DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Claims 45, 73-83, and 85-92 are pending.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 21 April 2026 has been entered.
Status of the Application
Applicant’s response and amendment filed 21 April 2026 are acknowledged and entered.
Applicant has added Claims 89-92.
Response to Amendment
The 103 rejection is maintained but modified.
The NSDP rejections are maintained but modified.
Claims 45, 73-83, and 85-92 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Claims 45, 73-83, and 85, 89-92 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over US Patent No. 5728518 (issued 17 March 1998, “US518”, of record), International Patent Application No. WO 95/17414 (published 29 June 1995, “WO414”), International Patent Application No. WO 2005/023083 (published 15 March 2005, “WO083”). This rejection is updated.
NOTE: references to p. # in WO documents refers to PDF p. #.
US518 teaches (§Abstract) oligont that inhibit HBV replication and which can be used to treat viral infection in a subject. US518 discloses (p. 12 SEQ Listing) SEQ ID NO 1 which is a 25-mer that comprises a region of 100% identity to claimed SEQ ID NO 226, as shown by the following alignment:
US-08-287-337A-1
(NOTE: this sequence has 1 duplicate in the database searched)
Sequence 1, US/08287337A
Patent No. 5728518
GENERAL INFORMATION
APPLICANT: Ellen Carmichael
TITLE OF INVENTION: ANTIVIRAL OLIGONUCLOETIDE
CURRENT APPLICATION NUMBER: US/08/287,337A
NUMBER OF SEQ ID NOS: 9
SEQ ID NO 1
LENGTH: 25
TYPE: DNA
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAGGTGAAGCGAAGTGC 20
||||||||||||||||||||
Db 1 GCAGAGGTGAAGCGAAGTGC 20
Regarding Claim 45, US518 teaches (Figs. 1, 3; Col 3 L25-42) the oligont comprising SEQ ID NO 1 inhibits HBV replication. US518 teaches (Col 8 L25-50) the oligont can be used to treat HBV infection in a person and administering the oligont within a pharmaceutically acceptable carrier. US518 teaches (Col 6 L1-30) oligont that are administered to a body are subject to degradation by nucleases but that chemical modifications can provide nuclease resistance and increase oligont stability. US518 teaches (Col 5 L15-35) the oligont can be from about 20 to about 25 bases long.
US518 teaches (Col 4 L6-34; Col 5 L36-57) their ASOs block transcription which blocks viral replication but also teaches (Col 1 L31-39) antiviral oligont include those that mediate cleavage reactions which indicates they contemplated ASOs that work via other mechanisms.
US518 teaches (Col 11-12 L59-10) all of their antiviral ASOs inhibit viral activity although some work better than others.
US518 does not explicitly disclose a reason why an artisan would choose to use the DRII(R) sequence of SEQ ID NO 1.
However, WO414 teaches (p. 6 L1-15) antisense oligonucleotide compositions complementary to the HBV DR2 region completely block viral transcription, antigen production, and replication. WO414 further discloses exactly how to produce such ASOs:
(p. 16 L1-7) antiviral antisense oligomers of the invention, which are complementary to a region of HBV plus strand DNA comprising DR2; at least 3 and preferably at least 4 conserved 5' flanking nucleotides; and … more preferably 0-10… 3' flanking nucleotides, can totally block HBV replication.
WO414 teaches (pp. 16-17 L28-22) compositions and pharmaceutical compositions comprising such ASOs and methods of using them to inhibit HBV replication in cells or to treat HBV infection. Note that WO414’s “DR2 region” is the same as US518’s “DR(II)”, they are just abbreviated in different ways.
WO414 shows (p. 15 Table 1) the plus strand comprising the DR2 region, shown here in an excerpt of Table 1:
PNG
media_image1.png
178
1237
media_image1.png
Greyscale
The § of WO414 quoted above teaches that the ASOs should bind a specific region on the HBV plus strand, namely the 11-mer DR2 region and at least four 5’flanking nucleotides. WO414 teaches (p. 17 L5-10) such ASOs are capable of completely inhibiting HBV replication.
WO414 discusses (pp. 10-16 L23-27) the process of viral replication and states the ASOs bind to the DR2 region of HBV RNA and thereby inhibit viral replication:
(p. 16 L12-17) The oligonucleotides of the invention are complementary to the DR2 region of HBV plus strand DNA and to the corresponding region of HBV RNA (which is also of plus strand polarity), and thus interact with these regions, thereby inhibiting HBV viral replication. The interaction of such oligonucleotides with their complementary or "receptor" sequences may result from hybridization interactions, or through other mechanisms which are not yet fully understood. [emphasis added.]
WO414 further teaches their ASOs work by targeting HBV RNA:
(p. 29 L10-15) It is thought that the DR2 antisense oligonucleotide may be acting at any of several possible levels. It may bind to and have an antisense effect on the HBV 3.5 kb pregenomic RNA, the HBV 2.1 kb mRNA and/or the HBV 2.4 kb mRNA. The DR2 sequence is present in both the polymerase and the X protein ORFs.
The same § discusses that the ASOs can also bind HBV DNA.
Regarding Claim 45, WO414 teaches (p. 17 L 19-22) pharmaceutical compositions comprising an effective amount of the ASO and a pharmaceutically acceptable carrier.
Regarding Claim 74, WO414 teaches (p. 23 L3-9) modifying the ASOs with PS linkages to make them more stable.
Altogether, WO414 teaches instructions for how to produce an effective pharmaceutical composition that completely inhibits HBV replication in cells: Antisense oligonucleotide compositions complementary to the HBV DR2 region completely block viral transcription, antigen production, and replication. Those instructions require targeting a specific target region in the HBV genome, DR2, which (p. 12 L9-12) play[s] a critical rol[e] in the initiation of viral DNA synthesis. That specific DR2 region is located on the HBV plus strand (RNA or DNA).
The following alignment shows that US518 SEQ ID NO is 100% complementary to the 11-nt DR2 region and the region 5’ of it and, therefore, exactly within WO414’s rules for producing an ASO that completely blocks HBV viral replication:
RESULT 1
NASEQ2_05132026_140414/c
Query Match 100.0%; Score 25; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAGGTGAAGCGAAGTGCACACG 25 US518 SEQ ID NO 1
|||||||||||||||||||||||||
Db 25 GCAGAGGTGAAGCGAAGTGCACACG 1 nt 1578-1602 of WO414 HBV SEQ
US518 and WO414 does not teach a sequence consisting of 20 linked nucleosides and having a nucleobase sequence consisting of claimed SEQ ID NO 226 (i.e., Claim 73). US518 and WO414 do not teach a 20-mer ASO that comprises a gap segment consisting of linked nucleosides, a 5’wing segment and a 3’ wing segment, each consisting of 1-8 or 4-5 linked modified nucleosides, wherein the gap segment is positioned between the wing segments, wherein the modified nucleoside of each wing segment comprises a 2’-O-methoxyethyl sugar, wherein each linkage is a PS linkage, and wherein all cytidine nt are 5-methylcytidines (Claims 73-79, 83, 86, 89). US518 and WO414 do not teach the compound comprises a salt of the modified ASO or that the salt is a sodium salt (Claims 81-82, 85, 87-88, and 91-92). US518 and WO414 do not teach the compound wing segments can comprise bicyclic sugar that can be a 4’-CH2-O-2’ bridge (Claims 80 and 90).
However, WO083, drawn to ASO compounds for inhibiting another virus (SARS), teaches claim limitations US518 and WO414 do not teach. WO083 (§Abstract): provides design and synthesis of oligomeric compounds and compositions that can be administered to reduce the activity of SARS virus in vivo or in vitro, to prevent or treat SARS virus-associated disease, to detect AARS virus, and to diagnose SARS virus-associated diseases. WO083 discusses (p. 11 L16-25) ASOs are useful for treating a variety of disease states including other viruses [besides SARS]. That indicates that it was known in the art that ASO compositions can be used to treat, detect, and diagnose a virus and the design techniques disclosed by WO083 could be applied to other viruses.
WO083 teaches (p. 3 L21-25) oligont compositions that can be administered to reduce SARS virus activity in vivo/in vitro or used to detect/diagnose the virus.
Regarding Claims 73-79, 83, 89: WO083 discloses (p. 86 L1-14) ASOs targeting the SARS virus plus strand. WO083 teaches:
chimeric oligonucleotides (“gapmers”) 20 nucleotides in length composed of a central “gap” region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide “wings.” The wings are composed of 2’-O-methoxyethyl nucleotides, also known as 2’-MOE. The internucleoside (backbone) linkages are phosphorothioate (P=S) throughout the oligonucleotide. All cytidine residues are 5- methylcytidines.
Therefore WO083 teaches ASOs comprising a gap segment consisting of 10 linked DNA nt, a 5’ wing segment and a 3’ wing segment wherein each wing segment consists of 5 linked 2’-MOE nt, wherein each inter-nt linkage is a PS linkage, and wherein each C residue is a 5-methylcytosine (i.e., limitations of Claims 73-79, 83, and 89. WO083 teaches (p. 42 L1-20) benefits of such chimeric compounds: they have increased resistance to nuclease degradation, increased cellular uptake, increased stability, and/or increased binding affinity for the target nucleic acid.
Regarding Claims 81-82, 85, and 91-92: WO083 teaches (p. 26 L1-2) their invention encompasses their ASOs in salt form including sodium salt form.
Regarding Claims 80 and 90: WO083 teaches (pp. 30-32 L10-23) LNAs in which the 2’ OH group is linked to the 4’ carbon atom of the sugar ring, thereby forming a 2’-[O], 4’-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2) group…. WO083 teaches (same §) LNA and LNA analogs display very high stabilities with complementary DNA and RNA, stability towards exonucleolytic degradation and good solubility properties.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the 25-mer ASO sequence for targeting the HBV DR2 region of US518 with the instructions for producing an ASO effective for completely inhibiting HBV replication of WO414, and the teachings about improving ASO binding affinity and stability of a virus-targeting ASO of WO083, and one would have done so for the benefits of:
targeting the ASO to the DR2 region on the HBV plus strand (as taught by WO414),
shortening the oligont sequence of US518 so that they could apply the exact modification motif of WO083 while applying the 5-10-5 gapmer motif of WO083, and
increasing the ASO’s affinity for target mRNA and improving its resistance to nucleases (as taught by WO083).
One would have been motivated to do (1) with a reasonable expectation of success because WO414 teaches targeting an ASO to the DR2 region on the HBV plus strand is highly effective for totally inhibiting virus replication and WO414 provides instructions for how to produce such an ASO and what structural characteristics the ASO has to have. Although US518 shows (Col 12 Table 1) the DRII(R) ASO has the lowest IC50 of the ASOs they tested, an artisan would have been motivated to use that sequence as a basis for improvement because it is the only ASO in US518 that targets the DR2 (a.k.a. “DR(II)”) region on the plus strand. Furthermore, although the DRII(R) ASO has the lowest IC50 of those tested in US518, an artisan would have expected the other changes (2) and (3) to improve that.
One would have been motivated to do (2) because a shorter antisense oligont is a cheaper oligont (which is relevant when mass-producing a treatment for use in subjects). The easiest way to shorten would have been to remove 5 nt from either end; as discussed above, US518 allows for 20-mer oligos.
One would have been motivated to do (2) and (3) because WO083 teaches motifs that are suitable for ASOs including virus-targeting ASOs, and it would have been a simple matter to apply the teachings of WO083 (including the 5-10-5 motif, the 5-methylCs, the PS linkages, the 2’-MOE and/or LNA nt) to the ASO of US518.
Modifying US518’s ASO according to WO414 and WO083 would have produced the exact gapmer that is instantly claimed, including the exact sequence of SEQ ID NO 226 and the 5-10-5 gapmer motif.
It would have been obvious to formulate the ASO as the sodium salt of WO083 for the benefit of formulating the ASO in routine and conventional manner.
As discussed above, WO414 teaches producing a pharmaceutically acceptable composition of their ASO and applying PS linkages to improve nuclease resistance.
An artisan would have understood that the modifications taught by WO083 could be applied to any ASO, including any virus-targeting ASO, because improvements in binding affinity and nuclease resistance imparted by such modifications are imparted due to the structure of the modification which affects the shape of the ASO and how it interacts with other shapes. Additionally, WO083 discusses that it is routine and conventional to apply such modifications to ASOs including virus-targeting ASOs.
Therefore the limitations of Claims 45, 73-83, and 85, 89-92 would have been obvious in view of US518, WO414, and WO083.
Claims 45, 73-83, and 85, 89-92 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over International Patent Application No. WO 95/17414 (published 29 June 1995, “WO414”), European Patent Application No. EP 1152063 (published 11 July 2001, “EP063”), Will (et al. 1987. Replication Strategy of Human Hepatitis B Virus. J. Virol. 61[3]:904-911, “Will”), and International Patent Application No. WO 2005/023083 (published 15 March 2005, “WO083”). This rejection is new.
NOTE: references to p. # in WO documents refers to PDF p. #.
WO414 is drawn to (§Abstract) methods and compositions for inhibiting viral replication. WO414 teaches (same §) complete and irreversible termination of replication of hepatitis B virus is achieved by introducing into a target cell an oligonucleotide complementary to HBV plus strand…
WO414 teaches (p. 6 L1-15) antisense oligonucleotide compositions complementary to the HBV DR2 region completely block viral transcription, antigen production, and replication. WO414 further discloses exactly how to produce such ASOs:
(p. 16 L1-7) antiviral antisense oligomers of the invention, which are complementary to a region of HBV plus strand DNA comprising DR2; at least 3 and preferably at least 4 conserved 5' flanking nucleotides; and … more preferably 0-10… 3' flanking nucleotides, can totally block HBV replication.
WO414 teaches (pp. 16-17 L28-22) compositions and pharmaceutical compositions comprising such ASOs and methods of using them to inhibit HBV replication in cells or to treat HBV infection.
WO414 shows (p. 15 Table 1) the plus strand comprising the DR2 region, shown here in an excerpt of Table 1:
PNG
media_image1.png
178
1237
media_image1.png
Greyscale
The § of WO414 quoted above teaches that the ASOs should bind a specific region on the HBV plus strand, namely the 11-mer DR2 region and at least four 5’flanking nucleotides. WO414 teaches (p. 17 L5-10) such ASOs are capable of completely inhibiting HBV replication.
WO414 discusses (pp. 10-16 L23-27) the process of viral replication and states the ASOs bind to the DR2 region of HBV RNA and thereby inhibit viral replication:
(p. 16 L12-17) The oligonucleotides of the invention are complementary to the DR2 region of HBV plus strand DNA and to the corresponding region of HBV RNA (which is also of plus strand polarity), and thus interact with these regions, thereby inhibiting HBV viral replication. The interaction of such oligonucleotides with their complementary or "receptor" sequences may result from hybridization interactions, or through other mechanisms which are not yet fully understood. [emphasis added.]
WO414 further teaches their ASOs work by targeting HBV RNA:
(p. 29 L10-15) It is thought that the DR2 antisense oligonucleotide may be acting at any of several possible levels. It may bind to and have an antisense effect on the HBV 3.5 kb pregenomic RNA, the HBV 2.1 kb mRNA and/or the HBV 2.4 kb mRNA. The DR2 sequence is present in both the polymerase and the X protein ORFs.
The same § discusses that the ASOs can also bind HBV DNA.
Regarding Claim 45, WO414 teaches (p. 17 L 19-22) pharmaceutical compositions comprising an effective amount of the ASO and a pharmaceutically acceptable carrier.
Regarding Claim 74, WO414 teaches (p. 23 L3-9) modifying the ASOs with PS linkages to make them more stable.
Altogether, WO414 teaches instructions for how to produce an effective pharmaceutical composition that completely inhibits HBV replication in cells: Antisense oligonucleotide compositions complementary to the HBV DR2 region completely block viral transcription, antigen production, and replication. Those instructions require targeting a specific target region in the HBV genome, DR2, which (p. 12 L9-12) play[s] a critical rol[e] in the initiation of viral DNA synthesis. That specific DR2 region is located on the HBV plus strand (RNA or DNA).
WO414 does not teach a sequence consisting of 20 linked nucleosides and having a nucleobase sequence of claimed SEQ ID NO 226 (i.e., Claim 73).
However, EP063 teaches methods of diagnosing HBV infection comprising (§Abstract) two amplifications of a sample wherein the results indicate stage of infection. EP063 teaches (¶28-38) using a primer pair that includes the primer called “txs1” (EP063 SEQ ID NO 2) to amplify viral DNA indicative of a replication phase of infection (i.e., from §Abstract, a replicative HBV infection stage). EP063’s txs1 primer is a 20-mer that has the sequence gcacttcgcttcacctctgc which is 100% complementary to instantly claimed SEQ ID NO 226, as shown by the following alignment:
RESULT 2
ABA05912/c
(NOTE: this sequence has 15 duplicates in the database searched.
See complete list at the end of this report)
ID ABA05912 standard; DNA; 20 BP.
XX
AC ABA05912;
XX
DT 05-MAR-2002 (first entry)
XX
DE Hepatitis B virus diagnostic PCR primer SEQ ID NO 2.
XX
KW Hepatitis B virus; HBV; infection; hepatocellular carcinoma; diagnosis;
KW PCR primer; ss.
XX
OS Hepatitis B virus.
XX
CC PN EP1152063-A1.
XX
CC PD 07-NOV-2001.
XX
CC PF 03-MAY-2000; 2000EP-00109436.
XX
PR 03-MAY-2000; 2000EP-00109436.
XX
CC PA (DEKR-) DEUT KREBSFORSCHUNGSZENTRUM.
XX
CC PI Schroeder KH, Koike K;
XX
DR WPI; 2002-068256/10.
XX
CC PT Diagnosing hepatitis B virus (HBV) infection stages and determining the
CC PT risk for hepatocellular carcinoma, comprises identifying full length HBV
CC PT transcripts and truncated HBV transcripts in a serum sample.
XX
CC PS Example 1; Page 6; 25pp; English.
XX
CC The invention relates to diagnosis of hepatitis B virus (HBV) infection
CC stages comprising identification of full length HBV transcripts (I) and
CC truncated HBV transcripts (II) in a serum sample, where the ratio of I:II
CC is indicative of a particular infection stage. The method is useful for
CC diagnosing HBV infection stages and determining the risk for developing
CC hepatocellular carcinoma. The present sequence is that of a HBV
CC diagnostic PCR primer, useful for the invention
XX
SQ Sequence 20 BP; 2 A; 9 C; 3 G; 6 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAGGTGAAGCGAAGTGC 20 SEQ ID NO 226
||||||||||||||||||||
Db 20 GCAGAGGTGAAGCGAAGTGC 1 Complement of EP063 SEQ ID NO 2
EP063 discusses (§Abstract, ¶18, ¶32, ¶34-35, ¶48) that their primers are highly specific and show extent of viral replication. EP063 shows (Fig. 1) the txs1 primer is the only one that binds to the DR2 region.
Will, drawn to HBV’s replication “strategy”, teaches (Fig. 7) the region the EP063 primer binds is on the virus’s minus strand. That is shown in a modified excerpt of Fig. 7. The longer box is an annotation that highlights where EP063’s SEQ ID NO 2 binds:
PNG
media_image2.png
136
410
media_image2.png
Greyscale
EP063 SEQ ID NO 2 gcacttcgcttcacctctgc reversed is the sequence CGTCTCCACTTCGCTTCACG. That binding would look like this:
5’-GCAGAGGTGAAGCGAAGTGC-3’ HBV minus strand DNA or RNA
||||||||||||||||||||
3’-CGTCTCCACTTCGCTTCACG-5’ EP063 SEQ ID NO 2 binding to HBV minus strand.
A person of ordinary skill would have understood that the virus’s plus strand is merely the complement of the minus strand. Therefore the plus strand region equivalent to the minus strand bound by EP063’s primer would have the same sequence as EP063’s primer: gcacttcgcttcacctctgc.
As discussed above, WO414 teaches ASOs that inhibit HBV replication should bind to the virus’s plus strand.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify WO414’s ASOs for inhibiting HBV replication and apply WO414’s teachings about HBV-inhibiting ASO design and Will’s teachings identifying the plus/minus strands to the specific DR2-targeting primer of EP063. One would have done so for the benefit of producing a highly specific ASO that targets the HBV plus strand’s DR2 region. One would have been motivated to use a sequence complementary to EP063’s SEQ ID NO 2 because EP063’s primers were found to be highly specific indicators of viral replication—specific enough to use in a diagnostic assay—as well as because WO414’s Table 1 shows the sequence is highly conserved, and because WO414 teaches ASOs that target the DR2 region on the virus’s plus strand fully inhibit viral replication. One would have been motivated to do so with a reasonable expectation of success because it would have been a simple matter to modify EP063’s primer sequence to target the HBV DR2 region on the virus’s plus strand and because WO414 teaches such ASOs are effective for treating HBV.
An artisan would have wanted to target a highly conserved and HBV-specific region when treating HBV or inhibiting HBV replication in a cell or subject, and a person of ordinary skill understands that PCR primers used for diagnostic purposes are by definition highly specific. EP063 shows their primer can be used to effectively detect HBV infection and infection stage. WO414 teaches the sequence targeted by EP063’s txs1 primer (i.e., EP063 SEQ ID NO 2) is highly conserved but Will indicates the primer targets the HBV minus strand. A person of ordinary skill would have modified EP063’s primer sequence to target the HBV plus strand so it could be used to inhibit viral replication (as discussed by WO414). In doing so, they would have produced the 20-mer sequence of SEQ ID NO 226.
WO414, EP063, and Will do not teach the 20-mer ASO comprises a gap segment consisting of linked nucleosides, a 5’wing segment and a 3’ wing segment, each consisting of 1-8 or 4-5 linked modified nucleosides, wherein the gap segment is positioned between the wing segments, wherein the modified nucleoside of each wing segment comprises a 2’-O-methoxyethyl sugar, wherein each linkage is a PS linkage, and wherein all cytidine nt are 5-methylcytidines (Claims 73-79, 83, 89). WO414, EP063, and Will do not teach the compound comprises a salt of the modified ASO or that the salt is a sodium salt (Claims 81-82, 85, and 91-92). WO414, EP063, and Will do not teach the compound wing segments can comprise bicyclic sugar that can be a 4’-CH2-O-2’ bridge (Claims 80 and 90).
However, WO083, drawn to ASO compounds for inhibiting another virus (SARS), teaches claim limitations WO414, EP063, and Will do not teach. WO083 (§Abstract): provides design and synthesis of oligomeric compounds and compositions that can be administered to reduce the activity of SARS virus in vivo or in vitro, to prevent or treat SARS virus-associated disease, to detect AARS virus, and to diagnose SARS virus-associated diseases. WO083 discusses (p. 11 L16-25) ASOs are useful for treating a variety of disease states including other viruses [besides SARS]. That indicates that it was known in the art that ASO compositions can be used to treat, detect, and diagnose a virus and the design techniques disclosed by WO083 could be applied to other viruses.
WO083 teaches (p. 3 L21-25) oligont compositions that can be administered to reduce SARS virus activity in vivo/in vitro or used to detect/diagnose the virus.
Regarding Claims 73-79, 83, 89: WO083 discloses (p. 86 L1-14) ASOs targeting the SARS virus plus strand. WO083 teaches:
chimeric oligonucleotides (“gapmers”) 20 nucleotides in length composed of a central “gap” region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide “wings.” The wings are composed of 2’-O-methoxyethyl nucleotides, also known as 2’-MOE. The internucleoside (backbone) linkages are phosphorothioate (P=S) throughout the oligonucleotide. All cytidine residues are 5- methylcytidines.
Therefore WO083 teaches ASOs comprising a gap segment consisting of 10 linked DNA nt, a 5’ wing segment and a 3’ wing segment wherein each wing segment consists of 5 linked 2’-MOE nt, wherein each inter-nt linkage is a PS linkage, and wherein each C residue is a 5-methylcytosine (i.e., limitations of Claims 73-79, 83, 86, and 89. WO083 teaches (p. 42 L1-20) benefits of such chimeric compounds: they have increased resistance to nuclease degradation, increased cellular uptake, increased stability, and/or increased binding affinity for the target nucleic acid.
Regarding Claims 81-82, 85, and 91-92: WO083 teaches (p. 26 L1-2) their invention encompasses their ASOs in salt form including sodium salt form.
Regarding Claims 80 and 90: WO083 teaches (pp. 30-32 L10-23) LNAs in which the 2’ OH group is linked to the 4’ carbon atom of the sugar ring, thereby forming a 2’-[O], 4’-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2) group…. WO083 teaches (same §) LNA and LNA analogs display very high stabilities with complementary DNA and RNA, stability towards exonucleolytic degradation and good solubility properties.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the 20-mer ASO for targeting HBV’s DR2 region of WO414, EP063, and Will with the teachings about improving ASO binding affinity and stability of WO083, and one would have done so for the benefits of increasing the ASO’s affinity for target mRNA and improving its resistance to nuclease. One would have been motivated to do so with a reasonable expectation of success because WO083 teaches motifs that are suitable for ASOs including virus-targeting ASOs, and it would have been a simple matter to apply the teachings of WO083 (including the 5-10-5 motif, the 5-methylCs, the PS linkages, the 2’-MOE and/or LNA nt) to the 20-mer ASO of WO414, EP063, and Wills.
It would have been obvious to formulate the ASO as the sodium salt of WO083 for the benefit of formulating the ASO in routine and conventional manner.
As discussed above, WO414 teaches producing a pharmaceutically acceptable composition of their ASO and applying PS linkages to improve nuclease resistance.
An artisan would have understood that the modifications taught by WO083 could be applied to any ASO, including any virus-targeting ASO, because improvements in binding affinity and nuclease resistance imparted by such modifications are imparted due to the structure of the modification which affects the shape of the ASO and how it interacts with other shapes. Additionally, WO083 discusses that it is routine and conventional to apply such modifications to ASOs including virus-targeting ASOs.
Therefore the limitations of Claims 45, 73-83, and 85, 89-92 would have been obvious in view of WO414, EP063, Will, and WO083.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 45, 73-83, and 85-92 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-24 of U.S. Patent No. 9145558 (“US558”). This rejection is maintained and updated.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a compound comprising a single-stranded modified 20-mer oligont that is a gapmer consisting of SEQ ID NO 226; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine, wherein each modified nt can comprise a 2-MOE or bicyclic sugar and wherein the bicyclic sugar can comprise bridges as recited in Claim 80; wherein each wing of the gapmer can be 5 nt and the gap can be 10 nt; to a salt or sodium salt of the oligont; and to a composition comprising the oligont and a pharmaceutically acceptable carrier or diluent.
The patented US558 claims are directed to 20-mer compounds that comprise a conjugate and an oligont that is 100% complementary to nt 1583-1602 of SEQ ID NO 1, can comprise a 20-mer gapmer consisting of SEQ ID NO 3, that can comprise 2’-MOE or bicyclic nt; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine; and wherein the gapmer can be a 5-10-5 gapmer, can have various outcomes on target mRNA. US558 SEQ ID NO 3 is 100% complementary to nt 1583-1602 of SEQ ID NO 1 and is 100% identical to claimed SEQ ID NO 226, as shown by the following alignment:
US-14-633-491-3
Filing date in PALM: 2015-02-27
Sequence 3, US/14633491
Patent No. 9145558
GENERAL INFORMATION
APPLICANT: Isis Pharmaceuticals, Inc.
TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR MODULATING HBV EXPRESSION
FILE REFERENCE: BIOL0248US.C1
CURRENT APPLICATION NUMBER: US/14/633,491
CURRENT FILING DATE: 2015-02-27
PRIOR APPLICATION NUMBER: PCT/US2014/036463
PRIOR FILING DATE: 2014-05-01
PRIOR APPLICATION NUMBER: 61/818,442
PRIOR FILING DATE: 2013-05-01
PRIOR APPLICATION NUMBER: 61/823,826
PRIOR FILING DATE: 2013-05-15
PRIOR APPLICATION NUMBER: 61/843,887
PRIOR FILING DATE: 2013-07-08
PRIOR APPLICATION NUMBER: 61/871,673
PRIOR FILING DATE: 2013-08-29
PRIOR APPLICATION NUMBER: 61/880,790
PRIOR FILING DATE: 2013-09-20
PRIOR APPLICATION NUMBER: 61/976,991
PRIOR FILING DATE: 2014-04-08
PRIOR APPLICATION NUMBER: 61/986,867
PRIOR FILING DATE: 2014-04-30
NUMBER OF SEQ ID NOS: 53
SEQ ID NO 3
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial sequence
FEATURE:
OTHER INFORMATION: Synthetic oligonucleotide
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAGGTGAAGCGAAGTGC 20
||||||||||||||||||||
Db 1 GCAGAGGTGAAGCGAAGTGC 20
Both claim sets are directed to gapmer oligont that comprise or consist of the same nt sequence as claimed SEQ ID NO 226. Therefore the invention of the instant claims would have been obvious in view of the patented US558 claims. Although the US558 claims recited a GalNAc conjugate group, it would have been obvious to use the compounds of the US558 claims either with or without the GalNAc conjugate group.
Claims 45, 73-83, and 85, 89-92 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-17 and 23-27 of U.S. Patent No. 9932580 (“US580”) in view of United States Patent No 5728518 (“US518”), and International Patent Application No. WO 2005/023083 (published 15 March 2005, “WO083”). This rejection is maintained and updated.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a compound comprising a single-stranded modified 20-mer oligont that is a gapmer consisting of SEQ ID NO 226; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine, wherein each modified nt can comprise a 2-MOE or bicyclic sugar and wherein the bicyclic sugar can comprise bridges as recited in Claim 80; wherein each wing of the gapmer can be 5 nt and the gap can be 10 nt; to a salt or sodium salt of the oligont; and to a composition comprising the oligont and a pharmaceutically acceptable carrier or diluent.
The patented US580 claims are directed to 20-mer compounds that comprise a conjugate and an oligont that consists of SEQ ID NO 8, that can comprise 2’-MOE or bicyclic nt; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine; and wherein the gapmer can be a 5-10-5 gapmer, can have various outcomes on target mRNA. US580 SEQ ID NO 8 is 90% identical to claimed SEQ ID NO 226, as shown by the following alignment:
US-14-822-493-8
Filing date in PALM: 2015-08-10
Sequence 8, US/14822493
Patent No. 9932580
GENERAL INFORMATION
APPLICANT: Isis Pharmaceuticals, Inc.
TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR MODULATING HBV EXPRESSION
FILE REFERENCE: BIOL0248US.C2
CURRENT APPLICATION NUMBER: US/14/822,493
CURRENT FILING DATE: 2015-08-10
PRIOR APPLICATION NUMBER: 14/633,491
PRIOR FILING DATE: 2015-02-27
PRIOR APPLICATION NUMBER: PCT/US2014/036463
PRIOR FILING DATE: 2014-05-01
PRIOR APPLICATION NUMBER: 61/818,442
PRIOR FILING DATE: 2013-05-01
PRIOR APPLICATION NUMBER: 61/823,826
PRIOR FILING DATE: 2013-05-15
PRIOR APPLICATION NUMBER: 61/843,887
PRIOR FILING DATE: 2013-07-08
PRIOR APPLICATION NUMBER: 61/871,673
PRIOR FILING DATE: 2013-08-29
PRIOR APPLICATION NUMBER: 61/880,790
PRIOR FILING DATE: 2013-09-20
PRIOR APPLICATION NUMBER: 61/976,991
PRIOR FILING DATE: 2014-04-08
PRIOR APPLICATION NUMBER: 61/986,867
PRIOR FILING DATE: 2014-04-30
NUMBER OF SEQ ID NOS: 53
SEQ ID NO 8
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial sequence
FEATURE:
OTHER INFORMATION: Synthetic oligonucleotide
Qy 1 GCAGAGGTGAAGCGAAGT 18
||||||||||||||||||
Db 3 GCAGAGGTGAAGCGAAGT 20
Both claim sets are directed to gapmer oligont that target the same region of claimed SEQ ID NO 226. The US580 claims do not recite the exact sequence that is SEQ ID NO 226.
However, US518, drawn to RNA interference reagents for treating HBV, teaches (§Abstract) oligont for inhibiting HBV replication that can be used in a subject. US518 teaches (p. 12 L25) SEQ ID NO 1, a 25-mer that (Col 2 L 34-40) binds to HBV DNA and (Figs. 1, 3) inhibits its replication. Their SEQ ID NO comprises 100% identity to claimed SEQ ID NO 226, as shown by the following alignment:
US-08-287-337A-1
(NOTE: this sequence has 1 duplicate in the database searched)
Sequence 1, US/08287337A
Patent No. 5728518
GENERAL INFORMATION
APPLICANT: Ellen Carmichael
TITLE OF INVENTION: ANTIVIRAL OLIGONUCLOETIDE
CURRENT APPLICATION NUMBER: US/08/287,337A
NUMBER OF SEQ ID NOS: 9
SEQ ID NO 1
LENGTH: 25
TYPE: DNA
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAGGTGAAGCGAAGTGC 20
||||||||||||||||||||
Db 1 GCAGAGGTGAAGCGAAGTGC 20
The US580 claims and US518 do not teach a bicyclic sugar that comprises a 4’-CH2-O-2’ bridge.
However, WO083, drawn to ASO compounds for inhibiting another virus (SARS), teaches that sugar. WO083 (§Abstract, p. 11 L16-25) ASO design techniques that can be used for virus-targeting ASOs.
WO083 teaches (p. 3 L21-25, p. 86 L1-14, p. 42 L1-20, p. 26 L1-2) strategies for improving ASOs.
Specifically regarding the bicyclic sugar recited in instant Claims 80 and 90: WO083 teaches (pp. 30-32 L10-23) LNAs in which the 2’ OH group is linked to the 4’ carbon atom of the sugar ring, thereby forming a 2’-[O], 4’-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2) group…. WO083 teaches (same §) LNA and LNA analogs display very high stabilities with complementary DNA and RNA, stability towards exonucleolytic degradation and good solubility properties.
Therefore it would have been obvious to modify the invention of the US580 claims with the nt sequence disclosed by US518 for the benefit of targeting another HBV sequence and optimizing anti-HBV effect. It would have been obvious to do so because US518’s SEQ ID NO 1 was shown to inhibit HBV replication, because using inhibiting HBV mRNA with 20-mer gapmers was known in the art and an artisan would have shortened US518’s SEQ ID NO 1 from 25- to 20-mer because shorter oligos would be cheaper to produce and because the US580 claims recite a 5-10-5 gapmer and modified sugars that target the same region as that instantly claimed.
It would have been obvious to modify the 20-mer ASO for targeting HBV’s DR2 region of the US580 claims and US518 with the teachings about LNA sugar improving ASO binding affinity and stability of WO083, and one would have done so for the benefits of increasing the ASO’s affinity for target mRNA and improving its resistance to nuclease. One would have been motivated to do so with a reasonable expectation of success because WO083 teaches LNA and LNA analogs display very high stabilities with complementary DNA and RNA, stability towards exonucleolytic degradation and good solubility properties, and it would have been a simple matter to apply it to the ASOs of the US580 claims and WO518.
Doing so would have produced the invention of the instant claims which therefore would have been obvious in view of the patented US580 claims, US518, and WO083. Although the US580 claims recited a GalNAc conjugate group, it would have been obvious to use the compounds of the US580 claims either with or without the GalNAc conjugate group.
Response to Arguments
Applicant's arguments filed 21 April 2026 have been fully considered but they are not persuasive. Arguments that are no longer relevant are not addressed.
103
Applicant argues (Remarks pp. 6-13) against the 103 rejection. They first argue that (§1) there would have been no motivation to select US518’s DRII(R) compound as a lead compound because it exhibits the lowest IC50 of the compounds in US518.
That is not found persuasive because the art of WO414 teaches targeting specifically the DR2 region on the HBV plus strand to produce ASOs that completely inhibit HBV replication. The only sequence in US518 that targets the DR2 region on the HBV plus strand is SEQ ID NO 1 (i.e., the DRII[R] compound).
In addition EP063 teaches a sequence for HBV diagnostics that an artisan would recognize (based on the art of WO414 and Will) could be modified to target the DR2 region on the HBV plus strand. EP063 shows (Fig. 1) the txs1 primer is the only one that binds to the DR2 region.
Regarding Applicant’s arguments in §2 and §3, most of those arguments are no longer relevant because the references cited in the arguments are no longer cited in the rejections.
Regarding the arguments in §2 ¶2, those aren’t persuasive because WO414 teaches HBV-inhibiting ASOs can work via a variety of mechanisms and (p. 29 L29-32) the invention as claimed, however, is not predicated on any particular mechanism or mechanisms through which the DR2 oligonucleotides act to block HBV replication. This passage from WO414 discussing it doesn’t really matter how the ASOs work, only that they block HBV replication truly highlights the lack of persuasiveness of Applicant’s particular argument. Furthermore, WO083 teaches (p. 42) chimeric gapmers can induce cleavage via RNAseH. Altogether, the art indicates that ASOs that would have been obvious in view of the cited art can “work” to inhibit virus replication via a variety of mechanisms and as long as the ASO targets DR2 on HBV’s plus strand, the inhibition will be (WO414 §Abstract) complete and irreversible.
Furthermore, the claims recite absolutely nothing about the mechanism by which the claimed ASOs “work”, any amount of inhibition they are required to effect, or even that they effect any inhibition. That is because the claims simply recite compounds and those compounds would have been obvious in view of the cited art. Any mechanism by which the compounds work is irrelevant to the claims because the claims don’t recite it.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., any particular IC50 or any mechanism by which ASOs effect inhibition or even that the ASOs effect inhibition) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
Regarding (§3 ¶1, ¶3) to the extent those arguments are relevant to the current rejections, they are not persuasive because the rejection states:
One would have been motivated to do [shorten US518’s ASO] because a shorter antisense oligont is a cheaper oligont (which is relevant when mass-producing a treatment for use in subjects). The easiest way to shorten would have been to remove 5 nt from either end; as discussed above, US518 allows for 20-mer oligos.
That and the benefits imparted by gapers as described in WO083 explain how and why an artisan would have changed a 25-mer ASO to a 20-mer ASO.
Furthermore, the art of EP063 teaches a primer used in diagnosing HBV that is the exact complement of the claimed sequence. The rejection explains why, in view of WO414 and Will, an artisan would have used a sequence that is the complement of that primer sequence in ASOs targeting HBV’s DR2 region on the HBV plus strand.
Regarding Applicant’s arguments about (§4) unexpected results, those are persuasive as they pertain to the specific compound claimed in Claims 86-88 which are not included the 103 rejections. The other claims recite broader genus claims and the unexpected results don’t apply to any compound aside from that claimed in Claims 86-88.
Any arguments in §II are not persuasive because they are against references no longer relied upon.
Therefore none of the arguments are persuasive and the 103 rejection is maintained as it pertains to all claims besides Claims 86-88.
NSDP
Applicant argues (pp. 13-15) the NSDP rejections over US558 and US580 because they say the Federal circuit stated that "the purpose of the ODP doctrine ... is to prevent patentees from obtaining a second patent on a patentably indistinct invention to effectively extend the life of a first patent to that subject matter." Applicant states that US558 and US580 are later filed, they would expire after the claimed invention would expire (if granted), so the NSDP rejections should be withdrawn.
That is not persuasive because the cited cases are not precedential and Office policy requires making such NSDP rejections.
A double patenting rejection also serves public policy interests by preventing the possibility of multiple suits against an accused infringer by different assignees of patents claiming patentably indistinct variations of the same invention. In re Van Ornum, 686 F.2d 937, 944-48, 214 USPQ 761, 767-70 (CCPA 1982).
(MPEP §804 II B)
Regarding Applicant’s arguments that the right to exclude doesn’t apply to later-filed patents, those are not persuasive because the right to exclude is not merely about patent term but also about preventing others from making or using the invention during a patent term. For example, a right to exclude is relevant if the instant claims and the US558 claims were licensed to two different parties. Both claim sets are directed to overlapping subject matter, so enforcing patent/licensing rights in such a case would be problematic.
Information in the § about Terminal Disclaimers touches on common ownership and the right to exclude (MPEP 804.02[IV]):
Each one of the commonly owned conflicting nonstatutory double patenting references must be included in the terminal disclaimer to avoid the problem of dual ownership of patents to patentably indistinct inventions in the event that the patent issuing from the application being examined ceases to be commonly owned with any one of the double patenting references that have issued or may issue as a patent. Note that 37 CFR 1.321(c)(3) requires that a terminal disclaimer for commonly owned conflicting claims "[i]nclude a provision that any patent granted on that application or any patent subject to the reexamination proceeding shall be enforceable only for and during such period that said patent is commonly owned with the application or patent which formed the basis for the judicially created double patenting."
Filing a terminal disclaimer including each one of the conflicting nonstatutory double patenting references is also necessary to avoid the problem of separate enforcement of patents to patentably indistinct inventions by parties to a joint research agreement.
MPEP 804.02(IV)
That describes how the right to exclude, apart from patent term, is relevant to the NSDP rejections.
Regarding Applicant’s arguments (pp. 14-15) that US558 claims recite an improvement over the claimed invention, that is not persuasive because the US558 claims require the exact claimed compound. Regarding Applicant’s arguments that (p. 14, full ¶1) the US558 claims are of different scope than the instant claims, that is not persuasive because the US558 claims encompass the instantly claimed compounds. A person of ordinary skill in the art would, upon reading the US558 claims, immediately envisage the invention claimed in the examined application. See MPEP §804 II B 2 ¶2. It would have been obvious to use the compounds of the US558 and US580 claims either with or without the GalNAc conjugate group.
For those reasons, Applicant’s arguments are unpersuasive and the NSDP rejections are maintained.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
