DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-3, 5-8, 10, 28, 64-72, 77, 78, 81, 100, 102, 104-115 and new claims 116-120 are pending and examined here.
Priority
It is recognized that the application claims benefit of Provisional Applications 63/065,190 and 63/214,016 filed on 8/13/2020 and 6/23/2021, respectively. All the claims examined enjoy the benefit of ‘190, filed on 08/13/2020.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 10/23/2025, along with its fee, was filed after the mailing date of prior Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Objections
Objection to claims 100, 104, 109, 111, 113 is withdrawn, as they are not substantially identical, see Summary of Interview in the Remarks of 10/23/2025 (pg. 10).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 28, 100 and all their dependent claims 2-3, 5-8, 10, 64-72, 77, 78, 81, 102, 104, 105, 106, 108-115, 116-120 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The instant cl. 1, 28 and 100 recite SEQ ID NO: 3076, which does not recite a GalNAc moiety conjugated to the sequence.
Specification, pg. 123, noting SEQ ID NO: 3076 has a GalNAc conjugation (see excerpt below from Table 2). Further in all of the prior actions, the same excerpt below was copied for rejection of claims reciting SEQ ID NO: 3076.
PNG
media_image1.png
27
596
media_image1.png
Greyscale
Further, in the Remarks, under unexpected results section, the duplex SEQ ID NO: 3076/3472 and its corresponding molecule is noted as “D-2241 (see Table 2)” (pg. 17).
MPEP 2173.03 provides the following: A claim, although clear on its face, may also be indefinite when a conflict or inconsistency between the claimed subject matter and the specification disclosure renders the scope of the claim uncertain as inconsistency with the specification disclosure or prior art teachings may make an otherwise definite claim take on an unreasonable degree of uncertainty.
Here the inconsistency creates difficulty, including the uncertainty regarding whether the unexpected results are in commensurate with the claims, at least regarding D-2241, used for in-vivo studies, the results of which is described in detail in the Remarks. If the Applicant prefers to not include the GalNAc moiety in the sequence, a different SEQ ID NO from the specification needs to be identified.
All dependent claims (2-3, 5-8, 10, 64-72, 77, 78, 81, 102, 104, 105, 106, 108-115, 116-120) are rejected for failing to overcome the indefiniteness of noted claims.
In the interest of compact prosecution, the SEQ ID NO: 3076 will be interpreted as the modified sequence noted on pg. 123, Table 2, of the specification, which includes the GalNAc moiety. Examiner recognizes that some claims will have 112(d) issue by interpreting SEQ ID NO: 3076 comprising GalNAc moiety for claim 1, 28, 100 (cl. 107, recites X=S, dependent of cl. 106, 100).
Claim Rejections - 35 USC § 103
The rejection of examined claims is maintained.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 2, 3, 5, 6, 7, 8, 10, 28, 64, 65, 66, 67, 68, 69, 70, 71, 72, 77, 78, 81, 100, 102, 104, 108-115, 116 are rejected under 35 U.S.C. 103 as being unpatentable over Tremblay et al. (US20230183707, pub. date 6/15/2023, EFD: 5/21/2020, and serves as a 102(a)(2), hereinafter referred as Tremblay, of record) in view of McSwiggen et al. (US20150148530, pub. date 05/2015, hereinafter referred as McSwiggen, of record) and Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster).
Regarding instant cl. 1, 114, the modified sequences of instant sense SEQ ID NO: 1729 (20 nt.) and antisense SEQ ID NO: 2461 (23 nt.) are noted below (pg. 112, Table 2):
PNG
media_image2.png
26
987
media_image2.png
Greyscale
The lower case letter “s” indicates a phosphorothioate linkage (PS), lower case nt. letter is 2’-O-methyl (2OMe) modification; while capital letter nt. next to a “f” is a 2’-fluoro (2F) modification; GalNac3= trivalent GalNAc moiety; invAb=inverted abasic deoxynucleotide (par. 219).
The base/unmodified strands are noted below to illustrate overhangs:
AS-2461 5’- aaaggcaucuaauauuccagguu
Se-1729 uuccguagauuauaaggucc - 5'
(overhangs at both 5’ and 3’ ends of 1 and 2 nt., respectively)).
Tremblay discloses a double stranded RNA agent for inhibiting expression of MARC1 gene, wherein the dsRNA agent comprises a sense strand (SS) and an antisense strand (AS) forming a double stranded region (i.e. a duplex region), wherein the antisense strand comprises a nt. sequence comprising at least 15, 17, 19, or 21 contiguous nt. and may comprise 0-3 mismatches when bound to sense strand (par. 26-30). Tremblay discloses one dsRNA agent comprising sense strand SEQ ID NO: 214 (uccuggaauauuagaugccdTdT), which matches 18 contiguous nt. with instant SEQ ID NO: 1729, and comprises antisense SEQ ID NO: 566, matching 18 contiguous nt. with the instant antisense SEQ ID NO: 2461 (see alignment below, the mismatches are underlined, bolded below). Further, the dsRNA agent comprising SEQ ID NOs: 214/566 (AD-890305.1) following treatment resulted in ~ 53% inhibition of Marc1 expression at 50 nM in vitro (see Table 5, par. 636).
Instant SEQ ID NO: 1729: ccuggaauauuagaugccuu (a 20 nt. SS, no overhangs)
Tremblay SEQ ID NO: 214: uccuggaauauuagaugccdTdT (a 21 nt. SS, with dTs as overhangs)
Instant SEQ ID NO: 2461: aaaggcaucuaauauuccagguu (a 23 nt. AS)
Tremblay SEQ ID NO: 566: ggcaucuaauauuccaggadTdT (a 21 nt. AS, with terminal dTs as overhangs)
The comparison of 2’ modification pattern of all Tremblay’s sense strands in Fig. 1 and instant sense SEQ ID NO: 1729:
Tremblay’s: msmsmmmmfmfffmmmmmmmmmmG (pos. 7, 9-11 are 2F)
Instant SEQ ID NO: 1729: msmsmmmmfmffffmmmmmmms-invAB (pos. 7, 9-12 are 2F)
Comparison of 2’ modification pattern of Tremblay’s antisense strand in Fig. 1 and instant antisense strand is below (G=L96 GalNAc structure or GalNAc moiety, s=PS, m=2OMe, f=2F, invAB = inverted abasic nucleotide):
Tremblay: msfsmmmfmffmmmmfmfmmmmmsmsm (pos. 2, 6, 8, 9, 14, 16 are 2F)
Instant 2461: msfsmfmfmmmmmmmfmfmmmmmmsm (pos. 2, 4, 6, 14, 16 are 2F)
Tremblay (1) does not disclose the 20 and 23 contiguous nt. of the sense and antisense SEQ ID NO: 1729/2461, respectively; (2) does not disclose sense strand comprising an inverted abasic nt. as the terminal nt. at its 3’end; and (3) does not disclose the specific pattern of modifications of the sense strand SEQ ID NO: 1729 and antisense strand SEQ ID NO: 2461.
Regarding the differences in base/unmodified sequence highlighted above: Although Tremblay does not disclose the exact sequences of instant SEQ ID NOs 1729/2461, both Tremblay’s SEQ ID NO: 214/566 and instant SEQ ID NO: 1729/246 duplexes share the same 18 nt. region of the mARC1 gene that is targeted (ccuggaauauuagaugcc). Further, Tremblay teaches shifting the antisense/sense strands in attempts to identify the optimal accessible region of a target transcript, see Fig. 1, e.g. AD-6646147, '151, '154, '158, have overlapping sequences that share a target region of a target transcript. Further, Tremblay, as noted above, demonstrates a ~50% inhibition by SEQ ID NO 214/566, thus a skilled artisan would shift the antisense strands around potential accessible region in the transcript to identify an optimal accessible region on the transcript. Thus, despite minor sequence differences, instant SEQ ID NOs 1729/2461 are not patentably distinct from Tremblay’s SEQ ID NO: 241/566.
Regarding the differences in the modification pattern of the sense and antisense strands: Tremblay does not disclose a sense strand with an Inv-AB at the 3’ end nor an exact modification pattern for the sense and antisense strands as instant SEQ ID NOs: 1729/2461.
Foster demonstrate substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the dsRNA siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). Foster highlights that modifying the 2’ position of RNA can significantly enhance the stability of oligonucleotides and that the bulky 2OMe has a greater stabilizing effect than the less bulky 2F modification, however, steric bulk, “if not applied judiciously” results in reduction of RNAi activity (pg. 708). Before conducting bench studies, they conducted an in silico analysis based on a dataset of 1,890 duplexes with varying 2F and 2OMe composition across five targets and 15 target sites. The in silico results describing impact of 2F relative to 2OMe at each position in the antisense strand (AS) and sense strand (SS) was generated (Foster’s fig. 1A, B is provided below, and indicates “Negative numbers indicate activity improvement with inclusion of 2’-F relative to 2’-OMe at that position, positive numbers reflect decreased activity. Asterisks (*) indicate significant differences between 20-F and 20-OMe at the noted positions” (pg. 709, 710, Fig. 1).
Foster also reduced the overall numbers of 2F with the rationale that 2OMe significantly enhances nuclease stability thus having a greater stabilizing effect while still maintaining inhibitory activity (pg. 708).
Foster: Fig. 1A, B, pg. 710.
PNG
media_image3.png
216
600
media_image3.png
Greyscale
Reviewing Foster’s sense strand data of Fig. 1B, it appears that although there are significant inhibition differences between 2OMe and 2F at various positions, except for position 11 of sense strand (Fig. 1B), which has a strong (and a significant) preference for 2F, there is not a strong preference for 2OMe or 2F along the sense strand. Here, both instant and Tremblay’s sense strand have a 2F at position 11. Similarly reviewing the antisense strand data of Fig. 1A, there is a strong (and significant) preference for 2F at pos. 2 and 14, and a strong preference for 2OMe at position 21. Here both Tremblay’s and instant antisense strands have 2F at pos. 2 and 14. Using the in silico data as a starting point, Foster tested various sense and antisense strands pattern modifications in vitro and in vivo with the aim to identify an optimal 2OMe and 2F modification pattern, while maintaining a low 2F content, across a siRNA targeting a murine transthyretin gene (abstract, Fig. 1C, D, and other figures). Thus, it is known in the art to modify the nt. positions of 2OMe and 2F on a siRNA to identify a modification pattern(s) that improve stability and maintain or increase activity
Regarding PS linkages, Foster introduced PS linkages in the antisense strand between position 1 and 2, 2 and 3, 21 and 22 and 22 and 23 and for sense strands, between position 1 and 2 and 2 and 3 from 5’ end (all nt. positions are from 5’ end unless indicated otherwise). Foster discloses that PS linkages provide additional protection against 3’ and 5’ exonucleases and thus are placed at terminal ends (pg. 708). Thus modifying the PS linkage content is known in the art.
Regarding terminal inverted abasic nt., although Tremblay and Foster, do not disclose sense strand with terminal abasic nt. at 3’ end, McSwiggen discloses the sense strand with an inverted deoxy abasic moiety as terminal cap moiety at 3’ end, 5’ end or both ends and indicates its connection to short interfering double stranded nucleic acid (siNA) in a 3’-3’ or 5’-5’ configuration (par. 31, 92, 96). McSwiggen indicates that incorporation of inverted deoxy abasic residue preserves RNAi activity while “dramatically increasing the serum stability of these compounds” (par. 34).
Regarding the modification pattern, including the invAB, of instant dsRNA agent, although Tremblay teaches a fully modified siRNA but not the exact instant 2F and 2OMe modification pattern and without the invAB, it would have been obvious for one ordinarily skilled in the art to have obviously tried workable modification patterns based on prior art to achieve improved results (see MPEP 2143(I)(E)).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success. Foster indicates placement of a bulky 2OMe modification provides an improved nuclease stability compared to a less bulky 2F modification, and with the aims of keeping a low level of 2F modification, identifies optimal 2OMe and 2F modification pattern for the genes tested by testing numerous siRNAs with different modification patterns of 2OMe and 2F.
Foster tested the finite number of 2’-sugar modifications using 2OME and 2F to identify the optimal modification pattern comprising 2OMe and 2F modifications. Further, McSwiggen provides the purpose of including an invAB on a sense strand for increased siRNA stability.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried modifying the dsRNA agent comprising SEQ ID NOs: 566 and 214 of Tremblay in view of Foster and McSwiggen to have arrived at the claimed invention with a reasonable expectation of success. Because Foster discloses testing of 2OMe and 2F modifications positions across a siRNA to identify a modification pattern with desired siRNA activity, and McSwiggen discloses invAB modification at terminal ends of a sense strand to further stabilize a siRNA, a skilled artisan with these known, finite options would expect that these modifications would successfully result in identifying a stable siRNA with an optimal modification pattern comprising 2OMe and 2F and invAB at either ends. Thus claims 1, 114 are obvious.
Regarding instant cl. 2, 3, 5, 6, Tremblay discloses an example of a siRNA complex where SS and AS form a duplex region of 19 nt. in length, see SS and AS SEQ ID NOs 214 and 566, respectively, above (regarding instant cl. 2 and 3), and each SS and AS is 21 nt. in length (regarding instant cl. 5 and 6).
Regarding instant cl. 7 and 8, 10 Tremblay discloses one end of dsRNA is blunt end (regarding instant cl. 7), while the other end has a 2 nt. overhang (regarding instant cl. 8), and discloses overhang at either 5’ or 3’ end of antisense strand (regarding instant cl. 10, par. 320, also par. 118-119).
Regarding instant cl. 64, 65, 66, 67, 68, Tremblay discloses the dsRNA agent comprising a ligand, which may be one or more N-acetylgalactosamine (GalNac, a carbohydrate) attached through trivalent or tetravalent branched linker (par. 42, Fig. 1 discloses a trivalent GalNAc moieties conjugated to dsRNA agents).
Regarding instant cl. 69 and 70, 116, Tremblay discloses that the ligand is covalently conjugated to the sense strand at its 3’ or 5’ end (par. 42, par. 43 includes figure of GalNAc ligand structure with covalent conjugation via a linker, see also Fig. 1).
Regarding instant cl. 71, Tremblay discloses a pharmaceutical composition comprising the dsRNA agent invention and an acceptable carrier (par. 82).
Regarding instant cl. 72, 77, 78, 81, 108-113, 115, Tremblay discloses a method of administration siRNAs targeting mARC1 transcript wherein treating comprising inhibiting or reducing the expression of MARC1 in a cell, e.g. hepatocyte (embodiment 109, par. 620) or in a human that is diagnosed with non-alcoholic fatty liver disease (NAFLD)/ non-alcoholic steatohepatitis (NASH) (cl. 24, 26, 28, 29, 30). Tremblay discloses examples of mice fed high level of high fat/high fructose (HF/HFr) diet, which represents a non-alcoholic steatohepatitis (NASH) murine model and results from excessive accumulation of ectopic fat in the liver (NASH is considered a species of a fatty liver disease, par. 642) and were treated with siRNA targeting mARC1 transcript; Fig. 4A and 4B shows reduction in Marc1 expression. It is known in the art that reduction/inhibition in mRNA levels results in reduction in protein levels.
Regarding instant cl. 72, although the RNAi constructs of cl. 1 are based on human mARC1 gene and the prior art is addressing the human based siRNA constructs, it is obvious for a skilled artisan to identify a non-human mammal species (such as the mice discussed above) that have sufficient complementary with an RNAi construct of Tremblay (for e.g. chimpanzee, see alignment below).
Alignment between instant Tremblay SEQ ID NO: 566 and predicted chimpanzee MARC1 mRNA (XM_009441519.3)
Tremblay SEQ ID NO: 566 1 GGCAUCUAAUAUUCCAGGA 21
|||||| :|:||:|::|||
XM_009441519.3 1812 AAAGGCGTCTAATATTCCAGGA 1791
Regarding instant cl. 1, 28 and 100, the instant claims recite SEQ ID NO: 3076 and 3472, see excerpt from specification below (pg. 123).
PNG
media_image4.png
29
969
media_image4.png
Greyscale
Tremblay discloses SS SEQ ID NO: 214 and AS SEQ ID NO: 566, see alignments below of unmodified sequences:
Instant SEQ ID NO: 3076: ccuggaauauuagaugccuu (a 20 nt. SS, with one terminal U as an overhang)
Tremblay SEQ ID NO: 214: uccuggaauauuagaugccdTdT (a 21 nt. SS, with dTs as overhangs)
Instant SEQ ID NO: 3472: aggcaucuaauauuccagguu (a 21 nt. AS, with terminal Us as overhangs)
Tremblay SEQ ID NO: 566: ggcaucuaauauuccaggadTdT (a 21 nt. AS, with terminal dTs as overhangs)
Comparison of 2’ modification pattern of Tremblay’s antisense strand in Fig. 1 and instant antisense strand is below (G=L96 GalNAc structure or GalNAc moiety, s=PS, m=2OMe, f=2F, invAb = inverted abasic nucleotide):
Tremblay: msfsmmmfmffmmmmfmfmmmmmsmsm (pos. 2, 6, 8, 9, 14, 16 are 2F)
Instant 3472: msfsmmmmfmmmmmmfmfmmmmmsmsm (pos. 2, 7, 14, 16 are 2F)
The comparison of 2’ modification pattern of all Tremblay’s sense strands in Table 4A and instant sense SEQ ID NO:
Tremblay’s: msmsmmmmfmfffmmmmmmmmmmG (pos. 7, 9-11 are 2F)
Instant SEQ ID NO: 3076: Gsmmmmmmfmffffmmmmmmmms[invAb] (pos. 7, 9-12 are 2F)
Tremblay (1) does not disclose the 20 and 21 contiguous nt. of the sense and antisense SEQ ID NOs: 3076/3472, respectively; (2) does not disclose a sense strand comprising an inverted abasic nt. at its 3’end; and (3) does not disclose the specific pattern of modifications of the sense strand SEQ ID NO: 3076 and antisense strand SEQ ID NO: 3472.
Regarding differences in base/unmodified strands: Although Tremblay does not disclose the exact sequences of instant SEQ ID NOs: 3076/3472, both Tremblay’s SEQ ID NO: 214/566 and instant SEQ ID NO: 3076/3472 duplexes share the same 18 nt. region of the mARC1 gene that is targeted (ccuggaauauuagaugcc). Further, Tremblay teaches shifting the antisense strands in attempts to identify the optimal accessible region of a target transcript, see Fig. 1, e.g. AD-6646147, '151, '154, '158, have overlapping sequences that share a target region of a target transcript. Further, Tremblay, as noted above, demonstrates a ~50% inhibition by SEQ ID NO 214/566, thus a skilled artisan would shift the antisense strands around that region in the transcript to identify an optimal accessible region on the transcript. Thus, despite the minor sequence differences, instant SEQ ID NOs: 3076/3472 are not patentably distinct from Tremblay’s SEQ ID NO: 241/566.
The rejection of differences in modification pattern and inclusion of invAb at the 3’ end of the sense strand is discussed above and also applies for the differences here.
Regarding the GalNAc ligand position differences, Tremblay discloses that N-acetyl-galactosamine (GalNAc) ligands conjugated to a siRNA is used to target the siRNA to the liver, i.e. hepatocytes, and GalNAc bind to asialoglycoprotein receptor of liver cells (Tremblay par. 250, 274), and can be conjugated to either 3’ end or the 5’ end of the sense strand (Tremblay claim 9).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified SEQ ID NOs: 214/566 of Tremblay in view of Foster and McSwiggen and arrive at the claimed invention with a reasonable expectation of success. Here, Tremblay discloses that GalNAc moiety can be attached to either 5’ and 3’ end of the sense strand and provides examples of GalNAc conjugated to the 3’ end of the sense strand with inhibition of target MARC1 gene, thus altering the placement of GalNAc at either end of the sense strand would successfully result in targeting the siRNA to hepatocytes and inhibiting the target gene. Thus, claims 28, 100 are obvious.
Regarding instant cl. 102, 104, Tremblay discloses a pharmaceutical composition comprising the dsRNA agent invention and an acceptable carrier (par. 82).
Claims 105, 106 and 107, 117-120 are rejected under 35 U.S.C. 103 as being unpatentable over Tremblay et al. (US20230183707, pub. date 6/15/2023, EFD: 5/21/2020, and serves as a 102(a)(2), hereinafter referred as Tremblay) in view of McSwiggen et al. (US20150148530, pub. date 05/2015, hereinafter referred as McSwiggen) and Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster) as applied to claims 1, 2, 3, 5, 6, 7, 8, 10, 28, 64, 65, 66, 67, 68, 69, 70, 71, 77, 78, 81, 100, 102, 104, 108-115 above, and further in view of Prakash et al. (US20150126718, pub date, 05/2015, hereinafter referred as Prakash, of record) and Matsuda et al. (2015, ACS Chem. Biol., 10, 1181-1187, referred as Matsuda).
Regarding instant cl. 105, 106: Tremblay and McSwiggen teach a conjugation of a GalNAc moiety to a siRNA via a linker moiety (see Tremblay cl. 14, 15, McSwiggen Fig. 48).
Tremblay, Foster, McSwiggen do not disclose the Structure 1 of claim 105 nor of Formula VII of claim 106.
Prakash discloses various linker groups that conjugates the duplex siRNA to the GalNAc moieties that increase activity of duplex siRNA compounds in liver cells in vivo (Par. 07). Prakash discloses Illustration of a linker Embodiment 1853 (see below, par. 36), which is a similar structure as the instant formula VII
PNG
media_image5.png
263
433
media_image5.png
Greyscale
Similar to instant ligand Structure 1 and formula VII, Embodiment 1853 comprises 5 amides groups with branching group with 3 tether linking moieties, with each alkane chain tether having a GalNac moeity; there is a conjugate linker that also can be linked to siRNA that are RNAi agents. Prakash discloses that the conjugated oligonucleotides can be made easily by one of ordinary skill and can provide increased yield than the conjugate groups described previously (par. 12).
Matsuda discloses refining GalNac-ligand design to explore the effects of ligand positioning, proximity and steric factors on ligand-receptor interaction and silencing activity (pg. 1181); Matsuda discloses “successive placement of a trinucleotide motif, where each nucleotide contains a monovalent GalNac, resulting in a trivalent GalNac cluster II-V that resembles the well optimized triantennary GalNac ligand design I” (pg. 1181, structures of II-V). Incorporation of three contiguous GalNac units on the sense strand of the siRNAs resulted in high ASGPR binding regardless of their position, i.e. terminally at 5’ or 3’ end or internally and comparable to a triantennary GalNac structure (see Table 1, siRNA 42-88, compared to siRNAs 49-51 with GalNac dispersed). Thus as long as the modifications and placements of monovalent GalNac moieties resemble triantennary conjugate, regardless of the location of the attachment, whether through ribosugar or through the nucleobase, the results provide similar binding affinity and similar potencies; thus providing “advancement of robust ASGPR-mediated delivery of RNAi therapeutics to hepatocytes” (pg. 1185). Thus, the essential importance is having the GalNAc moieties in close proximity and minor structural differences of the linker molecule would not affect the ability to inhibit the target gene.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the linker moiety of dsRNA agent of Tremblay in view of Prakash and arrive at the claimed invention with a reasonable expectation of success. Here, it is recognized that little minor structural modification that still maintain the triantennary GalNAcs in structure in close proximity does not affect its delivery function, thus modification of Tremblay’s linker moiety to Prakash’s linker moiety embodiment 1835, where triantennary GalNAcs are in close proximity, will successfully result in ability of endocytosis of siRNA conjugated with GalNAc in liver cells. Thus, claims 105-106 are obvious.
Regarding instant cl. 107, Tremblay discloses a 3’-terminus phosphorothioate linkage at 3’ end of sense strand (par. 15, par), to be clear this also discloses phosphorothioate linkage at 3’ end, where X = O or S, attached to the linker (par. 277).
Regarding instant cl. 117-120, Tremblay discloses a pharmaceutical composition comprising the dsRNA agent invention and an acceptable carrier (par. 82, relevant to instant cl. 117); Tremblay discloses a method of administration siRNAs targeting mARC1 transcript wherein treating comprising inhibiting or reducing the expression of MARC1 in a cell, e.g. hepatocyte (embodiment 109, par. 620) or in a human that is diagnosed with non-alcoholic fatty liver disease (NAFLD)/ non-alcoholic steatohepatitis (NASH) (cl. 24, 26, 28, 29, 30; relevant to instant cl. 118, 119, 120). Tremblay discloses examples of mice fed high level of high fat/high fructose (HF/HFr) diet, which represents a non-alcoholic steatohepatitis (NASH) murine model and results from excessive accumulation of ectopic fat in the liver (NASH is considered a species of a fatty liver disease, par. 642) and were treated with siRNA targeting mARC1 transcript; Fig. 4A and 4B shows reduction in Marc1 expression. It is known in the art that reduction/inhibition in mRNA levels results in reduction in protein levels.
Response to Arguments
Applicant's arguments filed 10/23/2025 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks make the following arguments:
the Remarks note that Tremblay discloses better dsRNAs than the cited dsRNA of Tremblay, i.e. more potent than AD-890305, and thus "it stands to reason that one of skilled in the art would choose a compound providing significant suppression of gene expression, and modify the sequences of that compound for therapeutic purposes." (pg. 13-14);
that even with significant overlap, sequence can have very different unpredictable activity: one has 91.3% knockdown, the other has 32.9% knockdown (pg. 14);
how Tremblay’s AD-890305.1 sequence can be altered to “capture the specifically claimed” sequences (pg. 15);
regarding modification pattern, in view of Foster, even with preference of 2F at position (pos.) 11 in the sense strand and 2F at positions 2 and 14 and 2OMe at pos. 21, a) there is a still a large number of permutations that are possible (270 billion choices); and b) a skilled worker could not predict that the resulting compound would be effective (pg. 15); c) also see results of different targeting duplexes (D-2208 and D-2216, same sequences but different modification pattern involving 2OME and 2F, provide contrasting results (one inhibits (-44 mRNA change), the other does not (24 mRNA change)), see excerpt below from Remarks, pg. 15-16).
PNG
media_image6.png
140
568
media_image6.png
Greyscale
provides unexpected results of D-2241, comprising SEQ ID NO: 3076/3472, and D-1389, comprising SEQ ID NO: 1729/2461 (pg. 17-19).
The arguments, although thorough and well-thought out, are not persuasive.
The main counterpoint to all the arguments is pointed out by the Remarks: the Remarks note that “the top performing siRNA,” i.e. D-1389, which was identified through in vitro studies that caused 95% suppression of human mARC1 expression with IC50 in picomolar range (pg. 17), was “further evaluated in structure-activity relationship studies to improve in vivo potency and durability by altering chemical modification patterns” and, consequently, D-2241 was identified (both are the duplexes of claimed sense and antisense strands) (pg. 17-18). (It should be pointed out that the antisense strand (of D-1389) SEQ ID NO: 2461, is 23 nt. in length, while the antisense strand (of D-2241) SEQ ID NO: 3472, is 21 nt. in length. Thus, the region targeted on the transcript by each is a bit different and the modification pattern of each antisense strand of instant claimed compounds is also different.) Thus, based on the results noted, it is not unpredictable to modify a chemical modification pattern of a modified siRNA duplex, that knocks-down the expression of a target gene in vitro, and expect improvement of duplex’s therapeutic index profile, including potency. Thus, the observation noted by the Remarks will be used as a basis to address the arguments.
Regarding argument 1, a skilled artisan does not have to select the most potent siRNA, any siRNA that is successful in suppressing the expression of the target gene is sufficient under the reasonably expectation of success standard. The knock-down of the target gene in Tremblay indicates that there is a region within the transcript that is accessible for hybridization and leading to the suppression of its expression. Further, in view of Foster, a skilled artisan can improve the potency of a siRNA duplex by modifying based on the guidelines provided Foster and the other prior art references of record, since Foster demonstrates improvement by refining the siRNA chemistry by optimizing the positioning/content of 2F and 2OMe.
Regarding arguments 2 and 3, regarding overlap and unpredictability, as noted above, there is a 2 nt. difference (21 nt. overlap) between the antisense strand of duplex of D-2241 and D-1389, and yet there is successful outcome, further confirming that a certain overlap, or alternatively, nucleotide differences between antisense strands is sufficient to maintain the suppression of a target gene. As noted in the Remarks/actions, there is a 18 nt. overlap between antisense strands of Tremblay and instant claimed compounds, and a skilled artisan can shift the antisense strand around the region that is known to be accessible to a target transcript to identify an optimal region for targeting (pg. 13 of Remarks).
Regarding argument 4) of chemical modification pattern, argument 4a) notes a >billion number of possibilities. Foster discusses a large number of permutations: “due to the complexity of the design space even for two 2’ modifications (with 221 and 223 possible permutations for sense and antisense, respectively), the results from this analysis [in silico model] were considered starting points for further optimization rather than general design rules” (pg. 709). Thus, using the results of in silico analysis, Foster further refined 2OMe and 2F modifications along both antisense and sense strands and demonstrated identification of duplexes with improved therapeutic profile (e.g. DV18 and DV22 used for further studies). This is also what the Applicant’s observed: ability to refine 2OMe and 2F modification of a siRNA duplex and still obtain a successful outcome: the positioning of 2OMe and 2F of D-1389 was refined for “to improve in vivo potency and durability by altering chemical modification patterns” to identify improved duplex (D-2241).
It should be noted that D-2241 also has a GalNAc moiety that aids in delivery of the drug to the liver, which is not addressed, thus more of the drug is going to the liver to also improve potency.
Thus addressing argument 4b), based on Foster, addition of GalNAc moiety, and inverted abasic nucleotide (invAB), which also improves serum stability and RNAi activity, to a siRNA duplex, a skilled artisan would expect reasonable success by modifying a chemical modification pattern of, along with GalNAc and invAB additions to a siRNA duplex that is found to inhibit expression of target gene in vitro. Foster Fig. 3b (see excerpt below) illustrates the reasonableness in predicting successful outcome. Foster demonstrates improvement of three duplexes (Seq 1, Seq 3, Seq 4) targeting different regions of a transcript with varying inhibition levels for the parent drug, and following modification of 2OMe and 2F modification pattern (modification pattern DV18 and DV22) there is an improved potency at both time points tested (day 7 and 22).
PNG
media_image7.png
633
843
media_image7.png
Greyscale
Argument 4c) is addressing the reasonableness standard and what the Remarks refer to as “unpredictable”. Here, the Remarks point out that D-2208 and D-2216 had contrasting results with different modification pattern, even while maintaining the preferred 2OMe and 2F at noted positions. However, the reasonableness standard does not require that it is 100% predictable, i.e. without a doubt. But, rather, a skilled artisan would reasonably expect success. Between the two (D-2208 and D-2216), there was a 50% success rate, which, arguably, would appear to satisfy the reasonable standard. Additionally, it also goes to the unpredictable-ness that the Remarks highlight. The Examiner believes it is variability as opposed to unpredictable. Foster points out results with varying outcomes based on changes to the chemical modification pattern (e.g., see Fig. 2). And further, a skilled artisan can decrease the risk of unpredictability by further modification(s), i.e. inclusion of a GalNAc moiety and invAB nucleotide, former to focus the delivery to the target organ and latter to improve RNAi processing and increasing stability. Tremblay lacked those two modifications, while instant claimed compounds has them.
Now addressing the unexpected results of argument 5): The Applicant argues that there is a significant difference between the potency of Tremblay’s AD-890305.1 compound and instant claimed compounds: “the claimed compounds are effective some 100 time more potent (IC50 value of 227 to 390 pM) than the AD-890305.1 compound” (pg. 18)” and argues that it “would not be correct to presume that simply applying chemical modifications to a compound, such as AD-890305.1, would produce the advantageous results seen with the claimed compounds” (pg. 18). The Remarks then note the differences in outcome of Tremblay’s modified siRNA, i.e. noting that cited siRNA (AD-890305.1) is less effective in vitro and noting that other Tremblay’s siRNAs required a higher dose in vivo (pg. 18-19). The Remarks note use of lower doses being potent for a longer duration than Tremblay’s noted duplex (e.g., 0.5mg/kg, 90% inhibition at 4 wks. (pg. 18). “Thus, even compounds with modified sense and antisense strands did not approach the efficacy and potency of the claimed compounds” (pg. 19).
The argument is not persuasive and the results are not unexpected.
Again, in view of prior art, including Foster, the results noted are not unexpected. Here, the Remarks compare instant results with Tremblay’s without considering the obvious modifications, including those of Foster and McSwiggen, i.e. addition of GalNAc moiety and invAB nucleotide.
Further, the differences of potency can also be attributed to differences in methodology of the experiments. Instant specification in vivo mice studies transduced viral expression vector (AAV) containing a sequence encoding the human mARC1 protein in the animals. They overexpressed the target transcript. Meanwhile, Tremblay’s used siRNA targeting the endogenous mARC transcript (see Ex. 4, Tables 5-22, pg. 148 - 159).
Regardless, Foster’s Fig. 3 (noted above) results comparing a parent to an improved modified version of the parent (DV18, DV22) demonstrate improved potency, see, e.g., Seq 1 at day 22 improved potency by ~60 %, and a longer duration of the effect. Thus, simply applying chemical modifications to a compound can produce advantageous results; although Foster does not teach just any chemical modification pattern, it still has to follow the guidelines based on in silico and their additional experiments. Foster Fig. 4 (excerpt below) results comparing a parent siRNA duplex and an optimized version DV22 demonstrate that in mice “[r]elative to the parent, the optimized version yielded an increase in activity and duration in mice . . . DV22 demonstrated improved activity at all time points except day 0 and day 70” and in monkeys, a dose of 1mg/kg results in a “significant effect of design (DV 22 versus parent . . . ), with difference apparent beginning at day 8 post-dose and continuing through study end” (pg. 712, see Fig. 4). Thus, similar to results of claimed compound, here a low dose of 1mg/kg resulted in improved potency and duration of the potency.
PNG
media_image8.png
194
461
media_image8.png
Greyscale
Thus, the rejection of the claims are maintained.
Allowable Subject Matter
No claim allowed.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600