DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from US Application No. 14/888,637 filed 11/02/2015, international Application PCT/US2014/036690 filed 05/02/2014, and Provisional Applications Nos. 61/818,777 filed 05/02/2013, 61/870,898 filed 08/28/2013, 61/901,989 filed 11/08/2013, is hereby acknowledged.
Election/Restrictions
Applicant’s election without traverse of Species 1, SEQ ID NO: 31,476 (claim 1), Species 2, colon cancer (claim 26), and Species 3, colon (claim 9) in the reply filed on 07/17/2025 is acknowledged.
Claims 5-8, 10-25 and 27-38 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/17/2025.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Application Status
This Application is a CON of US Application No. 14/888,637 (US Patent No. 11,293,064) filed 11/02/2015.
Preliminary amendments to claims filed 07/16/2021 are hereby acknowledged. Claims 3-18 are currently amended. Claims 1-38 are pending. Claims 5-8, 10-25 and 27-38 are withdrawn from consideration, therefore, claims 1-4, 9 and 26 are under consideration in this office action.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 11/10/2021 is hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, or listed on a submitted IDS, they have not been considered.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they include the following reference character(s) not mentioned in the description: Reference numbers in Figures 1A, 1B, and 2 are not explained in “Brief Description of Figures” in § [00022]-[00026]. Instead, the explanation for these reference characters have to be searched and read through in “Detailed description of the invention” in § [000100]-[000149].
Corrected drawing sheets in compliance with 37 CFR 1.121(d), or amendment to the specification to add the reference character(s) in the description in compliance with 37 CFR 1.121(b) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see § [00097] and [000247] for example). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The lengthy specification has not been checked to the extent necessary to determine the presence of all possible minor errors. Applicant’s cooperation is requested in correcting any errors of which applicant may become aware in the specification.
Claim Objections
Claim 1 is objected to because of inconsistencies: when considering the description in sequence listings, the sequences in SEQ ID NO: 1 to SEQ ID NO: 47,972 are listed as “DNA”. However, Claim 1 is drawn to miRNAs.
Claims 1 and 26 are objected to because of the following informalities:
Regarding claim 1, it recites “SEQ ID NO: 1to SEQ ID NO: 47,972”. There is no space between “1” and “to”. The claim should read “ SEQ ID NO: 1 to SEQ ID NO: 47,972”.
Regarding claim 26, it recites “wherein the condition of interest is cancer or the colon”. The claim should recite “ wherein the condition of interest is cancer of the colon”.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. §101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Non-Patent Eligible Subject Matter- Laws of Nature, Natural Phenomena, and Abstract Ideas.
Claims 1-4, 9 and 26 are rejected under 35 U.S.C. § 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea).
The claims are drawn to a method of determining whether a subject has, or is at risk of developing, or is at a given stage of a condition/disease, however, do not include additional elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exception.
Subject Matter Eligibility Test for Products and Processes
Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES
Claims 1-4 are directed to "A method of determining whether a subject has, or is at risk of developing, or is at a given stage of a condition afflicting a tissue of interest, comprising measuring in a biological sample from the tissue of interest expression level of one or more of the miRNAs, wherein the miRNAs comprise a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 47,972, wherein the alteration of the level of said one
or more miRNAs as compared to the level of the same one or more miRNA in a
reference sample is indicative of the subject either having, or being at risk of developing, or is at a given stage of the condition”.
Thus, the claims are directed to a statutory category (e.g., a process).
Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Abstract ideas have been identified by the courts by way of example, including
fundamental economic practices, certain methods of organizing human activities, an idea 'of itself,' and mathematical relationships/formulas. The claims recite two judicial exceptions: 1) a "mental" process of determining/interpreting data/information (e.g., "screening") which corresponds to "an abstraction"; an idea having no particular concrete or tangible form; and 2) the relationship/correlation between the "expression level of one or more of miRNAs”. The specific SEQ ID NOs introduces naturally occurring products and the expression of a gene is a natural principle. Also, the altered expression of said gene in a subject affected by a disease, is a natural phenomenon. Thus, the claimed invention describes judicial exceptions, which corresponds to "an abstraction"; an idea, having no particular concrete or tangible form.
Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the
Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. However, absent are any additional elements recited in the claim beyond the judicial exceptions which integrate the exception into a practical application of the exception.
The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. The claim limitations "wherein the alteration of the level of said one of more miRNAs as compared to the level of the same one or more miRNA in a reference sample is indicative of the subject having, or being at risk of developing, or is at a given stage of the condition” do not apply, rely on, or use integrate the judicial exception into a practical application. The above claim limitations are considered simply as the recitation of: 1) a "mental" process of determining/interpreting data/information; and 2) a comparison/correlation between the expression level in a reference tissue and a tissue affected with a condition/disease. There are no further/additional steps which applies either the identified judicial exceptions into a practical application. Thus, the claims do not provide for any element/step that integrates the law of nature into a practical application.
Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim. See M.P.E.P. 2106.05.
However, the additional elements, individually and in combination, do not amount to "significantly more". Under the Step 2B analysis, claims 1-4 provide no additional "physical" elements/steps. As explained with respect to Step2A Prong Two, the recitations "wherein the alteration of the level of said one of more miRNAs as compared to the level of the same one or more miRNA in a reference sample is indicative of the subject having, or being at risk of developing, or is at a given stage of the condition” do not require any particular application of the recited comparative determination and is at best the equivalent of merely adding the words "apply it" to the judicial exception. Mere instructions to apply an exception cannot provide an inventive concept. Absent from the claims is a limitation(s) that has more than a nominal relationship to the judicial exception. There is no limitation(s) that utilize the recited abstract idea in a manner that imposes a meaningful limit on it. There is no limitation(s) that integrates the recited judicial exception into a practical application, such that the claim is not directed to the judicial exception.
Thus, when viewed both individually and as an ordered combination, the claimed
elements/steps in addition to the identified judicial exceptions are found insufficient to supply an inventive concept because the elements/steps are considered conventional and specified at a high level of generality. The claim limitations do not transform the abstract idea that they recite into patent-eligible subject matter because "the claims simply instruct the practitioner to implement the abstract idea with routine, conventional activity."
Accordingly, the claims do not qualify as patent-eligible subject matter.
Claims 9 and 26 do not remedy the deficiencies of claim 1, therefore they are rejected as well.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. §112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. §112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-4 are rejected under 35 U.S.C. §112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the Invention:
Claim 1 recites “A method of determining whether a subject has, or is at risk of developing, or is at a given stage of a condition afflicting a tissue of interest, comprising measuring in a biological sample from the tissue of interest expression level of one or more of the miRNAs, wherein the miRNAs comprise a sequence selected from SEQ
ID NO: Ito SEQ ID NO: 47,972, wherein the alteration of the level of said one or more miRNAs as compared to the level of the same one or more miRNA in a reference sample is indicative of the subject either having, or being at risk of developing, or is at a given stage of the condition.”
It is therefore expected in the instant application a disclosure of a method using miRNAs as biomarkers to specifically indicate a disease or predisposition to a disease, any disease in any subject, at any time. It is claimed that the method is for determining whether the subject is at risk of developing a disease or condition, using differential expression of a set of miRNAs, using any biological sample from a tissue of interest. Therefore, the method could be used for determining the likelihood of anyone developing Alzheimer disease from a CSF sample right after birth of the subject, since “birth” is a “given stage”, a time during development in a subject. It is expected that the method could identify a subject at risk for cancer right after birth. It is expected that the method could identify a subject at risk for death, i.e. death is also “ a given stage of a condition”, from an infectious disease as soon as the disease is contracted, since time of contact is also “a given stage”.
It is expected in this disclosure a reduction to practice with examples of acceptable ratios obtained after detection of miRNA, as reference, in specific tissues and specific conditions. It is expected for each miRNA, a reference standard curve for each type of tissue and developmental stage. It is expected for this method of diagnosing a condition that is an infection, a system including normal cells infected with an infectious agent, and fluctuations of miRNAs according to a time-course during infection as measured compared to a reference. It is expected for a condition that is cancer, cancerous cells at different levels of transformation with a standard reference curve of housekeeping RNAs. It is expected for prognosis, exposure of cells to antineoplastic agents and effects on miRNAs expression compared to levels of miRNAs in absence of the agents; or it is expected to have subjects’ samples before and after treatment with examples of agents, with measures of claimed biomarkers.
It is also expected within the disclosure a connection in an example, a reduction to practice, status of subjects and a connection with a condition, an infection and/or cancer, or a risk for a condition, an infection and/or cancer.
The broadness of the claim leads to assumption that the subject can be anyone human or animal, from newborn to adult, from pregnant subjects with a risk of pregnancy-related disorders, to newborns at risk for behavior disorders in childhood, to adult subjects at risk for infection in a pandemic, and to animals at risk for infertility in captivity compared to wild counterparts.
Claim 2 is drawn to miRNAs isoforms used as biomarkers. It is expected in the disclosure the “naming” of such isoforms and disclosure of their levels compared to a reference in a specific tissue of interest.
Claims 3 and 4 are drawn to reference samples that can be either a representative of a normal condition or a “recognizable” stage of an abnormal condition.
The State of the Art:
Mouillet (Mouillet, J-F. et al. “Expression patterns of placental microRNAs”.
Birth Defects Res. A. Clin. Mol. Teratol. Vol, 91, No. 8 (2011), pp: 737-743) teaches the challenges of diagnosing placental diseases using miRNAs expression levels (see title and abstract). Mouillet reviews analyses of miRNAs expression in placental tissues of women suffering from preeclampsia (see abstract and page 4, “MicroRNA expression in placental injury” section). Mouillet teaches the attempts to use miRNAs as biomarkers of placental dysfunction (see page 5, “Placenta-derived circulating miRNAs as biomarkers of placental dysfunction” section). Mouillet specifically emphasizes the challenges in normalization of high-throughput data since SnoRNAs and snRNAs suggested as references exhibit high variability. Mouillet teaches that the assumption of uniformity of total mRNA amount per cell is likely false. Mouillet recommends caution when results based on high-throughput miRNA analyses are used to inform placental dysfunction (see page 7, “Challenges in normalization of high-throughput data” section ).
Neilson (Neilson, J.R. et al. “Dynamic regulation of miRNA expression
in ordered stages of cellular development”. Genes & Development, Vol. 21 (2007), pp: 578-589) teaches that miRNAs levels of expression can vary during cell development (see title and abstract). Indeed, profiling miRNA expressions during thymocyte development, Neilson teaches that the expression patterns change according to clones and stage of development, with specific enrichment of miRNAs correlating with depletion of transcripts harboring seed matches to these miRNAs (see page 579, left column, last paragraph and right column, first paragraph). Nielson, using total pool RNAs as reference, teaches different levels of miRNAs in thymocyte development with a signature pattern differing according to the specific type of T cell (see Figures 1 and 2).
Therefore, the teachings of Neilson would lead one with ordinary skills in the art to conclude that the adaptive immune response itself, in a given subject, depending on stage of development and stimulation will present with a different miRNAs expression pattern (see title and abstract).
Lenart (Lenart, M. et al. “miRNA regulation of NK cells antiviral response in
children with severe and/or recurrent Herpes Simplex virus infections”. Frontiers in Immunology, Vol. 11 (2021), p: 589866) teaches that miRNAs expression levels vary in patients that have Herpes Simplex Virus (HSV) infections (see title). Lenart teaches that NK (natural killer) cells, a type of T cells, isolated from infected patients had a substantially high levels of miR-27b, miR-199b, iR-369-3p and miR-491-3p when compared to healthy controls (see abstract). Lenart also teaches that miR-552 is downregulated in NK cells of infected subjects (see page 4, right column, “Results” section first paragraph).
Therefore, it is interpreted that a subject at risk for a condition such as cancer, presenting with an underlying inflammation or infection, can show with an already altered miRNAs pattern. From Lenart’s and Neilson’s teachings, it is concluded that the reference expression cannot be measured from miRNA expression pattern from a different and random patient, but the expression level of individual miRNA would need to be normalized compared to carefully picked internal references standards.
Akbar (Akbar, S. et al. “Blood miRNAs miR-549a, miR-552, and miR-592
serve as potential disease-specific panels to diagnose colorectal cancer”. Heliyon, Vol. 10 (2024), p: e28492) teaches a method of diagnosing colorectal cancer using miRNAs expression levels (see title and abstract). Akbar also teaches that miR-522 as a cancer-specific biomarker that is upregulated in colorectal cancer tissue samples compared to normal tissues (see page 4, section 3.1). Akbar also teaches that using miRNAs expression, it is difficult to differentiate inflammation from colorectal cancer, since those biomarkers, such as miR-552, are also deregulated in inflammation (see section 3.2). However, Akbar teaches that miR-552 is downregulated in Crohn’s disease (see section 3.2 and Table 3). Akbar also teaches that miR-552 is upregulated in morphine addiction (see Table 2).
Therefore, it is interpreted that a sample from a subject referred as “normal” can have a different expression pattern because of drug use or substance abuse, and cannot be used as reference. It is also conceivable that a subject referred as “normal” or “control”, or a tissue isolated from a healthy subject, under general anesthesia and morphine for pain management, can present an artificially deregulated miRNAs expression pattern.
What the Specification does and does not teach:
The Specification teaches a definition of “subjects” as “human or animal” and as
“adult to newborn” (see page 44, § [000174]-[000175]).
The Specification does not give specific definition for “a given stage” or “a recognizable stage”, relying on the assumptions of one with ordinary skills in the art.
The Specification teaches about the use of miRNAs or “complementary sequences” or mimics or isoMirs as therapeutics (see § [000176]-[000179]. The Specification further discloses acceptable modifications of oligonucleotides, delivery carriers and targeting moieties, administration routes, toxicities, dosage, combination chemotherapies and kits (see § [000180]-[000202]).
Regarding a Method of diagnosing, i.e. “determining whether a subject has, or is at risk of developing , or is at a given stage of a condition”, the Specification introduces a computer-implemented method for determining “ a normal condition of the tissue”, “a recognizable stage of an abnormal condition of the tissue” ( see page 54 of Specification, paragraphs 38 to 79 on page 57).
The Specification teaches about conservation of expression and sequences across species (see page 347, § [000241]), without further explanation of tissue, organs used and/or developmental stages of organisms.
The Specification teaches tissue specificities of miRNAs expressions (see page 453, § [000241]), without explanation of tissue sources nor developmental stages, diseases and what references were used.
The Specification teaches patient segmentation or diagnosis, differential expression by disease states (see Example 4, § [000244], and Example 8, § [000256]). However, it is not clear whether these analyses were obtained from case control studies with adequate references standards and a reference curve.
The Specification mainly teaches the discovery/isolation and corresponding analyses of miRNAs relative expressions, as well as their nucleic acid sequences in Tables 1 to 3 (Table 1: “Novel miRNA sequences”, pages 523-1615, SEQ ID NO: 1 to SEQ ID NO: 23,461; Table 2: “Additional miRNA sequences”, pages 1616-1869, SEQ ID NO: 23,462 to SEQ ID NO: 27,7168; Table 3: “Novel miRNA/isomiR sequences”, pages 1870-3178, SEQ ID NO: 27,169 to SEQ ID NO: 47,972).
The Specification does not disclose an example of pregnant female subject at risk for a disease, nor an example of subject affected with a specific viral or bacterial infection. The Specification does not present data regarding specific set of miRNA identified as specific in a tissue with a curve for differential expression compared to reference housekeeping gene standard. The Specification does not present an example of case control study demonstrating the reproducibility and the predictive value of using specific miRNAs’ expressions as biomarkers for a specific condition, representative of different classes of diseases, in a selected population of subjects.
The large computer-generated data volume renders essential information one with ordinary skills in the art motivated in using a new miRNA- based method of diagnosing a disease would need, difficult to find. Furthermore, the Specification does not demonstrate the ability of specific miRNAs’ expressions to diagnose and to predict a specific disease or condition of interest in a conclusive manner. The tables merely list potential miRNAs and suggest using them. There is no clear written description of an actual use and steps for diagnosing a condition in a population. The claims do not appropriately limit the scope of the claimed method for one with ordinary skills to know whether the method is applicable to a specific condition of interest.
Conclusion:
Taking into consideration the factors outlined above, including the nature of the
invention, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that Applicant does not possess the whole scope of the claimed invention. There is no specific written example within the Specification that would lead one with ordinary skills in the art to a different conclusion.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4, 9 and 26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, it recites the limitation " expression level of one or more of the miRNAs" in line 4. There is insufficient antecedent basis for this limitation in the claim.
Regarding claim 3, it recites “wherein the reference sample represents a normal condition of the tissue”. It is unclear what would be a normal condition of the tissue for a subject that is only at risk of developing a condition.
Regarding claim 4, it recites “ wherein the reference sample represents a recognizable stage of an abnormal condition of the tissue”. It is unclear what would be a proper reference sample if the subject is only at risk of developing an abnormal condition.
It is unclear what would be the relevance of a “recognizable stage” of a cancer as reference, when diagnosing a subject that has not developed a cancer yet, since “a subject at risk” can be any healthy subject, undistinguishable from a normal, healthy subject.
It is unclear what would be a recognizable stage of an infection and its relevance, for a risk of infection affecting differently some populations, e.g. infected but healthy carriers and recurrently infected subjects, especially if there is a difference in genetic background that would alter baseline gene expression levels.
Regarding claims 2-4, 9 and 26 depending upon claim 1, the claims do not remedy the deficiency of claim 1, therefore they are rejected as well.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3 are rejected under 35 U.S.C. §102(a)(1) as being anticipated Galas (Galas et al. US 2010/0216139 A1, published August 26, 2010) by as evidenced by NCBI Ref Seq # NR_030278 (Homo sapiens microRNA 552 (MIR552), microRNA, first published October 29, 2009, referred below as NR_030278) and Zou (Zou, Y. et al. “miR-552: an important post-transcriptional regulator that affects human cancer”. Journal of Cancer, Vol. 11, No. 21 (2020), pp: 6226-6233).
Regarding claim 1, Galas teaches a method which uses microRNA to detect, predict, treat and monitor physiological conditions such as disease or injury. Galas teaches measuring differential expression of microRNA for diagnostic information, i.e. determining whether a subject has or is at risk of developing or is at a given stage of a condition (see title and abstract).
Galas teaches generating a microRNA profile from a biological sample and comparing the microRNA profile with a reference to identify differentially expressed, i.e. alterations in expression of microRNA sequences (see § [0014]).
Galas teaches using miRNA-552 as one of the microRNAs selected (see claim 2). As evidenced by NR_030278, miRNA-552 is a microRNA sequence comprising SEQ ID NO: 31, 476. See alignment below (Qy : Query= SEQ ID NO:31,476; Db: Database= NR_030278):
Query Match 100.0%; Score 22; DB 1; Length 96;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTTAACCTTTTGCCTGTTGG 22
||||||||||||||||||||||
Db 24 TGTTTAACCTTTTGCCTGTTGG 45
Regarding claim 2, Galas teaches the use of miRNA isoforms, as evidenced by Zou, the sequence of miR-552 presented in Galas, page 23, Appendix A Table, is an isoform called miR-552-3p, which has a different sequence from miR-552-5p (see page 6226, right column, “miR-552 family” section of Zou). Galas teaches other examples of miRNA used and their isoforms, i.e. for example, miR-513a-3p and miR-513a-5p, miR-513b, and miR-513c (see page 23, Appendix A Table, § [0159]).
Regarding claim 3, Galas teaches reference samples from normal (healthy) person, i.e. a normal condition of tissue sample (see § [0010] and [0084]).
Claims 1, 3-4, 9 and 26 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Boisen (Boisen, M.K. et al. US 2015/0152503 A1, published June 4, 2015, benefitting of priority from PCT filing date of January 16, 2013 and from Foreign application PA 2012 70025 filed January 16, 2012) as evidenced by NCBI Ref Seq # NR_030278 (Homo sapiens microRNA 552 (MIR552), microRNA, first published October 29, 2009, referred below as NR_030278).
Regarding claim 1, Boisen teaches a method of determining whether a subject is at risk of disease progression or at risk for death, in subjects suffering from cancer and treated with anti-angiogenic treatment (see title and abstract, and § [0057]). Boisen teaches determining the expression level of a combination of miRNAs in tissue sample from patients and comparing the expression level of at least one miRNA in the sample with a predetermined control level of the miRNA, wherein a difference in expression level is considered aberrant (see § [0058], claim 108). Boisen teaches that the predetermined control level may be the average level of expression in healthy controls (see § [0059]). Boisen teaches that miRNA expression level is altered as compared to the expression level in a control sample. Said control sample may be a normal tissue ( see § [0243]).
Boisen teaches miR-552 as a biomarker (see § [0007], [0010], [0013], and see claim 107). As evidenced by NR_030278, miRNA-552 is a microRNA sequence comprising SEQ ID NO: 31,476. See alignment below (Qy : Query= SEQ ID NO:31,476; Db: Database= NR_030278):
Query Match 100.0%; Score 22; DB 1; Length 96;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTTAACCTTTTGCCTGTTGG 22
||||||||||||||||||||||
Db 24 TGTTTAACCTTTTGCCTGTTGG 45
Regarding claim 3, Boisen teaches that the predetermined control level may be the average level of expression in healthy controls (see § [0059]). Boisen also teaches that a biomarker is an indicator of a normal or abnormal process, or of a condition or disease ( § [0034], [0056]). Boisen teaches that miRNA expression level is altered as compared to the expression level in a control sample. Said control sample may be a normal tissue ( see § [0243]).
Regarding claim 4, Boisen teaches reference sample representing a recognizable stage of an abnormal condition of the tissue, i.e. primary tumor samples (see § [0426]).
Regarding claims 9 and 26, Boisen teaches tissue of interest being colon and the disease is colon cancer ( see abstract, and § [0064]-[0065], [0244]-[0245], [0273]-[0274]).
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636