Prosecution Insights
Last updated: October 02, 2026
Application No. 17/396,381

COMPOSITIONS AND METHODS FOR CONVERTING STYRENE TO BIODEGRADABLE ALTERNATIVES

Non-Final OA §103§112
Filed
Aug 06, 2021
Priority
Aug 06, 2020 — provisional 63/061,969
Examiner
RAMIREZ, DELIA M
Art Unit
1652
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Virginia Patent Foundation
OA Round
3 (Non-Final)
65%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allowance Rate
557 granted / 855 resolved
+5.1% vs TC avg
Strong +56% interview lift
Without
With
+56.3%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
51 currently pending
Career history
902
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
21.9%
-18.1% vs TC avg
§102
19.5%
-20.5% vs TC avg
§112
37.9%
-2.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 855 resolved cases

Office Action

§103 §112
DETAILED ACTION Status of the Application Claims 1-2, 5-7, 12, 15, 17, 24-26, 29, 48-51, 78-79 are pending. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment of claims 1, 5-7, 17, 25-26, 29, and addition of claims 78-79 as submitted in a communication filed on 5/11/2026 is acknowledged. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 5/11/2026 has been entered. New claims 78-79 are directed to the elected invention. Claims 48-51 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 3/19/2024. Claims 1-2, 5-7, 12, 15, 17, 24-26, 29, 78-79 are at issue and will be examined to the extent they encompass the elected invention. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Rejections and/or objections not reiterated from previous office actions are hereby withdrawn. Information Disclosure Statement The information disclosure statement (IDS) submitted on 5/11/2026 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Objections Claims 7, 17 are objected to due to the recitation of “SEQ ID NOs: ”. To be consistent with the proper format for sequence identifiers, the term should be amended to recite “SEQ ID NO:”. Applicant argues that this objection should be withdrawn referring to 37 CFR § 1.821(d). Applicant further argues that the use of “SEQ ID NO:” refers to single sequences. Applicant further submits that issued patents also use the term “SEQ ID NOs:”. This is not found persuasive. While it is agreed 37 CFR § 1.821(d) recites the term “the like”, there is no indication that this term should be interpreted as encompassing “SEQ ID NOs:”. Also, while the term “SEQ ID NO:” could be interpreted as referring to a single sequence if the term is followed by a single number, one cannot reasonably conclude that the term refers to a single sequence if the term is followed by several numbers. As set forth in 37 CFR § 1.821 (d), reference to a sequence requires a sequence identifier preceded by the term “SEQ ID NO:”. Appropriate correction is required. Claims 17 and 78 are objected to due to the recitation of “in vivo system of any claim 7”. The term should be amended to recite “in vivo system of claim 7”. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) or Second Paragraph (pre-AIA ) Claims 12, 15, 17, 26, 29 remain rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 12 (claim 15 dependent thereon) is indefinite in the recitation of “….and fourth coding sequences are under transcriptional control of a first promoter that is active in the bacterium to thereby direct expression of the first, second…and fourth coding sequences in the bacterium, and the fifth, sixth, and seventh coding sequences are under transcriptional control of a second promoter that is active in the bacterium to thereby direct expression of the fifth, sixth, and seventh coding sequences in the bacterium..” for the following reasons. As previously explained, a coding sequence is a graphical representation of the order in which nucleotides are arranged in a nucleic acid. As known in the art, the expression of nucleic acids (or genes) is controlled by promoters. Therefore, while the expression of nucleic acids can be under the control of a promoter, it is unclear as to how a coding sequence, which is a graphical representation of the region of a nucleic acid that encodes a protein, can be expressed in a cell or how a coding sequence can be under the control of a promoter. Applicant argues that one of skill in the art, a coding sequence is not merely a graphical representation. Applicant states that one of skill in the art would understand that a coding sequence is that part of a larger nucleotide sequence that starts with an initiator codon and ends with a terminator codon. Applicant states that while it may be true that nucleotide sequences generally can be under transcriptional control of a promoter, when those nucleotide sequences include coding sequences, those coding sequences are also under transcriptional control of a promoter. Therefore, Applicant is of the opinion that transcription of nucleotide sequences that include coding sequences result in mRNAs that include coding sequences. Applicant concludes that there is nothing graphical about the term coding sequence. This is not found persuasive to overcome the instant rejection. Applicant is directed to the previously provided evidence which shows that it is well known in the art that a nucleotide sequence is the representation of the order in which nucleotides are arranged in a polynucleotide. See the nucleotide sequence definition provided with the prior Office action by ScienceDirect and BOC Sciences. Therefore, contrary to Applicant’s assertion, a coding sequence is a graphical representation of the order in which nucleotides are arranged in a nucleic acid molecule. A nucleotide sequence is not a nucleic acid molecule. As such, a nucleotide sequence cannot be under transcriptional control of a promoter. A gene or a polynucleotide encoding a protein can be under transcriptional control of a promoter. It is a gene or a polynucleotide encoding a protein which is transcribed to create an mRNA, which is also a nucleic acid molecule and not a nucleotide sequence. It is reiterated herein that a polynucleotide comprises a nucleotide sequence but it is not a nucleotide sequence. For examination purposes, it will be assumed that the nucleic acids encoding the recited enzymes are under transcriptional control of the recited promoters. Correction is required. Claims 17 and 78 are indefinite in the recitation of “…and also comprises a single transcription terminator 3’ to the first, second…and fourth coding sequences….(ii)..and also comprises a single transcription terminator 3’ to the fifth, sixth, and seventh coding sequences.…...” and “…and a single transcription terminator 3’ to the first, second, third, and fourth coding….and a single transcription terminator 3’ to the fifth, sixth, and seventh….” for the following reasons. As written, it is unclear if the first plasmid should comprise the single transcription terminator at the 3’ of the fourth coding sequence, or if the plasmid is required to have a single transcription terminator at the 3’ of the first coding sequence, at the 3’ end of the second coding sequence, at the 3’ of the third coding sequence and at the 3’ end of the fourth coding sequence for a total of four transcription terminators. In addition, as written, it is unclear if the second plasmid is required to comprise the single transcription terminator at the 3’ end of the seventh coding sequence, or if the second plasmid is required to have a single transcription terminator at the 3’ end of the fifth coding sequence, at the 3’ end of the sixth coding sequence and at the end of the 3’ end of the seventh coding sequence for a total of three transcription terminators. Applicant argues that based on what is shown in Figures 10D and 10E, the language recited indicates that there is one single terminator located downstream of the styA-D coding sequences. This is not found persuasive. The Examiner acknowledges the cited figures. However, the language currently recited is ambiguous, particularly because the claim recites “3’ to the first, second…and fourth coding sequences” and “3’ to the fifth, sixth, and seventh coding sequences”. This phrases are not consistent with the cited figures. If the intended limitation is a singe transcription terminator 3’ to the nucleic acid encoding the phenylacetaldehyde dehydrogenase, and a single transcription terminator 3’ to the nucleic acid encoding the class I poly(R)-hydroxyalkanoic acid synthase, the claim should be amended accordingly. Correction is required. Claim 29 is indefinite in the recitation of “.. (a) the first plasmid optionally comprises….and/or (b) the second plasmid optionally comprises an origin of replication comprising nucleotides 7785-80369 or .,..of SEQ ID NO: 72, or both, and/or an antibiotic resistance gene….of SEQ ID NO: 72” for the following reasons. Applicant argues that claim 29 recites limitations regarding epitope tags, thus having a different scope than either claims 6 or 7. This is not found persuasive. While it is agreed that claim 29 recites limitations regarding epitope tags and has a different scope with regard to claim 6 and claim 7, the issue is that the limitation “.. (a) the first plasmid optionally comprises….and/or (b) the second plasmid optionally comprises an origin of replication comprising nucleotides 7785-80369 or .,..of SEQ ID NO: 72, or both, and/or an antibiotic resistance gene….of SEQ ID NO: 72” is already encompassed by claim 29 by virtue of the fact that this limitation is part of claim 6, from which claim 29 ultimately depends. In view of the fact that claim 6 specifically recites the same limitations recited in claim 29 in items (a) and (b), and the fact that these limitation are already encompassed by claim 29 due to its dependency on claims 6 and 7, it is unclear as to how the limitations recited in parts (a) and (b) recited in claim 29 further limit the scope of claim 29. Correction is required. Claim 79 is indefinite in the recitation of “wherein:….any combination thereof” for the following reasons. It is unclear as to which is the intended limitation. There is no indication as to what “thereof” is related to. For examination purposes, it will be assumed that the limitations recited with regard to the first, fourth, fifth, seventh and eight sequence are in the alternative. Correction is required. When amending the claims, applicant is advised to carefully review all examined claims and make the necessary changes to ensure proper antecedent basis and dependency. Claim Rejections - 35 USC § 112(a) or First Paragraph (pre-AIA ) Claims 1-2, 5-7, 12, 15, 17, 24-26, 29 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description and enablement requirements. In view of Applicant’s amendment of claim 1, which now requires a bacterium that comprises plasmids encoding the proteins of SEQ ID NO: 2, 6, 8, 14, 26, 32, and 36, or a bacterium that comprises plasmids encoding the proteins of 2, 6, 8, 14, 26, 32, 20, and 36, these rejections are hereby withdrawn. Claim Rejections - 35 USC § 103 (AIA ) Claims 1-2, 5-7, 12, 15, 17, 25, 26, 29 remain rejected under 35 U.S.C. 103 as being unpatentable over Arshad et al. (Front Biol 12(3):210-218, 2017) in view of Antonio et al. (FEMS Microbiology Letters 182:111-117, 2000), Marconi et al. (Applied and Environmental Microbiology 62(1):121-127, 1996), Beltrametti et al. (Applied and Environmental Microbiology 63(6):2232-2239, 1997), and Ayyadurai et al. (Biotechnology and Bioprocess Engineering 14:257-265, 2009) as evidenced by SnapGene entry for T5 promoter (2024), and Wu et al. (GenBank accession number QBK40993 3/12/2019; GenBank accession number QBK40994 3/12/2019; GenBank accession number QBK40992 3/12/2019). Claim 24 remains rejected under 35 U.S.C. 103 as being unpatentable over Arshad et al. (Front Biol 12(3):210-218, 2017) in view of Antonio et al. (FEMS Microbiology Letters 182:111-117, 2000), Marconi et al. (Applied and Environmental Microbiology 62(1):121-127, 1996), Beltrametti et al. (Applied and Environmental Microbiology 63(6):2232-2239, 1997), Ayyadurai et al. (Biotechnology and Bioprocess Engineering 14:257-265, 2009) as evidenced by SnapGene entry for T5 promoter (2024), Wu et al. (GenBank accession number QBK40993 3/12/2019; GenBank accession number QBK40994 3/12/2019; GenBank accession number QBK40992 3/12/2019), and further in view of Hartmans et al. (Applied and Environmental Microbiology 56(5):1347-1351, 1990). These rejections have been discussed at length in the prior Office action. They are maintained for the reasons of record and those set forth below. Applicant argues that there is no suggestion in the combination of Arshad et al., Antonio et al., Marconi et al., Beltrametti et al., Ayyadurai et al., Snapgene and Wu et al. either alone or in combination to transform any bacterium with both the plasmid of Antonio et al. and a plasmid that comprises the P. fluorescens genes of Marconi et al. and Beltrametti et al. operably linked to a T5 promoter because Arshad et al. discloses synthesis of polyhydroxyalkanoate from styrene by a bacterial cell, wherein the polyhydroxyalkanoate is homopolymer PHB and copolymer PHB-co-PHV. Applicant states that there is no motivation from one of ordinary skill in the art to have looked outside of Arshad et al. because the goal of the instant claimed system is to convert styrene to PHB, which is already accomplished by Arshad et al. Applicant states that if Arshad et al. already accomplishes the goal of the presently claimed subject matter, then one of ordinary skill in the art would have no reason to modify the primary reference. Applicant states that there no rationale for replacing the Enterobacter spp. genes of Arshad et al. with the P. fluorescens genes and the R. eutropha PHB operon as currently claimed. Applicant states that the mere fact that one of ordinary skill in the art could have replaced the Enterobacter genes of Arshad et al. with the P. fluorescens genes and the R. eutropha PHB operon is not sufficient to render the instant claims obvious. Applicant cites MPEP § 2143.01(IV) in support of the argument that there has to be an objective reason to combine the teachings of the references. Applicant states that the only basis for combining the cited prior art is impermissible hindsight. Applicant states that the Patent Office bears the burden of establishing why one of skill in the art would have been motivated by the teachings of the prior art to make the modifications required to arrive to the claimed invention. Applicant states that the assertions provided by the Patent office lack any articulated reasoning. Applicant states that the basis given represent post hoc rationalizations that fail to consider that the cited references provide no independent basis for making the proposed modifications. According to Applicant, the Office’s prima facie case of obviousness is an example of using Applicant’s disclosure as a roadmap to finding the claimed elements in the prior art and then providing a justification as to why the claimed invention is obvious. With regard to claim 24, applicant submits that claim 24 depends from claim 1 and is in condition for allowance as set forth in MPEP § 2143.03. Applicant’s arguments have been fully considered but not deemed persuasive to overcome the instant rejections. The Examiner acknowledges the teachings of the cited prior art. However, the Examiner disagrees with Applicant’s contention that the claimed invention is not obvious. With regard to the arguments that (i) if Arshad et al. already accomplishes the goal of the presently claimed subject matter, then one of ordinary skill in the art would have no reason to modify the primary reference, (ii) there no rationale for replacing the Enterobacter spp. genes of Arshad et al. with the P. fluorescens genes and the R. eutropha PHB operon as currently claimed, and (iii) MPEP § 2143.01(IV) states that there has to be an objective reason to combine the teachings of the references, it is reiterated herein that s set forth in MPEP § 2144 (I), the rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In the instant case, the Examiner previously indicated that a person of ordinary skill in the art is motivated to transform an E. coli cell with plasmids that comprise the styrene catabolism genes from Pseudomonas fluorescens ST (Marconi et al. and Beltrametti et al.) and a plasmid that comprises the entire Ralstonia eutropha PHB operon (Antonio et al.) to obtain a cell capable of transforming styrene, which is a compound whose degradation is highly desirable, into a useful and biodegradable compound such as PHB. Moreover, with regard to the argument that if Arshad et al. already teaches the production of PHB from styrene, there is no motivation to transform any bacterium with both the plasmid of Antonio et al. and a plasmid that comprises the genes of Marconi et al. and Beltrametti et al. operably linked to a T5 promoter, it is reiterated herein that the in vivo system of Arshad et al. (a) is limited to naturally occurring organisms, (b) would not allow control of when to start the conversion of styrene to a polyhydroxyalkanoate, and (c) would not allow the production of a single type of polyhydroxyalkanoate. Applicant is reminded that the cell of Arshad et al. comprises endogenous styrene degradation genes whose expression cannot be controlled at will by an inducer. As set forth in MPEP § 2144 (II), the expectation of some advantage is the strongest rationale for combining references. In the instant case, an E. coli cell transformed with plasmids that comprise the styrene catabolism genes from Pseudomonas fluorescens ST and a plasmid that comprises the entire Ralstonia eutropha PHB operon under the control of an inducible promoter such as a T5 promoter would allow control of when to start the degradation of styrene (inducible promoter) and the production of a specific type of polyhydroxyalkanoate, namely PHB (PHB biosynthetic genes). Moreover, E. coli is a well-known host cell that has been previously used to degrade styrene and produce PHB when transformed with the required genes. Therefore, contrary to Applicant’s assertions, there is motivation from one of ordinary skill in the art to have looked outside of Arshad et al. and arrive to the claimed invention. With regard to the arguments that (i) the only basis for combining the cited prior art is impermissible hindsight, (ii) the Patent Office bears the burden of establishing why one of skill in the art would have been motivated by the teachings of the prior art to make the modifications required to arrive to the claimed invention, (iii) the assertions provided by the Patent office lack any articulated reasoning, and (iv) the Office’s prima facie case of obviousness is an example of using Applicant’s disclosure as a roadmap to finding the claimed elements in the prior art and then providing a justification as to why the claimed invention is obvious, it is reiterated herein that as set forth in MPEP § 2144 (I), the rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In the instant case, the Examiner has provided a clear rationale as to why one of skill in the art would have been motivated to combine the teachings of the cited prior art and arrived to the claimed invention. The examiner has previously indicated that in view of the fact that the in vivo system of Arshad et al. (a) is limited to naturally occurring organisms, (b) would not allow control of when to start the conversion of styrene to a polyhydroxyalkanoate, and (c) would not allow the production of a single type of polyhydroxyalkanoate, an E. coli cell transformed with plasmids that comprise the styrene catabolism genes from Pseudomonas fluorescens ST and a plasmid that comprises the entire Ralstonia eutropha PHB operon under the control of an inducible promoter such as a T5 promoter would allow control of when to start the degradation of styrene (inducible promoter) and the production of a specific type of polyhydroxyalkanoate, namely PHB (PHB biosynthetic genes). Moreover, E. coli is a well-known host cell that has been previously used to degrade styrene and produce PHB when transformed with the required genes. Therefore, it is not believed that the Examiner did not provide an articulated rationale indicating why one of skill in the art would have been motivated to arrive to the claimed invention, or that the reasons provided by the Examiner are stated in the specification. As such, one cannot reasonably conclude that the Office’s prima facie case of obviousness is an example of using Applicant’s disclosure as a roadmap to finding the claimed elements in the prior art and then providing a justification as to why the claimed invention is obvious. With regard to claim 24 and the argument that claim 24 depends from claim 1 and is in condition for allowance as set forth in MPEP § 2143.03, it is reiterated herein that the invention of claim 1 is not deemed allowable for the reasons extensively discussed above. Therefore, the subject of claim 24 remains rejected as obvious for the reasons of record. As previously stated, the motivation to add a partitioning agent to the system of Arshad et al., Antonio et al., Marconi et al., Beltrametti et al., and Ayyadurai et al. is disclosed by Hartmans et al. who teach that using an organic solvent (dibutyl phthalate) as a reservoir for toxic compounds offers the advantageous possibility of achieving high biomass concentrations at low substrate concentrations in the water phase without having to continuously monitor and adjust the substrate concentration. Therefore, for the reasons of record and those set forth above, one of skill in the art would have to conclude that the in vivo system of claims 1-2, 5-7, 12, 15, 17, 25, 26, 29 is obvious over the teachings of Arshad et al., Antonio et al., Marconi et al., Beltrametti et al., and Ayyadurai et al. as evidenced by SnapGene and Wu et al., while the in vivo system of claim 24 is obvious over the teachings of Arshad et al., Antonio et al., Marconi et al., Beltrametti et al., Ayyadurai et al., and Hartmans as evidenced by SnapGene and Wu et al. Claim 78 is rejected under 35 U.S.C. 103 as being unpatentable over Arshad et al. (Front Biol 12(3):210-218, 2017) in view of Antonio et al. (FEMS Microbiology Letters 182:111-117, 2000), Marconi et al. (Applied and Environmental Microbiology 62(1):121-127, 1996), Beltrametti et al. (Applied and Environmental Microbiology 63(6):2232-2239, 1997), Ayyadurai et al. (Biotechnology and Bioprocess Engineering 14:257-265, 2009) as evidenced by SnapGene entry for T5 promoter (2024), Wu et al. (GenBank accession number QBK40993 3/12/2019; GenBank accession number QBK40994 3/12/2019; GenBank accession number QBK40992 3/12/2019), and further in view of Huang (M.S. thesis, Design and Characterization of Artificial Transcriptional Terminators, Massachusetts Institute of Technology, November 13, 2008), and Doong (Ph.D. thesis, Biosensor-based Strategies for Improving in Escherichia coli, Massachusetts Institute of Technology, May 23, 2019) as evidenced by the Registry of Standard Biological Parts (BBa_B1002_Terminator; 2006). Arshad et al. teach the biosynthesis of polyhydroxyalkanoate from styrene by a bacterial cell, wherein the polyhydroxyalkanoate is homopolymer PHB and copolymer PHB-co-PHV (page 210, Results). Arshad et al. teach that that there are millions of tons of plastics composed of polystyrene polymers produced that usually end up in the landfills and that there are numerous studies to find alternative methods to recycle them (page 210, Introduction). Arshad et al. teach that polystyrene can be converted back to styrene by pyrolysis (physical recycled styrene) and that the styrene obtained can be metabolized by some bacteria to produce valuable biopolymers such as PHAs (page 210, Introduction). Arshad et al. teach that styrene degradation is a multistep process where styrene is first converted to styrene epoxide, which is then isomerized to phenylacetaldehyde. Phenylacetaldehyde is further converted into phenyl acetic acid, which is then converted to phenyl acetyl-CoA, which in turn enters into the TCA cycle (page 210, right column-page 211, left column). Arshad et al. teach that during PHA biosynthesis, (a) phenyl acetyl CoA oxidizes to acetyl-CoA, (b) two acetyl-CoA molecules condense to form acetoacetyl-CoA in a reaction catalyzed by PhaA, (c) acetoacetyl-CoA is reduced to R-3-hydroxyaceyl-CoA in a reaction catalyzed by PhaB, and (d) R-3-hydroxyaceyl-CoA polymerizes in a reaction catalyzed by PhaC (page 211, left column, first full paragraph). Arshad et al. do not teach nucleic acids encoding the proteins of SEQ ID NO: 2, 6, 8, 14, 26, 32, or 36. Antonio et al. teach E. coli cells transformed with a plasmid that comprises the entire Ralstonia eutropha PHB operon (pBHR68; page 111, Abstract). Ralstonia eutropha is also known as Cupriavidus necator. Antonio et al. teach that the pBHR68 plasmid comprises the phaA, phaB and phaC genes (page 114, Figure 1A). Antonio et al. teach that E. coli cells that comprise the pBHR68 plasmid produce a polyhydroxyalkanoate that is 100% poly(3-hydroxybutyrate) (poly3HB; page 115, Table 4; page 114, right column; page 116, Table 5). The Ralstonia eutropha (Cupriavidus necator) phaA, phaB and phaC genes encode the proteins of SEQ ID NO: 26, 32, and 36, respectively as evidenced by Wu et al. See alignments previously provided. Marconi et al. teach the cloning and characterization of the styrene catabolism genes from Pseudomonas fluorescens ST (page 121, Abstract). Marconi et al. teach a plasmid that comprises a 27Kb fragment from P. fluorescens ST (p907; Table 1) and discloses that this 27Kb fragment comprises the styrene catabolic genes (page 123, left column, last 4 lines). Marconi et al. teach an E. coli transformed with p907 (E. coli RU4420::Tn1725page 123, right column, lines 2-5). Beltrametti et al. teach that the p907 plasmid disclosed by Marconi et al. comprises the genes for styrene degradation (page 2233, Table 1) and that p907 comprises the genes styA, styB, styC and styD (page 2234, Figure 1B, caption). Beltrametti et al. teach plasmids comprising fragments of the 27Kb fragment in p907 and E. coli cells transformed with said plasmids (Table 1; page 2234, Figure 1C, caption; page 2233, left column, Culture conditions for metabolite analysis). Beltrametti et al. teach that those plasmids that comprise both the styA and styB genes when expressed in E. coli produced a fully functional monooxygenase (page 2235, right column, Functional analysis of styA and styB). Beltrametti et al. teach that those plasmids that comprise all of the styC gene when expressed in E. coli produced a fully functional isomerase (page 2236, Characterization of StyC). Beltrametti et al. teach that the plasmid that comprises all of the styD gene when expressed in E. coli produced a fully functional phenylacetaldehyde dehydrogenase (page 22367, Characterization of StyD). The P. fluorescens styA, styB, styC, and styD genes encode the proteins of SEQ ID NO: 2, 6, 8, and 14, respectively, as shown in the alignments previously provided. Ayyadurai et al. teach the expression of unnatural recombinant proteins in E. coli and the use of the pET and pQE expression systems to produce unnatural recombinant proteins (page 257, Abstract). Ayyadurai et al. teach that the pQE vector by Qiagen contains a T5 promoter (page 258, left column), which is inducible by IPTG (page 259, right column, second full paragraph). The T5 promoter comprises SEQ ID NO: 39 as evidenced by the SnapGene entry for the T5 promoter (page 2). See alignment previously provided. Ayyadurai et al. do not teach styrene degradation genes or PHB biosynthetic genes. Doong teaches the construction of an expression plasmid and the use of the transcription terminator rrnB (page 39, line 11). The transcription terminator rrnB comprises SEQ ID NO: 51 as shown in the alignment below. Huang teaches several transcription terminators and discloses that out of 10 transcription terminators designed, BBa_B1002 was one proved to be a strong terminator with terminator efficiencies greater than 90%. Huang et al. teach that the transcription terminator BBa_B1002 can be obtained from the Registry of Standardized Parts (Abstract). Huang teaches that BBa_B1002 has a measured termination efficiency of 99% (page 97, Table 7.2). As evidenced by Registry of Standardized Parts, BBa_B1002 comprises SEQ ID NO: 50. See alignment below. Claim 78 is directed in part to a system that comprises a bacterial cell, including an E. coli cell, wherein said bacterial cell comprises nucleic acids encoding a Pseudomonas styrene monooxygenase that comprises SEQ ID NO: 2, a Pseudomonas flavin reductase that comprises SEQ ID NO: 6, a Pseudomonas styrene-oxide isomerase that comprises SEQ ID NO: 8, a Pseudomonas phenylacetaldehyde dehydrogenase that comprises SEQ ID NO: 14, a Cupriavidus acetyl-CoA C-acetyltransferase that comprises SEQ ID NO: 26, a Cupriavidus 3-ketoacyl-ACP reductase that comprises SEQ ID NO: 32, and a Cupriavidus class I poly(R)-hydroxyalkanoic acid synthase that comprises SEQ ID NO: 36, wherein said nucleic acids are in two plasmids, wherein the first plasmid comprises the nucleic acids that encode the Pseudomonas styrene monooxygenase of SEQ ID NO: 2, the Pseudomonas flavin reductase of SEQ ID NO: 6, the Pseudomonas styrene-oxide isomerase of SEQ ID NO: 8, and the Pseudomonas phenylacetaldehyde dehydrogenase of SEQ ID NO: 14, wherein the second plasmid can comprise the Cupriavidus acetyl-CoA C-acetyltransferase that comprises SEQ ID NO: 26, the Cupriavidus 3-ketoacyl-ACP reductase that comprises SEQ ID NO: 32, the Cupriavidus class I poly(R)-hydroxyalkanoic acid synthase that comprises SEQ ID NO: 36, and an influx porin that comprises SEQ ID NO: 20, wherein the nucleic acids in said first plasmid are under the control of a promoter, wherein said promoter can be a T5 promoter that comprises SEQ ID NO: 39, wherein said first plasmid comprises a transcription terminator at the 3’ of the nucleic acid that encodes the Pseudomonas phenylacetaldehyde dehydrogenase of SEQ ID NO: 14, wherein said second plasmid comprises a transcription terminator at the 3’ of the nucleic acid that encodes the protein that comprises SEQ ID NO: 36, wherein the transcription terminator comprises SEQ ID NO: 50 or SEQ ID NO: 51. Please note that those limitations recited after the term “optionally” are not required by the claims. See also Claim Rejections - 35 USC § 112(b) or Second Paragraph (pre-AIA ) for claim interpretation. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to transform an E. coli cell with the plasmid of Antonio et al. and a plasmid that comprises the P. fluorescens genes of Marconi et al. and Beltrametti et al. operably linked to a T5 promoter. Also, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to include a transcription terminator at the 3’ of the styD gene in a plasmid that comprises the four styrene degradation genes of Marconi et al. and Beltrametti et al., or in a plasmid that comprises the three PHB genes of Antonio et al. at the 3’ of the protein of SEQ ID NO: 36 , wherein said transcription terminator comprises SEQ ID NO: 50 or SEQ ID NO: 51. A person of ordinary skill in the art is motivated to transform an E. coli cell with the plasmids described above to obtain a cell capable of transforming styrene, which is a compound whose degradation is highly desirable, into a useful and biodegradable compound such as PHB. A person of ordinary skill in the art is motivated to use a T5 promoter because this promoter is well known and inducible so that one could have control of when to start the expression of the styrene degrading enzymes. A person of ordinary skill in the art is motivated to place the styrene degrading genes styA, styB, styC and styD of Marconi et al. and Beltrametti et al. in that order from 5’ to 3’ end because that is the order in which they are found in P. fluorescens. A person of ordinary skill in the art is motivated to add at least one transcription terminator at the 3’ of the styD gene (fourth gene) and/or the 3’ end of the polynucleotide encoding the protein of SEQ ID NO: 36 (phaC) that comprise SEQ ID NO: 50 or 51 because transcription terminators are required to indicate the end of the transcriptional unit, and the transcription terminators of SEQ ID NO: 50 and 51 are well known transcription terminators as evidenced by Huang and Doong. One of ordinary skill in the art has a reasonable expectation of success at transforming an E. coli cell with the plasmid of Antonio et al. and a plasmid that comprises the P. fluorescens genes of Marconi et al. and Beltrametti et al. operably linked to a T5 promoter and comprising the transcription terminators recited because the molecular biology techniques required are well known and widely used in the art as evidenced by Antonio et al., Marconi et al., Beltrametti et al.,Ayyadurai et al., Huang and Doong. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention. Query = SEQ ID NO:50 Sbjct = BBa_B1002_Terminator - Huang & Registry of Standard Biological Parts NW Score Identities Gaps Strand 68 34/34(100%) 0/34(0%) Plus/Plus Query 1 CGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGC 34 |||||||||||||||||||||||||||||||||| Sbjct 1 CGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGC 34 Query = SEQ ID NO:51 Sbjct = rrnB terminator - Doong NW Score Identities Gaps Strand 160 80/80(100%) 0/80(0%) Plus/Plus Query 1 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTT 60 Query 61 GTTTGTCGGTGAACGCTCTC 80 |||||||||||||||||||| Sbjct 61 GTTTGTCGGTGAACGCTCTC 80 Conclusion No claim is in condition for allowance. Applicant is advised that any Internet email communication by the Examiner has to be authorized by Applicant in written form. See MPEP § 502.03 (II). Without a written authorization by Applicant in place, the USPTO will not respond via Internet email to any Internet correspondence which contains information subject to the confidentiality requirement as set forth in 35 U.S.C. 122. Sample written authorization language can be found in MPEP § 502.03 (II). An Authorization for Internet Communications in a Patent Application or Request to Withdraw Authorization for Internet Communications form (SB/439) can be found at https://www.uspto.gov/patent/forms/ forms-patent-applications-filed-or-after-september-16-2012, which can be electronically filed. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DELIA M RAMIREZ, Ph.D., whose telephone number is (571) 272-0938. The examiner can normally be reached on Monday-Friday from 8:30 AM to 5:00 PM. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert B. Mondesi, can be reached at (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. /DELIA M RAMIREZ/Primary Examiner, Art Unit 1652 DR September 5, 2026
Read full office action

Prosecution Timeline

Aug 06, 2021
Application Filed
Jun 21, 2024
Non-Final Rejection mailed — §103, §112
Dec 23, 2024
Response Filed
Apr 10, 2025
Final Rejection mailed — §103, §112
Oct 10, 2025
Notice of Allowance
May 11, 2026
Request for Continued Examination
May 12, 2026
Response after Non-Final Action
Sep 10, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12716081
MUTANT OF CORYNEBACTERIUM GLUTAMICUM WITH ENHANCED L-CITRULLINE PRODUCTIVITY AND METHOD FOR PREPARING L-CITRULLINE USING THE SAME
2y 10m to grant Granted Aug 25, 2026
Patent 12698515
GENETICALLY ENGINEERED BACTERIUM USING GLUCOSE AS SUBSTRATE FOR DE NOVO SYNTHESIS OF VANILLIN AND APPLICATION THEREOF
2y 4m to grant Granted Aug 04, 2026
Patent 12698492
ISOLATED CAS13 PROTEIN AND USE THEREOF
2y 3m to grant Granted Aug 04, 2026
Patent 12668785
COMBINATION TREATMENT
2y 11m to grant Granted Jun 30, 2026
Patent 12655405
SEQUENCE SPECIFIC DEGRADATION OF SINGLE-STRANDED POLYNUCLEOTIDES WITH CARD1 NUCLEASE
3y 4m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
65%
Grant Probability
99%
With Interview (+56.3%)
2y 9m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 855 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month