DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from US Application No. 14/888,637 filed 11/02/2015, international Application PCT/US2014/036690 filed 05/02/2014, and Provisional Applications Nos. 61/818,777 filed 05/02/2013, 61/870,898 filed 08/28/2013, 61/901,989 filed 11/08/2013, is hereby acknowledged.
Application Status
This Application is a CON of US Application No. 14/888,637 (US Patent No. 11,293,064) filed 11/02/2015.
This Office Action is in response to Amendments and arguments filed 06/05/2026.
Amendments to claims filed 06/05/2026 are hereby acknowledged. Claims 1 and 9 are currently amended. Claims 2, 5-8 and 10-38 are cancelled. Claims 1, 3-4 and 9 are pending and under consideration in this office action.
Any objection or rejection not reiterated herein has been overcome by amendments and is therefore withdrawn.
Applicant’s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons that follows.
Drawings/ Specification
The Drawings filed 07/16/2021 are rendered acceptable with amendments to the specification to add the reference character(s) in the description in compliance with 37 CFR 1.121(b).
Amendments to Specification, Substitute marked- and clean-copies are hereby acknowledged and are acceptable.
The following rejections are maintained, but are modified as necessitated by Applicant’s amendments:
Claim Rejections - 35 USC § 101
35 U.S.C. §101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Non-Patent Eligible Subject Matter- Laws of Nature, Natural Phenomena, and Abstract Ideas.
Claims 1, 3-4 and 9 are rejected under 35 U.S.C. § 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea).
The claims are drawn to “A method of treating colon cancer in a human subject in need thereof, the method comprising: (a) measuring in a biological sample obtained from a tissue of interest from the human subject the expression profile of two or more isoforms of a miRNA by deep sequencing, wherein the sequence of the miRNA is set forth in SEQ ID NO: 31476; (b) computing a difference in the expression profile of the two or more isoforms of the miRNA as compared to the expression profile of the same isoforms in a reference sample by determining differential expression based on a log 2-change in expression of ≥ 0.58 and ≤-0.58; (c) and administering to the human subject an anticancer treatment selected from the group consisting of chemotherapy, radiation therapy, surgery, immunotherapy, RNA therapeutics or any combinations thereof.”( Claim 1).
However, do not include additional elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exception and routine processes.
Subject Matter Eligibility Test for Products and Processes
Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES
Claims 1, 3-4 and 9 are directed to “a method of treating colon cancer”. Therefore, the claims are directed to a statutory category (e.g., a process).
Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Abstract ideas have been identified by the courts by way of example, including
fundamental economic practices, certain methods of organizing human activities, an idea 'of itself,' and mathematical relationships/formulas. The claims recite two judicial exceptions: 1) a "mental" process of determining/interpreting data/information (i.e., "determining differential expression") which corresponds to "an abstraction"; an idea having no particular concrete or tangible form; and 2) the relationship/correlation between the "expression level of one or more isoforms of a miRNA”. The specific SEQ ID NO introduces naturally occurring products and the expression of a gene is a natural principle. Also, a gene expression profile, or an altered expression of a gene and its naturally occurring isoforms in a subject affected by a disease, are natural phenomena. Thus, the claimed invention describes judicial exceptions, which corresponds to "an abstraction"; an idea, having no particular concrete or tangible form.
Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the
Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. However, absent are any additional elements recited in the claim beyond the judicial exceptions which integrate the exception into a practical application of the exception.
The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception.
The claim limitations "measuring in a biological sample obtained from a tissue of interest from the human subject the expression profile of two or more isoforms of a miRNA by deep sequencing, wherein the sequence of the miRNA is set forth in SEQ ID NO: 31476” do not apply, rely on, or use integrate the judicial exception into a practical application. The above claim limitations are considered simply as the recitation of a routine method of data collection based on naturally occurring gene expression. There are no further/additional steps which applies either the identified judicial exceptions into a practical application. Thus, the claims do not provide for any element/step that integrates the law of nature into a practical application.
Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim. See M.P.E.P. 2106.05.
However, the additional elements, individually and in combination, do not amount to "significantly more". Under the Step 2B analysis, claims 1, 3-4 and 9 provide no additional "physical" elements/steps. As explained with respect to Step2A Prong Two, the recitations " measuring in a biological sample obtained from a tissue of interest from the human subject the expression profile of two or more isoforms of a miRNA by deep sequencing, wherein the sequence of the miRNA is set forth in SEQ ID NO: 31476” do not require any particular application of a new method of measuring the naturally occurring gene expression profiles, that can be obtained using known in the art routine method, and is at best the equivalent of merely adding the words "apply it" to the judicial exception. The limitation in (b) involves a step of “computing” without express description of a new algorithm or new machine, combined with a mental process of “determining differential expression”. The limitation in (c) recites a step of “administering an anticancer treatment”, without specifically reciting a new protocol, new anticancer compound, or new machine for radiation therapy or surgery. The limitation in (c) does not recite specificity in the treatment method compared to what is known in the art.
Mere instructions to apply an exception cannot provide an inventive concept. Absent from the claims is a limitation(s) that has more than a nominal relationship to the judicial exception. There is no limitation(s) that utilize the recited abstract idea in a manner that imposes a meaningful limit on it. There is no limitation(s) that integrates the recited judicial exception into a practical application, such that the claim is not directed to the judicial exception.
Thus, when viewed both individually and as an ordered combination, the claimed
elements/steps in addition to the identified judicial exceptions are found insufficient to supply an inventive concept because the elements/steps are considered conventional and specified at a high level of generality. The claim limitations do not transform the abstract idea that they recite into patent-eligible subject matter because "the claims simply instruct the practitioner to implement the abstract idea with routine, conventional activity."
Accordingly, the claims do not qualify as patent-eligible subject matter.
Claims 3-4 and 9 do not remedy the deficiencies of claim 1, therefore they are rejected as well.
Response to Arguments
Applicant's arguments filed 06/05/2026 have been fully considered but they are not persuasive.
In response to Arguments in Remarks, pages 8-9, the judicial exceptions are 1) a naturally occurring gene of SEQ ID NO: 552; 2) a naturally occurring phenomena, i.e., changes in gene expression pattern under different naturally occurring conditions in a Human subjects; 3) a mental process of determining a differential expression.
Applicant attempts to incorporate the judicial exceptions into a practical application by using recitations that are merely a drafting effort designed to monopolize the exception. The method of treating itself is merely recited in a generic way; the step of measuring correspond to a mean for collecting data on patients. Both steps of measuring and treating can be performed with routine knowledge in the art. Applicant does not claim a novel method of treating having isolated a specific compound or having documented a specific protocol for treatment.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. §112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. §112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-4 and 9 are rejected under 35 U.S.C. §112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the Invention:
Claim 1 recites “A method of treating colon cancer in a human subject in need thereof, the method comprising: (a) measuring in a biological sample obtained from a tissue of interest from the human subject the expression profile of two or more isoforms of a miRNA by deep sequencing, wherein the sequence of the miRNA is set forth in SEQ ID NO: 31476; (b) computing a difference in the expression profile of the two or more isoforms of the miRNA as compared to the expression profile of the same isoforms in a reference sample by determining differential expression based on a log 2-change in expression of ≥ 0.58 and ≤ -0.58; (c) and administering to the human subject an anticancer treatment selected from the group consisting of chemotherapy, radiation therapy, surgery, immunotherapy, RNA therapeutics or any combinations thereof.”
It is therefore expected in the instant application a disclosure of a method of treating using the cited miRNA and/or isoforms as biomarkers, to specifically indicate a stage of the colon cancer and an adapted method of treating that disease according to said miRNA expression profile. It is expected in the disclosure, the specifying of a novel anticancer agent, or a specific combination of therapies, that can induce remission compared to human subjects having a different gene expression profile.
It is expected in this disclosure a reduction to practice with examples of acceptable ratios obtained after detection of miRNA, as reference, in specific tissues and specific conditions. It is expected for each miRNA isoform, a reference standard curve for each type of tissue and developmental stage. It is expected for this method of treating and prognosticating in a human subject, a system including normal cells from said specific subject, and fluctuations of miRNAs according to a time-course during treatment as measured compared to a reference.
It is expected for a condition that is cancer, cancerous cells at different levels of transformation with a standard reference curve of housekeeping RNAs. It is expected for prognosis of treatment outcome, exposure of cells to antineoplastic agents and effects on miRNAs expression compared to levels of miRNAs in absence of the agents; or it is expected to have subjects’ samples before and after treatment with examples of agents, with measures of claimed biomarkers.
It is expected a description of the treating method, step by step, with emphasis on the treating, and specification of said method of treating, applying new protocol for treatment, or new antineoplastic agents developed as a result or derivation, of the claimed miRNA and isoforms expression profile.
The broadness of the claim leads to assumption that the subject can be any human, from newborn to adult, and with any genetic background, gene rearrangement, presenting any type of colon cancer, at any stage.
Claims 3 and 4 are drawn to reference samples that can be either a representative of a normal condition or a “recognizable” stage of an abnormal condition.
Claim 9 is drawn to the tissue of interest being colon or blood.
The State of the Art:
Akbar (Akbar, S. et al. “Blood miRNAs miR-549a, miR-552, and miR-592
serve as potential disease-specific panels to diagnose colorectal cancer”. Heliyon, Vol. 10 (2024), p: e28492; previously cited) teaches a method of diagnosing colorectal cancer using miRNAs expression levels (see title and abstract). Akbar also teaches that miR-522 as a cancer-specific biomarker that is upregulated in colorectal cancer tissue samples compared to normal tissues (see page 4, section 3.1). Akbar also teaches that using miRNAs expression, it is difficult to differentiate inflammation from colorectal cancer, since those biomarkers, such as miR-552, are also deregulated in inflammation (see section 3.2). However, Akbar teaches that miR-552 is downregulated in Crohn’s disease (see section 3.2 and Table 3). Akbar also teaches that miR-552 is upregulated in morphine addiction (see Table 2).
Therefore, it is interpreted that a sample from a subject referred as “normal” can have a different expression pattern because of drug use or substance abuse and cannot be used as reference. It is also conceivable that a subject referred as “normal” or “control”, or a tissue isolated from a healthy subject, under general anesthesia and morphine for pain management, can present an artificially deregulated miRNAs expression pattern.
What the Specification does and does not teach:
The Specification teaches a definition of “subjects” as “human or animal” and as
“adult to newborn” (see page 44, § [000174]-[000175]).
The Specification does not give specific definition for “a given stage” or “a recognizable stage”, relying on the assumptions of one with ordinary skills in the art.
The Specification teaches about the use of miRNAs or “complementary sequences” or mimics or isoMirs as therapeutics (see § [000176]-[000179]. The Specification further discloses acceptable modifications of oligonucleotides, delivery carriers and targeting moieties, administration routes, toxicities, dosage, combination chemotherapies and kits (see § [000180]-[000202]).
Regarding a Method of diagnosing, i.e. “determining whether a subject has, or is at risk of developing , or is at a given stage of a condition”, the Specification introduces a computer-implemented method for determining “ a normal condition of the tissue”, “a recognizable stage of an abnormal condition of the tissue” ( see page 54 of Specification, paragraphs 38 to 79 on page 57).
The Specification teaches about conservation of expression and sequences across species (see page 347, § [000241]), without further explanation of tissue, organs used and/or developmental stages of organisms.
The Specification teaches tissue specificities of miRNAs expressions (see page 453, § [000241]), without explanation of tissue sources nor developmental stages, diseases and what references were used.
The Specification teaches patient segmentation or diagnosis, differential expression by disease states (see Example 4, § [000244], and Example 8, § [000256]). However, it is not clear whether these analyses were obtained from case control studies with adequate references standards and a reference curve.
The Specification mainly teaches the discovery/isolation and corresponding analyses of miRNAs relative expressions, as well as their nucleic acid sequences in Tables 1 to 3 (Table 1: “Novel miRNA sequences”, pages 523-1615, SEQ ID NO: 1 to SEQ ID NO: 23,461; Table 2: “Additional miRNA sequences”, pages 1616-1869, SEQ ID NO: 23,462 to SEQ ID NO: 27,7168; Table 3: “Novel miRNA/isomiR sequences”, pages 1870-3178, SEQ ID NO: 27,169 to SEQ ID NO: 47,972).
The Specification does not present data regarding specific set of miRNA identified as specific in a tissue with a curve for differential expression compared to reference housekeeping gene standard. The Specification does not present an example of case control study demonstrating the reproducibility and the predictive value of using specific miRNAs’ expressions as biomarkers for a specific condition, representative of different classes of diseases, in a selected population of subjects.
The large computer-generated data volume renders essential information one with ordinary skills in the art motivated in using a new miRNA- based method of diagnosing a disease would need, difficult to find. Furthermore, the Specification does not demonstrate the ability of specific miRNAs’ expressions to diagnose and to predict a specific disease or condition of interest in a conclusive manner. The tables merely list potential miRNAs and suggest using them. There is no clear written description of an actual use and steps for diagnosing a condition in a population. The claims do not appropriately limit the scope of the claimed method for one with ordinary skills to know whether the method is applicable to a specific condition of interest.
Conclusion:
Taking into consideration the factors outlined above, including the nature of the
invention, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that Applicant does not possess the whole scope of the claimed invention. There is no specific written example within the Specification that would lead one with ordinary skills in the art to a different conclusion.
Response to Arguments
Applicant's arguments filed 06/05/226 have been fully considered but they are not persuasive.
In response to arguments in Remarks, page 10, regarding the rejections of claims under 35 U.S.C. §112(a), the amendments, although adding new limitations, does not completely render the rejection moot. Applicant’s claim 1 recite “an anticancer treatment selected from the group consisting of chemotherapy, radiation therapy, surgery, immunotherapy, RNA therapeutics or any combinations thereof”, thereby claiming all the novelties and advances in the fields of oncology in terms of treatment for colon cancer. Applicant does not propose a specific and new protocol or a new compound in this method of treating.
The following rejections are new as necessitated by Applicants’ amendments:
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-4 and 9 are rejected under 35 U.S.C. §103 as being unpatentable over Boisen (Boisen, M.K. et al. US 2015/0152503 A1, published June 4, 2015, benefitting of priority from PCT filing date of January 16, 2013 and from Foreign application PA 2012 70025 filed January 16, 2012; previously cited), as evidenced by and in view of NCBI Ref Seq # NR_030278 (Homo sapiens microRNA 552 (MIR552), microRNA, first published October 29, 2009, referred below as NR_030278; previously cited) and further in view of Hamfjord (Hamfjord J. et al. “Differential expression of miRNAs in colorectal cancer: comparison of paired tumor tissue and adjacent normal mucosa using High-Throughput sequencing”. PLoS ONE, Vol. 7, issue no. 4 (2012), p: e34150 (1-9); cited on IDS filed 11/10/2021) and Oberg (Oberg, A.L. et al. "miRNA expression in colon polyps provides evidence for a multihit model of colon cancer". PLoS ONE, Vol. 6, Issue no. 6 (2011), p: e20465 (pp:1-12)).
Regarding claim 1, Boisen teaches a method of determining whether a subject is at risk of disease progression or at risk for death, in subjects suffering from colorectal cancer (including sigmoid colon cancer) and treated with anti-angiogenic treatment (see title and abstract, and § [0057]). Boisen teaches that the samples are human samples and human miRNAs (see [0053]). Boisen teaches Human subjects (see [0272]).
Boisen teaches determining the expression level of a combination of miRNAs in tissue sample from patients and comparing the expression level of at least one miRNA in the sample with a predetermined control level of the miRNA, wherein a difference in expression level is considered aberrant (see § [0058], claim 108). Boisen teaches that the predetermined control level may be the average level of expression in healthy controls (see § [0059]). Boisen teaches that miRNA expression level is altered as compared to the expression level in a control sample. Said control sample may be a normal tissue ( see § [0243]).
Boisen teaches miR-552 as a biomarker (see § [0007], [0010], [0013], and see claim 107). As evidenced by NR_030278, miRNA-552 is a microRNA sequence comprising SEQ ID NO: 31,476. See alignment below (Qy : Query= SEQ ID NO:31,476; Db: Database= NR_030278):
Query Match 100.0%; Score 22; DB 1; Length 96;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTTAACCTTTTGCCTGTTGG 22
||||||||||||||||||||||
Db 24 TGTTTAACCTTTTGCCTGTTGG 45
On note: NR_030278 teaches a sequence that is 96 nucleotides in length, with nucleotides 61 to 81 being non-coding region. Thus, one with ordinary skills in the art interested in choosing a sequence of miR-552 would only have 60 nucleotides to choose sequences from.
It would have been obvious to one with ordinary skills before the effective filing date of the claimed invention to have used multiple sequences encompassing isoforms of miR-552 taught by NR_030278 in a high-throughput analysis of miRNAs of interest as taught by Boisen. One with ordinary skills in the art motivated in selecting appropriate sequences for identifying gene profiles including the isoforms’ s expression profiles could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Regarding claim 1(b) and (c), Boisen teaches using statistical analysis and
computing ( [0431]). Boisen teaches analyzing differentially expressed miRNAs (see [0137]-[0138]).
Boisen teaches detection of miRNAs using commercially available array platform, such as the MicroRNA Profiling Panels by Illumina (see [0311]).
Boisen also teaches administering a therapeutically effective amount of an anti-angiogenic treatment and/or chemotherapeutic treatment, thereby treating cancer (see [0016], [0019], and page 43, claim 122(b)).
Regarding claim 3, Boisen teaches that the predetermined control level may be the average level of expression in healthy controls (see § [0059]). Boisen also teaches that a biomarker is an indicator of a normal or abnormal process, or of a condition or disease ( § [0034], [0056]). Boisen teaches that miRNA expression level is altered as compared to the expression level in a control sample. Said control sample may be a normal tissue ( see § [0243]).
Regarding claim 4, Boisen teaches reference sample representing a recognizable stage of an abnormal condition of the tissue, i.e. primary tumor samples (see § [0426]).
Regarding claim 9, Boisen teaches tissue of interest being colon and the disease is colon cancer ( see abstract, and § [0064]-[0065], [0244]-[0245], [0273]-[0274]). Boisen also teaches taking blood samples from the subjects (see [0257], [0274], [0276], [0283]; page 43, claim 116).
Boisen does not teach specifically a “deep sequencing’ and “differential expression based on a log 2-change in expression of ≥0.58 and ≤-0.58”.
However, Hamfjord teaches deep sequencing, as defined by Applicant’ s Specification (see [00013]) presenting Next-Generation sequencing on platforms such as Illumina Genome Analyzer IIx (Illumina, CA, USA) as part of acceptable methods for deep sequencing (see “RNA extraction and digital sequencing” in Materials and Method section, page 7, left column, first paragraph).
Hamfjord also teaches miR-552 in Table 2, as part of genes expressed with a Log 2-change of 4.3 in colon cancer.
Oberg teaches a multihit model using miRNA expression in colon polyps to predict colon cancer (see title and abstract). Oberg teaches selecting miRNAs that present at least a 2-fold change in expression differences and identifies miR-552 as one of the miRNAs to consider in the set comprising four miRNAs in comparison between proficient (pMMR) and deficient DNA mismatch repair (dMMR) tumors (see abstract).
Oberg teaches statistical analyses based on a Log 2-change ≥│0.5│in either direction (see Figure 4), which fully encompasses a range of ≥ 0.58 and ≤-0.58.
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention, to have combined the method of treating and prognosticating colon cancer in human subjects taught by Boisen, with the data analyzing steps taught by Hamfjord and Oberg. One with ordinary skills in the art, motivated in prognosticating the treatment outcome based on miRNAs, could have selected the miRNAs and isoforms taught in Table 2 of Hamfjord and in the abstract of Oberg, and adapted the method of treating adding a step of gene expression profiling including all the miRNAs of interest specific to colon cancer with a Log 2-change value≥│0.5│in either direction. One with ordinary skills in the art could have performed these modifications with a reasonable expectation of success and would have arrived at the claimed invention.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action, and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights