985). In this case, an alternate reason for making the claimed kits, including providing CHO cell DNA in the kit as a concentration within the claimed range, has been provided in the modified rejection, and no persuasive evidence of unexpected results or secondary considerations has been presented.
Argument:
Applicant also argues that the prior art fails to teach or suggest the claimed functional limitation (i.e., “said purified DNA from CHO cells reduces unspecific amplification” in amended claim 1) or the claimed concentration range (i.e., as recited in amended claim 1) (Remarks, pages 17-19). Applicant also argues in this portion of the response that the rejection relies on an improper hindsight rationale (Remarks, page 18).
Response:
These arguments were not persuasive for the following reasons.
First, the prior art need not discuss the functional limitation in amended claim 1 provided that an appropriate reason for providing CHO cell DNA in the kit at a concentration within the claimed range exists. In other words, if the prior art suggests a kit containing CHO cell DNA at a concentration within the claimed range, the functional requirement of reducing nonspecific amplification is necessarily met. As discussed in MPEP 2112.01, “If the composition is physically the same, it must have the same properties.” In this case, as discussed below, the concentration range recited in amended claim 1 is indefinite because it depends on an object that is variable (i.e., sample volume), but the modified rejection argues that it would have been obvious to provide the reagents suggested by the references in a kit at any desired concentration, including concentrations within the claimed range.
Second, as noted above and discussed in greater detail below, the concentration range recited in amended claim 1 is indefinite because it depends on an object that is variable (i.e., sample volume), but the modified rejection argues that it would have been obvious to provide the reagents suggested by the references in a kit at any desired concentration, including concentrations within the claimed range per MPEP 2144.05 II. As well, as discussed below, no persuasive evidence of unexpected results has been provided concerning the claimed concentrations. And, it is additionally noted that the claims do not actually require the high concentrations discussed by Applicant on pages 18-19 of the Remarks. Since the amount of CHO cell DNA in the kit depends on the sample volume, which is entirely variable, the claim encompasses much smaller amounts of DNA in the kit.
Lastly, in response to Applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In this case, the rejection does not improperly rely on Applicant’s disclosure, and instead, provides another reason for arriving at the claimed kits.
Argument:
Applicant also argues that the claimed invention is associated with unexpected results (Remarks, pages 19-20). Here, Applicant points to Examples 4, 6, 9, and 10 in the specification to support this argument.
Response:
This argument was not persuasive. First, as noted above, the claims do not actually require the kits to contain high concentrations of CHO cell DNA. Since the amount of CHO cell DNA in the kit depends on the sample volume, which is entirely variable since no sample is required to be present in the kit, the claims encompass much smaller amounts of CHO cell DNA in the kit. As a result, the feature alleged to be associated with unexpected results is not currently required by the claims.
Second, the results reported in the cited examples are not commensurate in scope with the claimed invention. As noted in MPEP 716.02(d), this is required to overcome a prima facie case of obviousness. In this case, the amount of CHO cell DNA added per milliliter of sample in Example 4 or calf thymus DNA in Example 10 is outside of the range recited in claim 1 (see paras. 96 and 127, respectively, of the originally filed specification). Each of Examples 5, 6, and 9 reports CHO cell DNA or calf thymus DNA concentrations within the claimed range, but these examples are also not commensurate in scope with the claimed invention because the claimed primers are more broadly claimed relative to the examples, encompassing mismatches and also longer primers. It is not clear that the same results would be obtained over the full scope of the primers encompassed by the claims.
Argument:
Applicant also argues that a reasonable expectation of success is lacking (Remarks, page 20). More specifically, Applicant argues on page 20 of the Remarks that the ordinary artisan would have lacked a reasonable expectation of success in using CHO cell DNA to reduce nonspecific amplification since Examples 9 and 10 of the application demonstrate that CHO cell DNA works for this purpose, whereas another type of DNA (calf thymus DNA) does not.
Response:
This argument was not persuasive because, as discussed above, the rejection sets forth a different reason for including CHO cell DNA in the MycoTool kit.
Argument:
Applicant also argues that “the combined kit components exhibit properties not present in the individual components” (Remarks, pages 20-21). More specifically, Applicant argues that the claimed kit is “a specific functional combination that exhibits properties not present in the individual components considered separately” (Remarks, page 20). This, Applicant argues, is because the CHO cell DNA suppresses artifacts when combined with the Mollicute-specific primers of SEQ ID NOs: 1 and 2 (Remarks, page 20). Applicant points to Examples 4, 9, and 10 to support this argument (Remarks, pages 20-21).
Response:
This argument was not persuasive. First, as discussed above, the claims do not actually require large amounts of CHO cell DNA. Second, the claims do not require providing the primers and CHO cell DNA in a mixture, nor are the claims drawn to a method that comprises amplification in the presence of the claimed primers and CHO cell DNA. Instead, the claims are more broadly drawn to a kit that need not contain a large amount of CHO cell DNA and may also provide the primers and CHO cell DNA separate from one another. Therefore, all that is required for a proper case of obviousness to exist is a reason to provide the different components in a kit format, which need not contain mixtures of primers and CHO cell DNA.
Since Applicant’s arguments were not persuasive, the rejection has been maintained with modifications to address the amendments to claim 1.
Priority
4. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 120, 121, or 365(c) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
In this case, the disclosure of PCT/EP2010/004655 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
More specifically, the ‘655 application fails to provide support for a kit containing a thermostable DNA polymerase as recited in independent claim 1 of the instant application. Compositions disclosed in the ‘655 application may include such a polymerase (see, e.g., claim 11), but there is nothing to indicate that including a polymerase, thermostable or otherwise, in the kit was contemplated.
The ‘655 application also fails to provide support for including primers in the kit that contain up to three variations relative to the primers set forth in SEQ ID NOs: 1 and 2. This is also recited in claim 1 of the instant application. The ‘655 application states that the kit may include “a first primer according to SEQ ID NO: 1 and a second primer according to SEQ ID NO: 2” (see, e.g., page 5, lines 15-19; see also claim 13). As noted above, though, independent claim 1 encompasses variant primers, though, and there is nothing in the ‘655 application to indicate that these variant primers were contemplated.
Thus, the ‘655 application fails to provide support for the subject matter of the instant claim 1. Accordingly, the instant claims 1, 2, and 4 have an effective filing date of February 1, 2012, which is the filing date of prior-filed Application Serial No. 13/364,050.
Also, as discussed below, amended claim 3 contains new matter. Accordingly, the effective filing date for this claim is the filing date of the instant application (i.e., June 28, 2021).
Claim Rejections - 35 USC § 101
5. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-4 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception—specifically, a product of nature—without significantly more.
Claim 1
Claim 1 is drawn to a kit comprising a thermostable DNA polymerase. The kit also comprises the following components: (i) purified DNA that has been obtained from Chinese hamster ovary (CHO) cells and is free of prokaryotic DNA, (ii) a first synthetic primer having a nucleotide sequence with no more than three variations from the sequence of SEQ ID NO: 1, and (iii) a second synthetic primer having a nucleotide sequence with no more than three variations from the sequence of SEQ ID NO: 2.
Each of the components present in the kit of claim 1 is judicial exception (product of nature) for the following reasons.
First, thermostable DNA polymerases (e.g., Taq DNA polymerase or Pfu DNA polymerase) are found in nature, and there is nothing in the claim that requires the thermostable DNA polymerase in the kit to possess any structural or functional differences relative to the naturally occurring proteins. In other words, the thermostable DNA polymerase recited in the kit of claim 1 has no structural or functional differences relative to its naturally occurring counterparts. Thus, this component of the kit encompasses naturally occurring products.
Second, as to the CHO cell DNA, CHO cells are naturally occurring cells, and there is nothing in the claim that requires the purified DNA to differ in any way, structurally or functionally, from naturally occurring CHO cell DNA. Thus, this component in the kit also encompasses naturally occurring products.
Third, as to the primers, it is not clear that these oligonucleotides are found in nature, but these nucleic acids are, nevertheless, a judicial exception because they are derived from naturally occurring nucleic acids and possess no structural or functional differences relative to their naturally occurring counterpart. For example, the naturally occurring nucleic acids disclosed in GenBank Accession Numbers MW725075 and LR605549, the relevant portions of which are shown below, contain a stretch that includes the instant SEQ ID NO: 1 or SEQ ID NO: 2. The nucleic acids recited in claim 1 are also not required to include a label (e.g., a radioisotope) or a non-naturally occurring nucleotide(s), nor do they have any functions not possessed by naturally occurring nucleic acids.
As well, MPEP 2106.04(b)(I) identifies isolated nucleic acids having no structural or functional differences from naturally occurring nucleic acids as an example of a patent-ineligible natural product.
Further, as discussed in MPEP 2106.04(b)(II), “[P]roduct of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart.” See Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244. In this case, the nucleic acids recited in claim 1 need not possess any structural differences relative to their naturally occurring counterpart, which is the single-stranded nucleic acid segment of the same sequence found in the naturally occurring nucleic acid.1 The claimed nucleic acids also have no functional differences relative to their naturally occurring counterpart since both molecules hybridize to complementary nucleic acids.
Thus, claim 1 clearly recites a plurality of judicial exceptions since each element in the kit encompasses, or is not materially different from, a naturally occurring product. The judicial exceptions are not integrated into a practical application because providing them in a kit is nothing more than token extra-solution activity and an attempt to link the judicial exception to a particular technological environment. Claim 1 also does not include additional elements that are sufficient to amount to significantly more than the judicial exception because the kit need not have any components other than the recited nucleic acids and polymerase.
Lastly, the requirement in the last clause of claim 1, which states that the “purified DNA from CHO cells reduces unspecific amplification,” does not render the claim patent eligible for the following reasons. First, the CHO cell DNA in the kit performs the same function that it does in nature (i.e., hybridization to complementary nucleic acids). Second, it is acknowledged that the specification teaches that adding particular amounts of purified total DNA from CHO cells to a sample decreases undesirable nonspecific amplification, whereas calf thymus DNA did not show the same effect (see, e.g., Examples 6, 9, and 10 on pages 26-28 and 31-34 of the originally filed specification). These examples indicate that CHO cell DNA may function in a manner in addition to its naturally occurring function of binding to complementary nucleic acids, but this is not entirely clear from the examples. That is, it is not clear that CHO cell DNA is simply more homologous to the nucleic acids found in the samples used than calf thymus DNA. If this is the case, then the CHO cell DNA would simply be performing its naturally occurring function. As well, claim 1 does not require the kit to contain a mixture containing a large amount of CHO cell DNA, primers, and a DNA polymerase. Instead, claim 1 only recites an amount of CHO cell DNA that is defined relative to an object that is variable (i.e., the sample volume), and the CHO cell DNA need not be provided in a composition together with the primers and other reaction components.
Thus, amended claim 1 is directed to a judicial exception without significantly more, and it is rejected under 35 U.S.C. 101.
Claims 2-4
Each of claims 2-4 depends from claim 1. Claims 2-4 further require the kit to contain the following components: (i) a lysis reagent (claim 2); (ii) a detection reagent comprising an oligonucleotide probe (claim 3); and (iii) total DNA purified from CHO cells (claim 4).
The additional elements recited in claims 2-4 and 14 are also judicial exceptions.
As to claim 2, the term “lysis reagent” includes naturally occurring substances (e.g., water, sodium hydroxide, and proteases). There is nothing in the claim that requires the lysis reagent to have any structural or functional properties that differ from the naturally occurring counterparts. Thus, this claim encompasses naturally occurring products.
As to claim 3, the oligonucleotide probe is not markedly different from a naturally occurring product for the same reasons set forth above with respect to the two primers in the kit of claim 1. Thus, claim 3 also encompasses naturally occurring products.
As to claim 4, the purified total DNA from CHO cells is not required to have any structural or functional differences compared to the naturally occurring CHO cell DNA. Accordingly, it is not markedly different from naturally occurring CHO cell DNA for the reasons set forth above with respect to the CHO cell DNA in claim 1.
In view of the foregoing, claims 2-4 also recite a plurality of judicial exceptions since each additional element required by these claims encompasses, or is not materially different from, a naturally occurring product. These additional judicial exceptions are not integrated into a practical application because providing them in a kit is nothing more than token extra-solution activity and an attempt to link the judicial exception to a particular technological environment. Claims 2-4 also do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the kit need not have any components other than the recited additional components. Thus, claims 2-4 are also directed to a judicial exception without significantly more, and they are also rejected under 35 U.S.C. 101.
ALIGNMENTS BETWEEN SEQ ID NOs: 1 & 2 AND NATURALLY OCCURRING NUCLEIC ACIDS
SEQ ID NO: 1
MW725075
LOCUS MW725075 194 bp DNA linear ENV 15-MAR-2021
DEFINITION Mycoplasmopsis bovis isolate LBV_50 16S ribosomal RNA gene, partial
sequence.
ACCESSION MW725075
VERSION MW725075.1
KEYWORDS ENV.
SOURCE Mycoplasmopsis bovis (Mycoplasma bovis)
ORGANISM Mycoplasmopsis bovis
Bacteria; Tenericutes; Mollicutes; Mycoplasmataceae;
Mycoplasmopsis.
REFERENCE 1 (bases 1 to 194)
AUTHORS De Carli,S., Dias,M.E., Silva,M.E., Brayer,G.M. and Siqueira,F.M.
TITLE Molecular detection of the agents responsible for poor reproductive
performance in bulls
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 194)
AUTHORS De Carli,S., Dias,M.E., Silva,M.E., Brayer,G.M. and Siqueira,F.M.
TITLE Direct Submission
JOURNAL Submitted (10-MAR-2021) Laboratorio de Bacteriologia Veterinaria,
Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves
9090, Porto Alegre, RS 91540000, Brazil
COMMENT ##Assembly-Data-START##
Sequencing Technology :: Sanger dideoxy sequencing
##Assembly-Data-END##
FEATURES Location/Qualifiers
source 1..194
/organism="Mycoplasmopsis bovis"
/mol_type="genomic DNA"
/isolate="LBV_50"
/isolation_source="Prepuce"
/host="Bull"
/db_xref="taxon:28903"
/environmental_sample
/note="amplified with species-specific primers"
rRNA <1..>194
/product="16S ribosomal RNA
Query Match 100.0%; Score 21; Length 194;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 1 1 GGCGAATGGGTGAGTAACACG 21
|||||||||||||||||||||
Db 77 GGCGAATGGGTGAGTAACACG 97
SEQ ID NO: 2
LR605549
LOCUS LR605549 288 bp DNA linear ENV 25-JAN-2021
DEFINITION uncultured Mycoplasma sp. partial 16S rRNA gene.
ACCESSION LR605549
VERSION LR605549.1
DBLINK BioProject: PRJEB23299
KEYWORDS ENV.
SOURCE uncultured Mycoplasma sp.
ORGANISM uncultured Mycoplasma sp.
Bacteria; Tenericutes; Mollicutes; Mycoplasmataceae; Mycoplasma;
environmental samples.
REFERENCE 1
AUTHORS Yao,H.
TITLE Direct Submission
JOURNAL Submitted (28-JUN-2019) INSTITUTE OF MICROBIOLOGY CHINESE ACADEMY
OF SCIEN, No.3, 1st Beichen West Road, Chaoyang District, Beijing,
China
FEATURES Location/Qualifiers
source 1..288
/organism="uncultured Mycoplasma sp."
/mol_type="genomic DNA"
/isolation_source="Mangrove leaves"
/db_xref="taxon:167967"
/environmental_sample
gene <1..>288
/gene="16S rRNA"
rRNA <1..>288
/gene="16S rRNA"
/product="16S ribosomal RNA
Query Match 100.0%; Score 22; Length 288;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 2 1 CGGATAACGCTTGCGACCTATG 22
||||||||||||||||||||||
Db 246 CGGATAACGCTTGCGACCTATG 267
Claim Rejections - 35 USC § 112
6. The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 3 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 3 has been amended to recite that the kit additionally contains “a detection reagent comprising an oligonucleotide probe.”
Applicant’s response of January 7, 2026 does not identify particular portions of the original disclosure that provide support for this subject matter.
The original disclosure has been reviewed, but support was not found for the full scope of amended claim 3, which encompasses (i) detection reagents consisting of an oligonucleotide probe and also (ii) detection reagents comprising an oligonucleotide probe directly or indirectly attached to other components. The original disclosure (see, e.g., original claim 3) only provides support for (i). Accordingly, claim 3 contains new matter.
Claim Rejections - 35 USC § 112, second paragraph
7. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is indefinite because it makes reference to an object that is variable. As noted in MPEP 2173.05(b) II, this can render a claim indefinite. In this case, the amount of purified CHO cell DNA provided in the kit is apparently variable since it is defined in terms of the sample volume, which will necessarily vary between different users of the kit.
Claim 1 is also indefinite because the claim scope with respect to the first and second primer is not entirely clear. The claim recites “a first synthetic nucleotide primer having a nucleic acid sequence with less than or equal to three nucleic acid variations from the nucleic acid sequence of SEQ ID NO: 1” and “a second synthetic nucleotide primer having a nucleic acid sequence with less than or equal to three nucleic acid variations from the nucleic acid sequence of SEQ ID NO: 2” (emphasis added).
As discussed in MPEP 2111.03 IV, the transitional phrase “having” can be open or closed depending on the specification. That is, this transitional phrase must be interpreted in light of the specification to determine whether it is an open or closed transitional phrase. In this case, though, the specification only uses the exact language in the claim to describe the primers (see the amendment dated April 12, 2024), which does not provide an indication as to whether open or closed language is intended. It is also noted that the language in the claims concerning nucleotide variations does not clearly preclude much longer primers that comprise, for example, the exact nucleotide sequence of SEQ ID NO: 1. As a result, it cannot be clearly determined whether open or closed language is intended for the primers. Accordingly, claim 1 is indefinite.
Claims 2-4 are also indefinite since they depend from claim 1 and do not correct its indefiniteness issue.
Claim Rejections - 35 USC § 103
8. The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
9. Claims 1-4 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over the MycoTOOL PCR Mycoplasma Detection Kit from ROCHE (Cat. No. 05 200 709 001; published March 2008 and hereafter “MycoTool”) in view of Kim et al. (Journal of Dairy Science 2001; 84: 74-83) and further in view of Arieli et al. (US 2010/0196904 A1).
The claims are drawn to a kit for detecting Mollicute nucleic acid in one of the following sample types: (i) amniotic fluid of embryonated cells, (ii) a eukaryotic cell culture supernatant, and (iii) a eukaryotic cell culture suspension. The kit comprises a thermostable DNA polymerase, nucleic acid primers, and purified DNA obtained from CHO cells.
Regarding claims 1, 2, and 4, MycoTool discloses a kit for detecting the presence of a specific type of Mollicute contaminant—specifically, mycoplasmas—in mammalian cell cultures (page 1, “What this Product Does” and “Application” sections). The kit includes the following components:
(i) a primer mix for mycoplasma (page 1, vial 3 in subkit 2);
(ii) a lysis reagent (page 1, proteinase K and lysis buffer in subkit 1);
(iii) detection dye (page 1, subkit 2); and
(v) a positive control, which is GAPDH (page 1, subkit 2 and the “Application” section).
Further regarding claim 1, as evidenced by the specification of the instant application at page 20, para. [0080], the mycoplasma-specific primers in the MycoTool kit are identical to the instant SEQ ID NOs: 1 and 2).
The MycoTool kit does not include all of the required elements.
First, as to claim 1, the reference does not clearly teach including a thermostable DNA polymerase in the kit. This may be the case since the MycoTool protocol does not include a separate polymerase addition step, nor is a polymerase included in the “Additional Equipment and Reagents Required” list on page 2, but it is not entirely clear that the required polymerase is, in fact, included in the kit.
Second, also as to claim 1, MycoTool does not clearly teach that the positive control DNA is obtained from CHO cells and lacks prokaryotic DNA. As a result, MycoTool also fails to meet the requirement in claim 1 for the kit to contain purified DNA that has been obtained from CHO cells and is free of prokaryotic DNA.
Third, as to claim 3, MycoTool does not teach detection using a detection reagent comprising an oligonucleotide probe. The reference only teaches detection using a dye.
Fourth, as to claim 4, MycoTool does not teach that the positive control DNA is total DNA from CHO cells.
The teachings of Kim and Arieli, though, remedy these deficiencies in the MycoTool reference.
In particular, Kim describes the use of PCR to detect a target nucleic acid from S. aureus in bovine milk (abstract and page 75, col. 1). The PCRs of Kim use either Taq DNA polymerase or Tth polymerase, each of which is a thermostable DNA polymerase (p. 76, col. 2). As well, the PCRs of Kim use total DNA isolated from cells as a positive control (Fig. 1).
Arieli describes nucleic acid amplification compositions that may include primer pairs and a nucleic acid template, which may be a positive control nucleic acid (see, e.g., paras. 28 and 91-93 as well as Example 3 at paras. 146-148 and 151-152). Arieli teaches that such compositions may be provided in a kit (para. 28). Further regarding amended claim 3, Arieli also teaches that detection probes may be provided in a kit together with oligonucleotide primers, a DNA polymerase, dNTPs, a buffer solution, and magnesium chloride (para. 29). Arieli teaches that fluorescently labeled probes advantageously allow one to perform quantitative PCR (see, e.g., paras. 5, 29, 74, and 83).
It would have been prima facie obvious for one of ordinary skill in the art at the time of the invention to include a thermostable DNA polymerase (e.g., Taq or Tth as disclosed in Kim) in the MycoTool kit. As discussed above, it is not entirely clear that the MycoTool kit contains a thermostable DNA polymerase, but if it does not, including one in the kit would have been obvious since the ordinary artisan would have recognized that the PCRs to be conducted with this kit would be most effectively and efficiently conducted using such a polymerase. The ordinary artisan would have had a reasonable expectation of success since suitable polymerases were known in the art as evidenced by Kim.
It also would have been prima facie obvious to substitute a detection dye as taught in MycoTool and Kim with a fluorescently labeled oligonucleotide probe as taught in Arieli such that the resulting kit also contains a fluorescently labeled oligonucleotide probe. The ordinary artisan would have been motivated to do so to obtain the ability to use the kit for quantitative PCR as taught in Arieli and would have had a reasonable expectation of success in view of the guidance throughout Arieli concerning providing fluorescently labeled oligonucleotide probes in a kit together with other PCR reagents.
It also would have been prima facie obvious to include total DNA purified from CHO cells and lacking prokaryotic DNA in the MycoTool kit. As discussed above, the MycoTool kit contains positive control DNA, and the protocol indicates that the positive control primers target the GAPDH gene from CHO cells (page 1). It is not clear that the positive control DNA is obtained from CHO cells and is free of prokaryotic DNA, but this would have been obvious since Kim teaches that a useful positive control may be total DNA isolated from cells expected to contain the positive control nucleic acid (see, e.g., Fig. 1). In this case, the ordinary artisan would have recognized from the teachings of Kim that the positive control DNA in the MycoTool kit could either be a synthetic form of the target GAPDH nucleic acid or total DNA isolated from CHO cells, and, accordingly, would have been motivated to select either alternative with a reasonable expectation of success. The ordinary artisan also would have recognized that for DNA isolated from CHO cells to be useful as a positive control, it must be free of prokaryotic nucleic acids that may falsely amplify with the mycoplasma-specific primers in the kit. Accordingly, the inclusion of total DNA purified from CHO cells and free of prokaryotic DNA in the MycoTool kit would have been prima facie obvious.
Lastly, further regarding the requirement in the last clause of amended claim 1 concerning the amount of purified CHO cell DNA provided in the kit, as discussed in MPEP 2144.05 II, determining optimal amounts of reagents is prima facie obvious in the absence of unexpected results or secondary considerations. In this case, no persuasive evidence of unexpected results with respect to the claimed amounts of purified CHO cell DNA have been presented.
Thus, the kits of claims 1-4 are prima facie obvious in view of the combined teachings of the cited references.
Conclusion
10. No claims are currently allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Angela Bertagna whose telephone number is (571)272-8291. The examiner can normally be reached 8-5, M-F.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached on 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANGELA M. BERTAGNA/Primary Examiner, Art Unit 1637
1 MPEP 2106.04(c)(II)(A) discusses how to select an appropriate counterpart when a claimed nucleic acid is derived from a naturally occurring nucleic acid and states that the appropriate counterpart for a short nucleic acid derived from a naturally occurring nucleic acid (e.g., a primer) is the single-stranded region in the naturally occurring nucleic acid that is identical to the claimed nucleic acid.