DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/20/2024 has been entered.
Claim Status
Claims 3, 5, 22, 34, 38, 40, 47, 48, 54, 69, 70, 80, 85, 86, 188-199 are pending and are examined here, along with elected species SEQ ID NO: 4 and Group A of claim 48.
Priority
Acknowledgement is made of applicant’s claim for domestic benefit of U.S. Provisional Applications 63/177,067 and 63/060,369, filed on 04/20/2021 and 08/03/2020, respectively. All examined claims enjoy the benefit of ‘369, filed on 08/03/2020.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 09/2024 were filed before the mailing date of the first Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Nucleotide and/or Amino Acid Sequence Disclosures
The objection to nucleotide disclosure is withdrawn, Tables 9-21 and appropriate sequences of Ex. 2 have SEQ ID NOs.
Claim Interpretation
Claim 54 provides limitation to the functional moiety, however the placement of “optionally” and “and/or” results in interpretation that all subsequent limitations are optional, such as the functional moiety as hydrophobic is optional and the “and/or” before “the functional moiety is linked to the antisense strand and/or sense strand by a linker” results in limitation of the linker groups as optional too, so reciting a list of species for linker group is optional. Thus claim 54 is interpreted to at least recite functional moiety is linked to the 5’ and/or 3’ end(s) with other limitations as optional.
Examiner’s Comment:
For improved clarity, claims 47 and 48, element 4 should recite “the nucleotides at positions 1 through 7 from the 3’ end of the antisense strand are connected to each other via phosphorothioate internucleotide linkage;” or alternatively “the nucleotides at positions 1-2 to 6-7 from the 3’ end of the antisense strand are connected to each other via phosphorothioate internucleotide linkage;” the recitation of positions 1-2 to 1-7 creates confusion, since positions 1-7 encompasses position 1-2. Par. 151 formula IV provides support.
Claim Rejections - 35 USC § 112
35 U.S.C. 112(b):
The rejection of claims 5, 22, 34, 38, 40, 47, 48, 54, 69, 70, 80, 85, 86, 188-199 under 112(b) is maintained.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 3, 5, 22, 34, 38, 40, 47, 48, 54, 69, 70, 80, 85, 86, 188-199 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “sufficiently complementary” in claims 3, 47, 48, 80 is a relative term which renders the claim indefinite. The term “sufficiently complementary” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Par. 234 provides a functional definition but lacks a structural limitation, i.e. a percentage of complementarity between two strands or number of allowed mismatched nucleotides: Par. 234 provides the following: antisense strand or first strand has “e.g., complementarity sufficient to trigger the destruction of the desired target mRNA by the RNAi machinery or process (RNAi interference) or complementarity sufficient to trigger translational repression of the desired target mRNA.” This functional definition fails “to provide a clear-cut indication of the scope of the subject matter embraced by the claim” and thus is indefinite under MPEP 2173.05(g), i.e. it is not clear what sequence(s) give sufficient complementarity to achieve the function.
Here claim 5 is also rejected since it is not clear whether only 10 contiguous nt. out of an antisense strand of 21 nt. will be sufficient to direct silencing of target transcript.
Here, claim 188 is also rejected since it is not clear whether 3 mismatches anywhere within an antisense strand comprising 15 nt. would allow silencing of target transcript.
Dependent claims 5, 22, 34, 38, 40, 47, 48, 54, 69, 70, 80, 85, 86, 188-199 are also rejected for failing to overcome 112b indefiniteness.
In the interest of compact prosecution and for the purpose of art rejection, the limitation the antisense strand comprises a sequence sufficiently complementary is interpreted to comprise a sequence that has a sub-sequence with a total of 7 complementary nt.
The term “about” in claims 3, 80, 192, 199 is a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The specification does not define “about.”
In the interest of compact prosecution, the claim is interpreted without the term “about.”
Dependent claims 5, 22, 34, 38, 40, 47, 48, 54, 69, 70, 80, 85, 86, 188-199 are also rejected for failing to overcome 112b indefiniteness.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 47 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 47, dependent of instant claim 3, recites the limitation “(2) the antisense strand comprises alternating 2’-methoxy-ribonucleotides and 2’-fluoro-ribonucleotides" in line 5-6. Claim 3 requires “nucleotides at positions 4, 5, and 6 from the 5’ end of the antisense strand are not 2’-methoxy-ribonucleotides,” thus there is a break in alternating 2’-methoxy-ribounucleotide and 2’-fluoro-ribonucleotides motif. It appears that claim 47 does not include all of the limitations of the claim from which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
In the interest of compact prosecution, the claim is interpreted that alternating 2’-O-methyl (2OMe) and 2-fluoro (2F) nt. modification motif substitutes the position 4, 5, and 6 from the 5’ end of the antisense strand without 2-methoxy-ribonucleotides modification.
Response to Arguments
Applicant's arguments filed 08/21/2024 have been fully considered but they are not persuasive. The Remarks indicate that amended cl. 3 incorporates limitation of claim 9, since it was not included in the rejection. Upon further consideration the argument and amendment is not persuasive, since the claim lacks sufficient guidance regarding the metes and bounds of the term “sufficiently complementarity.” Thus the rejection is maintained.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 3, 22, 34, 40, 54, 70, 192–198 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hu et al. (6/19/2020, Signal Transduction and Targeted Therapy, 5, 101, 1-25, referred as Hu).
Regarding instant cl. 3, elected SEQ ID NO: 4 is the following sequence: ggagugcaaugaugugaucucagcucacuaaaaccucuaccucc, a 45 nt. of HTT-1A variant. Further, the claim recites “a sequence sufficiently complementary to a huntingtin variant 1A (HTT-1A) nucleic acid sequence of” elected SEQ ID NO: 4 to direct silencing of a HTT-1A gene. Under broad reasonable interpretation, “a sequence” can be interpreted to encompass a sequence of a shorter length than the (par. 9) that has sufficient complementary to a region of SEQ ID NO: 4.
Hu discloses fully modified inclisiran/ALN-PCSsc that is a dsRNA comprising a sense and antisense strands, each separately comprising a 5’ end and a 3’ end, wherein the sense strand comprises 21 nucleotide (nt.) and the antisense strand comprises 23 nt. in length (Fig. 3, pg. 5; see edited excerpt of Fig. 3 below).
PNG
media_image1.png
98
568
media_image1.png
Greyscale
The antisense strand comprises a sequence that is at least 7 nt. that are complementary across a 15 nt. sequence of instant SEQ ID NO: 4 (see alignment below). Further, the antisense strand comprises at least 50% 2-O-methyl modification (2OMe), 14/23 are 2OMe, the remaining nt. on the antisense strand comprise 2-fluoro (2F) modification (9/23) at positions 4, 5, and 6, which are not 2OMe modification.
Alignment instant SEQ ID NO: 4 and Hu’s Inclisiran full modified (Fig. 3).
Query Match 11.6%; Score 5.2; DB 1; Length 23;
Best Local Similarity 70.0%;
Matches 7; Conservative 0; Mismatches 3; Indels 0; Gaps 0;
Instant SEQ ID NO: 4 30 AAAACCUCUA 39
|| | ||||
Hu Inclisiran: 11 AACAGGUCUA 20
Although, Hu’s inclisiran does not target HTT-1A gene, it encompasses the structural requirement of claim 3, and, absent evidence to the contrary meets recited functional limitation, i.e. sufficiently complementary to bind to the target HTT-1A gene and direct its silencing. Here, the specification does not provide sufficient clear explicit guidance regarding the functional limitation of “to direct silencing of a HTT-1A gene.”
Regarding instant cl. 22, Hu’s Inclisiran dsRNA has a blunt end.
Regarding instant cl. 34, Hu’s inclisiran dsRNA has one modified internucleotide linkage of Formula 1, the thick lines in between nt. represents phosphorothioate linkage (i.e. Z is O, Y is S, W is O).
Regarding instant cl. 40, Hu’s Inclisiran dsRNA has a sense strand with at least 65% 2OMe nt. modification. 18/21 nt. (85%) comprise 2OMe modification.
Regarding instant cl. 54, Hu’s Inclisiran dsRNA has a functional moiety, N-acetyl-galactose (GalNAc) moieties, linked to the 3’ end of the sense strand.
Regarding instant cl. 70, Hu discloses that siRNAs can be delivered via lipid nanoparticles or specific ligand-siRNA conjugates can transport siRNA to desired tissues and cells (pg. 8), thus these carriers are pharmaceutically acceptable carrier, and “inhibiting the expression of HTT-1A gene” is the intended use of dsRNA of claim 3, and the structure of claim 3 is disclosed in rejection above.
Regarding instant cl. 192, the dsRNA of Hu’s Inclisiran has 2 nt. overhang, thus comprising at least one single stranded nt. overhang.
Regarding instant cl. 193, Hu’s Inclisiran comprises a thymine, a naturally occurring nt., on the sense strand at position 11 from 5’ end (see fig. above).
Regarding instant cl. 194, Hu’s Inclisiran comprises at least one modified nt., a 2’-deoxy-2’-fluoro modified nt. (see figure above).
Regarding instant cl. 195, Hu’s Inclisiran comprises at least one modified internucleotide linkage (INL), a phosphorothioate linkage (see figure above, bold lines in between nt. at terminal end of antisense strand).
Regarding instant cl. 196, 197, Hu’s Inclisiran comprises at least 80% chemically modified nt. and all the nt. are modified.
Regarding instant cl. 198, Hu’s Inclisiran comprises 32/44 nt. (~73%) that comprise 2OMe nt. modification, thus the dsRNA comprises at least 70% 2OMe nt. modifications.
Response to Arguments
Applicant’s arguments, see pg. 14-15, filed 08/21/2024, with respect to the rejection(s) of claim(s) 3, 22, 34, 70, 192, 193, 194, 195 under 102(a)(1) have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of Hu.
Claim Rejections - 35 USC § 103
Rejection of claims 38, 40, 47, 48, 196-198, 54, 69, 80, 85, 86 under 35 U.S.C. 103 is maintained.
35 U.S.C. 103 rejection
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 3, 5, 22, 34, 38, 70, 188, 189, 190, 191, 199 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (US Pat. 7820809, issued 10/26/2010, referred to as Khvorova ‘809, of record) and Hu et al. (6/19/2020, Signal Transduction and Targeted Therapy, 5, 101, 1-25, referred as Hu).
Regarding instant cl. 3, 34, elected SEQ ID NO: 4 is the following sequence: ggagugcaaugaugugaucucagcucacuaaaaccucuaccucc, a 45 nt. of HTT-1A variant. Further, the claim recites “a sequence sufficiently complementary to a huntingtin variant 1A (HTT-1A) nucleic acid sequence of” elected SEQ ID NO: 4 to direct silencing of a HTT-1A gene. Under broad reasonable interpretation, “a sequence” can be interpreted to encompass a sequence of at least 8 nt. in length (par. 9) that has sufficient complementary to a region of SEQ ID NO: 4.
Khvorova ‘809 discloses SEQ ID NO: 124140, which comprises the following 19 nt. sequence: gaucucagcucacuacaac, and matches 18 nt. of instant SEQ ID NO: 4 (bolded/underlined region). Khvorova ‘809 discloses that all siRNA duplexes are referred as sense strand (Col. 35, line 15-16). Fig. 1 discloses a dsRNA molecule comprising a sense and antisense strands, each with a separate 5’ end a 3’ end, and the siRNA comprises 18 and 30 bp, more preferably between 18 and 25 bp region, and most preferably 19 bp (Col. 30, lines 61-63); thus the antisense and sense strands is 19 nt. in length. Khvorova ‘809 discloses 2OMe modification of sense strand (Col. 28, line 42-44).
Here, Khvorova ‘809 does not disclose antisense strand at least 50% 2OMe nt. modification nor the nt. at position 4, 5, 6 from the 5’ end of the antisense strand are not 2’-methoxy-ribonucleotides.
Hu discloses that siRNA therapeutics with completely unmodified or slightly modified siRNA were limited in their efficacy and had potential off-target effects (pg. 2) and therefore to enhance the potency and reduce the potential toxicity of siRNA, numerous chemical modification geometries have been established (pg. 2). Hu discloses various modification patterns used in clinical studies or for commercial siRNA (pg. 6, Fig. 3), and one of the drug is inclisiran, a dsRNA molecule, with fully modified nt. and its modification pattern has at least 50% 2OMe nt. modifications with nt. at position 4, 5, 6 that are not 2OMe modified, along with phosphorothioate INL (relevant to instant cl. 3, 34; see Fig. 3, also illustrated above). Fig. 5j illustrates a “potent and durable gene silencing” and a reduction of its target gene after a single dose of inclisiran (pg. 9, 19).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified Khvorova ‘809’s SEQ ID NO: 124140 with a modification pattern of siRNAs of Fig. 3 of Hu and arrive at the claimed invention with a reasonable expectation of success. Here, a skilled artisan would utilize one of the modification pattern of siRNAs of Fig. 3, including inclisiran, which had at least 50% nt. with 2OMe modification with nt. at position 4, 5, 6 of antisense strand as 2F and had a potent and long term effect, and would expect successful result of potent and durable gene silencing. Thus, instant cl. 3 is obvious.
Regarding instant cl. 5, Khvorova ‘809 SEQ ID NO: 124140 has at least 10 contiguous nt. of elected SEQ ID NO: 4, and thus an antisense with 100% complementarity would also have 10 contiguous nt. that is complementary to at least 13 contiguous nt. of instant SEQ ID NO: 4.
Regarding instant cl. 22, Khvorova ‘809 contemplates in claim 1 siRNA with no overhang regions, i.e. dsRNA with blunt ends.
Regarding instant cl. 70, Khvorova ‘809 discloses siRNA of kit is applied to cell through transfection and may include lipid-based carriers. Further Khvorova ‘809 discloses that certain applications to deliver molecules without transfection by simply formulating in a physiological acceptable solution.
Regarding instant cl. 188, Khvorova ‘809 comprises a duplex consisting of SEQ ID NO: 124140 that has no more than 3 mismatches with a region of elected SEQ ID NO: 4.
Regarding instant cl. 189, Khvorova indicates sense strand maybe 18 base pairs in length (For formula IX, where the sense strand is only 18 base pairs in length, the value of C19 is 0 (Col. 18, 48-49).
Regarding instant cl. 190, Khvorova ‘809 defines duplex region as polynucleotide strand having 21 nt. units that can base pair with another polynucleotide of 21 nt. units (Col. 11, lines 55-57). Therefore, in this scenario both strands are 21-nt, one strand is the antisense and is 21 nt. in length.
Regarding instant cl. 191, Khvorova ‘809 discloses in the scenario of 21 long polynucleotide base pairing with 21 nt. long polynucleotide, the duplex region would be 19 base pairs. (Col. 11, lines 58-60), thus is between 15 to 20 base pairs and anticipates claim 191.
Regarding instant cl. 38 and 199, Khvorova ‘809 does not disclose 70% 2OMe nt. modifications.
Hu discloses various nucleotide modification patterns of siRNA comprising 2OMe, 2F, and PS INL used in clinical studies or for commercial siRNA (see Fig. 3, pg. 5). One of the modification pattern, the STC, i.e. standard template chemistry (pg. 6), which based on their clinical studies caused “strong concern,” and thus other modification patterns were studied to identify improved and potentially safer modification pattern, labeled as “enhanced stabilization chemistry” (ESC) (pg. 7). Fig. 3 illustrates multiple advanced ESCs (examples are designated DV22 and DV18), which have AS that have 2OMe nt. modification content greater than 70% (DV18=17/23 [74% 2OMe nt. modified]; DV22=19/23 [83% 2OMe nt. modified]). ESC also comprises a few more PS INL and reduced 2F substitution, since “heavy use of 2’-F may magnify toxicity” (pg. 7). siRNA comprising an ESC modification pattern provide a potent long term inhibition after a single dose in monkeys (see Fig. 4e, pg. 7) along with reduced liver exposure (see Fig. 4b).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Here, Hu discloses that certain modification pattern raise a concern in their potential toxicity. Thus, by modifying positions of and percentage of known 2’ nt. modifications (2OMe and 2F) along with PS-INL were proposed and these new modification patterns were tested to identify equally or improved siRNAs with reduced toxic effects.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried Khvorova ‘809’s SEQ ID NO: 124140 with a modification pattern of siRNAs of Fig. 3 of Hu and arrive at the claimed invention with a reasonable expectation of success. Here, Hu’s figure 3 provides several fully modified ESC modification patterns that can be tried to identify an ideal/preferred therapeutic activity profile, i.e. increased inhibitory with low toxicity effects. Thus a skilled artisan utilizing one of the ESC modification pattern would expect a successful result, i.e. an ideal/preferred therapeutic profile. Thus, claims 38 and 199 are obvious.
Claims 47, 48, 69 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (US Pat. 7820809, issued 10/26/2010, referred to as Khvorova ‘809, of record) and Hu et al. (6/19/2020, Signal Transduction and Targeted Therapy, 5, 101, 1-25, referred as Hu) as applied to claims 3, 5, 22, 34, 38, 70, 188, 189, 190, 191, 199 above, and further in view of Khvorova et al. (US Pub. 20190024082, pub. date 1/24/2019, referred to as Khvorova ‘082, of record).
Regarding instant cl. 47, 48 and 69, Khvorova does not disclose the limitations of cl. 48 nor 69..
Both Khvorova ‘809 and Hu disclose siRNAs with phosphorothioate internucleotide linkages (PS-INL). However, Hu notes that PS modification has some drawbacks, including interfering with binding of siRNA to target transcript and “chemistry-related toxicities with a high PS content” (pg. 4). Thus, although PS modification is still very important and necessary for siRNA compared to unmodified oligonucleotides since they provide resistance to nucleases, “the position and number of PS linkages are pivotal” (pg. 4). Hu discloses various ESC fully modified siRNAs with both sense and antisense strands with at least 70% 2OMe nt. modification content (elements 2, 6, relevant to instant cl. 48) and have PS linkage at position 1-2 from the 5’ end of the sense strand (element 7, relevant to instant cl. 48, 47), also discloses that all antisense strands (total of 15) except 1 do not have a 2OMe at position 14 (element 3, relevant to instant cl. 48), and all siRNA have portion of antisense strand that is complementary to portion of sense strand (element 5, relevant to instant cl. 48, 47).
Neither Khvorova ‘809 and Hu disclose element 4 of elected Group A embodiment of cl. 48 nor PS-INLs of cl. 69.
Khvorova ‘082 discloses various embodiments of two-tailed siRNAs, where there is a longer stretch of overhangs, ranging from 4-7 nt. (see Fig. 2). First, overall Khvorova ‘082 discloses PS linkages for the overhang nt. stretch for protection (Fig. 2). Fig. 2 of Khvorova ‘082, illustrates PS linkages at positions 1-7 from 3’ end of AS strands (top strand in siRNAs) (element 4, relevant to instant cl. 48, 47). Khvorova ‘082 also has PS-INLs in between nt. position 1 and 2 from the 3’ end of the sense strand and from the 5’ end of antisense strands (Fig. 2, relevant to instant cl. 69). Khvorova ‘082 in Example 5 demonstrates that two-tailed siRNAs was delivered throughout the injected hemisphere of the brain in vivo of mice following intrastatial injection and had a significantly higher distribution compared to one-tailed siRNAs (par. 208-209). Khvorova ‘082 Fig. 2 discloses antisense strand comprising an alternating 2OMe and 2F nt. modification in the duplex region (elements 2 and 6, relevant to instant cl. 47), the antisense strand do not have 2OMe nt. at pos. 2 and 14 from 5’ end, .
Similarly here Hu discloses the recognized problem of potential toxicity issues of high PS-linkage content and one obvious to try solution is to reduce the PS linkage content while maintaining in-vivo stability of the siRNA. Other as illustrated by Khvorova ‘082 is to try different embodiments of siRNAs, i.e. a two-tailed siRNAs with a longer stretch of overhangs with PS-linkages mostly at the terminal exposed ends.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to obviously tried reducing the overall 2F modified nt. content in a siRNA of Hu in a fully modified siRNA of SEQ ID NO: 124140 of Khvorova ‘809 in view of Khvorova ‘082 and arrive at the claimed invention with a reasonable expectation of success. Here since Hu discloses the potential toxicity due to high 2F content and extensive PS linkages, a skilled artisan can reduce PS by only incorporating PS linkages in overhang stretches of two-tailed siRNAs of Khvorova ‘082 to protect the overhangs from nucleases and . Thus, claims 47, 48 and 69 are obvious.
Claims 80, 85, 86 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (US Pat. 7820809, issued 10/26/2010, referred to as Khvorova ‘809, of record) and Aguiar et al. (2017, Translational Neurodeg., 6, pg. 1-10, referred as Aguiar) and as evidenced by Lee et al. ((2018, Current Opinion in Biomedical Engineering, pg. 59, of record) for cl. 86.
Khvorova ‘809 discloses SEQ ID NO: 124140, which comprises the following 19 nt. sequence: gaucucagcucacuacaac, and matches 18 nt. of instant SEQ ID NO: 4 (bolded/underlined region). Khvorova ‘809 discloses that all siRNA duplexes are referred as sense strand (Col. 35, line 15-16). Fig. 1 discloses a dsRNA molecule comprising a sense and antisense strands, each with a separate 5’ end a 3’ end, and the siRNA comprises 18 and 30 bp, more preferably between 18 and 25 bp region, and most preferably 19 bp (Col. 30, lines 61-63); thus the antisense and sense strands is 19 nt. in length. Khvorova ‘809 discloses synthesizing equivalent DNA sequences (either as two separate, complementary strands, or as hairpin molecules) instead of siRNA sequences and introducing them into cells through vectors, including adenoviruses, retroviruses, lentivirus-based vectors (Col. 32, lines 58-67, Col. 33, lines 1-2). Fig. 1 discloses the processing of dsRNA molecule into a siRNA molecule with sense and antisense strand each comprising a 5’ and 3’ ends.
Khvorova ‘809 does not disclose the regulatory sequence or recombinant adeno-associated virus.
Aguiar is a review article of RNAi mechanisms in Huntington’s disease therapy, noting the use a single adeno-associated virus (AAV) mediated short hairpin RNA (shRNA) delivery which after a single dosing can last years with low toxicity, as opposed to multiple dosing of siRNAs (abstract, relevant to instant cl. 86); the shRNA is processed into a double-stranded siRNA with 5’ and 3’ ends (see Fig. 2, relevant to instant cl. 80). shRNA can be incorporated into adeno-associated virus (AAV), which are vectors of choice in clinical trials because of their low immunogenicity and are episomal, i.e. very low rate of chromosomal integration (pg. 5). Further shRNA can be cloned into available vectors, containing various promoters, such as U6, H1, CMV (pg. 5, relevant to instant cl. 80). Since the rejection meets all the structural limitation recited in the claim and, absent evidence to the contrary the prior art structure also meets the recited functional limitation, the vector expressed shRNA will inhibit the expression of the HTT-1A gene by at least 30% (relevant to instant cl. 80). Aguiar discloses an AAV5 administration in non-human primates resulted in extensive expression throughout the brain (pg. 7, relevant to instant cl. 85). As evidenced by Lee et al., the inherent structure of rAAV is packaged viral genome within the capsid (2018, Current Opinion in Biomedical Engineering, pg. 59, relevant to instant cl. 86).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have substituted vector encoding dsRNA comprising SEQ ID NO: 124140 of Khvorova ‘809 in view of Aguiar and arrive at the claimed invention with a reasonable expectation of success. Here, because both Aguiar and Khvorova ‘809 teach using a viral vector to deliver siRNA to cells, a skilled artisan would expect substituting adenovirus encoding dsRNA comprising SEQ ID NO: 124140 of Khvorova ‘809 with rAAV of Aguiar would successfully result in transducing neural cells with AAV encoding dsRNA comprising SEQ ID NO: 124140. Thus claims 80, 85 and 86 are obvious.
Response to Arguments
Applicant’s arguments, see pg. 15-16, filed 08/21/2024, with respect to the rejection(s) of claims 38, 47, 48, 69 under 103 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of Khvorova et al. (US Pat. 7820809, issued 10/26/2010, referred to as Khvorova ‘809) and Hu et al. Hu et al. addresses the amendments.
Applicant’s arguments, see pg. 16-17, filed 08/21/2024, with respect to the rejection(s) of claims 80, 85, 86 under 103 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of Khvorova et al. (US Pat. 7820809, issued 10/26/2010, referred to as Khvorova ‘809) and Aguiar et al. (2017, Translational Neurodeg., 6, pg. 1-10, referred as Aguiar) and as evidenced by Lee et al. ((2018, Current Opinion in Biomedical Engineering, pg. 59) for cl. 86. As noted above, the references combined teach the recited limitations and since the structure is obvious then absent evidence to the contrary the prior art structure also meets the recited functional limitation.
Allowable Subject Matter
No claims allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600